ID: 1083254398

View in Genome Browser
Species Human (GRCh38)
Location 11:61487236-61487258
Sequence CAAGGGTGAGGTCCGCTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083254384_1083254398 29 Left 1083254384 11:61487184-61487206 CCGGAGCCCCTGTGATCCTGACA 0: 1
1: 0
2: 1
3: 19
4: 380
Right 1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1083254387_1083254398 23 Left 1083254387 11:61487190-61487212 CCCCTGTGATCCTGACAGGGATC 0: 1
1: 0
2: 1
3: 18
4: 158
Right 1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1083254393_1083254398 -7 Left 1083254393 11:61487220-61487242 CCTGACCACCTACAACCAAGGGT 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1083254388_1083254398 22 Left 1083254388 11:61487191-61487213 CCCTGTGATCCTGACAGGGATCA 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1083254389_1083254398 21 Left 1083254389 11:61487192-61487214 CCTGTGATCCTGACAGGGATCAG 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1083254390_1083254398 13 Left 1083254390 11:61487200-61487222 CCTGACAGGGATCAGCGATACCT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083254398 Original CRISPR CAAGGGTGAGGTCCGCTTCC TGG Exonic
902206410 1:14871334-14871356 CAAGAGGGAGGTTTGCTTCCTGG + Intronic
903500865 1:23799650-23799672 CAAGGGTGAGGTCCTTTGCCAGG + Intronic
907441348 1:54480517-54480539 CAAGGCTGAGGCCAGATTCCAGG + Intergenic
908766744 1:67561140-67561162 CCAGGCTGAGGTCCACTTGCAGG + Intergenic
909833647 1:80225938-80225960 CAAGGGATAGGTCTGATTCCTGG - Intergenic
911097757 1:94069066-94069088 CCAGGGTGAACTCTGCTTCCTGG - Intronic
915224511 1:154402645-154402667 CCAGGGTGAGGTCTGGCTCCTGG - Intergenic
922289653 1:224199706-224199728 CAAGGGTGAGGACAGTGTCCTGG + Intergenic
922339810 1:224646318-224646340 CAAGGTTGAGGACAGCTGCCCGG + Intronic
1071566768 10:86675152-86675174 CAAGGGAGAGCTCAGCCTCCTGG - Intronic
1072740211 10:97904668-97904690 CCATGGGAAGGTCCGCTTCCGGG - Exonic
1073861244 10:107744113-107744135 CAATGGTGTGGTCAGTTTCCTGG + Intergenic
1075924189 10:126236853-126236875 CAAGGGGCAGGGCCGCCTCCTGG + Intronic
1076096037 10:127736038-127736060 CCAGGGCGAGGCCAGCTTCCAGG + Intergenic
1083254398 11:61487236-61487258 CAAGGGTGAGGTCCGCTTCCTGG + Exonic
1083609769 11:63999290-63999312 CGAGGGTGGGGTCCGCATCCCGG - Intronic
1084191598 11:67501901-67501923 CAAGGTTGAGTTCCGCTACTGGG - Exonic
1084900568 11:72307059-72307081 CAGAGCTGAGGTCTGCTTCCTGG + Intronic
1086541083 11:87913889-87913911 CAAGAATGAGGTCCTCTTGCCGG - Intergenic
1089581181 11:119482814-119482836 CAAGGGCCAGGTCAGATTCCAGG - Intergenic
1091209516 11:133844403-133844425 CAAGGGTGAGGTGCTCGTCTGGG - Intronic
1091918570 12:4286818-4286840 CATGTGTGAGGTGTGCTTCCCGG + Intronic
1093193766 12:16106076-16106098 CAAGGGTTAAGTCTGATTCCTGG + Intergenic
1099936684 12:89134359-89134381 CAAAGGTGAGTTCACCTTCCTGG - Intergenic
1107068306 13:36241898-36241920 TAAGGGGGAGGTCCGCCCCCAGG - Intronic
1108063270 13:46553406-46553428 AAAGGTTGGGGTTCGCTTCCCGG - Exonic
1113874231 13:113584726-113584748 CCAGGGTGAGCCCCGCGTCCCGG + Exonic
1114453742 14:22842605-22842627 CGATGGTGAGGGCGGCTTCCTGG + Exonic
1115880379 14:37910526-37910548 CAATGGGGAGGTCCCCATCCTGG - Intronic
