ID: 1083256021

View in Genome Browser
Species Human (GRCh38)
Location 11:61495997-61496019
Sequence AACACAGAGGGGCCTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083256009_1083256021 30 Left 1083256009 11:61495944-61495966 CCCACAGCCTGCGGGTGCTGAGA No data
Right 1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG No data
1083256015_1083256021 -4 Left 1083256015 11:61495978-61496000 CCTTCACCTTTCCAGCAAGAACA No data
Right 1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG No data
1083256010_1083256021 29 Left 1083256010 11:61495945-61495967 CCACAGCCTGCGGGTGCTGAGAA No data
Right 1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG No data
1083256011_1083256021 23 Left 1083256011 11:61495951-61495973 CCTGCGGGTGCTGAGAATATCCG No data
Right 1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG No data
1083256014_1083256021 3 Left 1083256014 11:61495971-61495993 CCGTGGGCCTTCACCTTTCCAGC No data
Right 1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG No data
1083256016_1083256021 -10 Left 1083256016 11:61495984-61496006 CCTTTCCAGCAAGAACACAGAGG No data
Right 1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083256021 Original CRISPR AACACAGAGGGGCCTCCCTC TGG Intergenic
No off target data available for this crispr