ID: 1083256184

View in Genome Browser
Species Human (GRCh38)
Location 11:61496715-61496737
Sequence GAGAGTGCGAGCGCGCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083256184_1083256198 26 Left 1083256184 11:61496715-61496737 CCCGTGAGCGCGCTCGCACTCTC No data
Right 1083256198 11:61496764-61496786 CATCGCTTCCCTGGGGGTCTCGG No data
1083256184_1083256194 20 Left 1083256184 11:61496715-61496737 CCCGTGAGCGCGCTCGCACTCTC No data
Right 1083256194 11:61496758-61496780 CCACCCCATCGCTTCCCTGGGGG No data
1083256184_1083256190 18 Left 1083256184 11:61496715-61496737 CCCGTGAGCGCGCTCGCACTCTC No data
Right 1083256190 11:61496756-61496778 CCCCACCCCATCGCTTCCCTGGG No data
1083256184_1083256188 17 Left 1083256184 11:61496715-61496737 CCCGTGAGCGCGCTCGCACTCTC No data
Right 1083256188 11:61496755-61496777 TCCCCACCCCATCGCTTCCCTGG No data
1083256184_1083256192 19 Left 1083256184 11:61496715-61496737 CCCGTGAGCGCGCTCGCACTCTC No data
Right 1083256192 11:61496757-61496779 CCCACCCCATCGCTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083256184 Original CRISPR GAGAGTGCGAGCGCGCTCAC GGG (reversed) Intergenic