1119513850 14:75232703-75232725 GGAGGTTGAGGTCCTCTTCCAGG + Intergenic
1119934648 14:78580479-78580501 CAAGGGTGAGCTCCTTTTCGTGG + Intronic
1121441623 14:93953334-93953356 CAAAGGTGAGGTCCCCACCCCGG - Exonic
1121635256 14:95449836-95449858 CCAGGGGAAGGTCCGTTTCCGGG - Intronic
1122759503 14:104012051-104012073 CAAGGCTCAGGTGAGCTTCCTGG - Intronic
1123862884 15:24486399-24486421 CATGGGTGAGCTCCACTTCCCGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1127395517 15:58541382-58541404 TAAGGGACAGGTCAGCTTCCAGG + Intronic
1128621515 15:69154818-69154840 CATGGGTGAGGTCAGCCTCATGG - Intergenic
1130255048 15:82322115-82322137 CACACGTGAGGTCCGCATCCAGG + Intergenic
1130599926 15:85267891-85267913 CACACGTGAGGTCCGCATCCAGG - Intergenic
1132674093 16:1114556-1114578 CAGGGGTGGGGGCTGCTTCCTGG + Intergenic
1133175338 16:4010205-4010227 CCTGGGTGAGGGCCCCTTCCTGG - Intronic
1133285868 16:4690430-4690452 CGAGCATGAGGTCCGCCTCCTGG + Exonic
1133416256 16:5609442-5609464 CAGAGGAGAGGTCAGCTTCCAGG + Intergenic
1134015188 16:10883226-10883248 CCAGGGTCAGGTTCCCTTCCAGG + Intronic
1135898263 16:26430384-26430406 CAAGGGTGAGGGCAGCATGCTGG + Intergenic
1135906765 16:26519166-26519188 CTTGGGTGAGGTCACCTTCCAGG + Intergenic
1140234774 16:73148351-73148373 CAAGGAAGAGTTCAGCTTCCTGG - Intergenic
1141470458 16:84234813-84234835 AAAGGATGATGTCCTCTTCCTGG - Intronic
1142707223 17:1703286-1703308 GAAGAGTGAGGTCAGCTCCCAGG - Exonic
1142779818 17:2172750-2172772 GAAGGGTGAGGTCATCATCCGGG + Exonic
1143023376 17:3927963-3927985 CAGGGGTGAGCTCCGGTTCCTGG - Exonic
1145863375 17:28225703-28225725 CAATTGAGAGGTCCTCTTCCTGG + Intergenic
1147927576 17:43955015-43955037 CAATTGAGAGGTCCTCTTCCTGG - Intronic
1148486130 17:47991856-47991878 CAAGGGTGAGGTCCTAGGCCAGG - Intergenic
1149867046 17:60156843-60156865 CATGGGGGAGGACAGCTTCCAGG + Intronic
1152323784 17:79624004-79624026 CAAAGGTGCGGTCTGTTTCCGGG - Intergenic
1159471765 18:68866901-68866923 CAAGGGTGAGATCCCACTCCAGG - Intronic
1159954857 18:74512058-74512080 CAAGGGCGAGGTCCGACCCCAGG + Intronic
1165136820 19:33674784-33674806 CCAAGGTCAGGTCTGCTTCCTGG - Intronic
1165720792 19:38078247-38078269 CAAGGGGGAGCCCCTCTTCCTGG - Intronic
1166806236 19:45488958-45488980 TCAGGGTGAGGTCCACATCCAGG + Exonic
926681996 2:15671174-15671196 GAAGGCTGAGGTCCCCTGCCAGG - Intergenic
928147935 2:28797293-28797315 TAGGGGGGAGGTCCTCTTCCTGG + Intronic
932413710 2:71561548-71561570 CATGGGTGAGGAAGGCTTCCTGG + Intronic
946410639 2:219513608-219513630 CAAAGGGGAGGTGTGCTTCCGGG - Intergenic
946418466 2:219552151-219552173 CGCCGGTGAAGTCCGCTTCCAGG - Exonic
948623220 2:239249971-239249993 CAAGGGGAAGCTCTGCTTCCGGG + Intronic
1168964660 20:1892182-1892204 CAAGGGTCAGGGCCCCCTCCAGG + Intergenic
1173433132 20:43009340-43009362 CAAGGATGAGGGCTGCCTCCTGG - Intronic
1175392798 20:58637657-58637679 CCAGGCTGAGGCCCGCCTCCAGG + Intergenic
1176011079 20:62896011-62896033 CTAGGGTCGCGTCCGCTTCCTGG - Intronic
1180959185 22:19755019-19755041 CAGGGGCCAGGTCCGCCTCCAGG - Intergenic
1181560536 22:23697167-23697189 ACAGGGTGTGGTCCCCTTCCTGG + Exonic
1181673905 22:24439678-24439700 CAGGGCTGAGGTCTGCTTACTGG + Intronic
1182590224 22:31373511-31373533 CTAGAGTGAAGTCCGCCTCCCGG - Intergenic
1185110292 22:48896733-48896755 GAAGGGTGAGGCCGGCATCCTGG + Intergenic
1185160024 22:49218811-49218833 CAAGAGTGAGGTGGGCCTCCTGG - Intergenic
950048857 3:9970643-9970665 CCAGGGTGAGTTCTGCATCCTGG - Exonic
953191477 3:40691535-40691557 TAAGAGTGGGGTCAGCTTCCCGG + Intergenic
954746736 3:52791703-52791725 CATGGGTGGGGTGAGCTTCCTGG + Intronic
956519060 3:70083603-70083625 CAAGGGGGAGGTCTTCTTCAAGG + Intergenic
961476647 3:127150973-127150995 CCAGGGTGTGGGCCGCTCCCTGG - Intergenic
965757794 3:172041902-172041924 CATGGGTGAGGTCCTTTTGCAGG - Intronic
970151972 4:13099374-13099396 CAAGGGGGAAGTCCCCTCCCAGG + Intergenic
975027718 4:69573129-69573151 CAAGGTTCAGGTACACTTCCAGG + Intergenic
983249309 4:165326984-165327006 CAAGGGAGAGTTCGGCTCCCAGG - Intergenic
987042681 5:14077599-14077621 CAAGGCTGAGGATCCCTTCCAGG + Intergenic
992592486 5:78309720-78309742 CAAGGTAGAGGTCTGCTTCATGG - Intergenic
993943838 5:94095124-94095146 CATGGTTGAGGTCAGCCTCCAGG + Intronic
999254240 5:150200958-150200980 CAAGGATGAAGGCCGGTTCCTGG + Intronic
1002559396 5:180071483-180071505 CAAGGCCGAGGTCCGCGGCCAGG - Exonic
1011828285 6:91336816-91336838 TAAGGGTGAGGTCCTAGTCCAGG - Intergenic
1015425986 6:133067931-133067953 CAAGGATGAGCTCAGGTTCCTGG + Intergenic
1017931756 6:158961595-158961617 CAAGGCTGAAGTCCTTTTCCTGG + Intergenic
1020076395 7:5261661-5261683 CATGGGTGAGGGCCGCTCCTAGG + Intergenic
1024965742 7:55020409-55020431 CCAGGATGAGCTCTGCTTCCGGG - Intronic
1025143432 7:56484227-56484249 CAAGGGCGAGGTGCACTTCGCGG - Intergenic
1025259066 7:57405056-57405078 CAAGGGCGAGGTGCACTTCGCGG - Intergenic
1026598323 7:71752704-71752726 GAAGGGTGAGAGCAGCTTCCGGG - Intergenic
1026879684 7:73900626-73900648 CAAGGGTGAGACCAGCTTCCAGG - Intergenic
1027690064 7:81333757-81333779 CAGGCGTGAGGTCCGCTGCGAGG + Intergenic
1027701552 7:81476212-81476234 CAAGGGTGAGGACCCTTTTCTGG + Intergenic
1029161058 7:98552222-98552244 CAAGGCTCAGGTGGGCTTCCTGG + Intergenic
1029545656 7:101209108-101209130 CAAGGCTGAGGACCGGTTTCTGG + Intronic
1035066097 7:156106023-156106045 CAAGGGTCAGGTCTCCCTCCTGG - Intergenic
1035078094 7:156194243-156194265 CCAGGGTTAGGGCCTCTTCCCGG - Intergenic
1037796786 8:22002190-22002212 CAGGGGTGTGGTCCTCTTCTTGG - Exonic
1038007406 8:23444414-23444436 CAAGGGTGAGGGTGGGTTCCTGG - Intronic
1039257331 8:35733809-35733831 CAGGGGTGAGGATGGCTTCCTGG + Intronic
1039897399 8:41725847-41725869 CAAGGGGAAGGTGCGCCTCCCGG - Exonic
1040894921 8:52355897-52355919 CAAGGGCTAGGGCAGCTTCCTGG + Intronic
1042027542 8:64440002-64440024 CAAGGGTGAGATTCCATTCCTGG + Intergenic
1046890397 8:119416043-119416065 CAAGCGTGGGGTCCCCTTACGGG - Intergenic
1048969573 8:139637846-139637868 CAGGGGTGAGGTCTGCTGCTGGG - Intronic
1052436515 9:28436869-28436891 CAAGGGTAAGGAACGGTTCCTGG + Intronic
1059344540 9:113619407-113619429 CCTGGGTGAGGTCAGCCTCCTGG + Intergenic
1060152954 9:121300203-121300225 CCAAGGTGAGGTTAGCTTCCTGG - Intronic
1060396403 9:123319727-123319749 CAAGGGTGGGGTCGGATTCCTGG - Intergenic
1192162885 X:68801889-68801911 GAAGTGTGAGGTCCCCTGCCAGG + Intergenic