ID: 1083257698

View in Genome Browser
Species Human (GRCh38)
Location 11:61506725-61506747
Sequence CATAGTTGCCTCTGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083257695_1083257698 -1 Left 1083257695 11:61506703-61506725 CCATAAGGATAGAGGTCAGGATC No data
Right 1083257698 11:61506725-61506747 CATAGTTGCCTCTGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083257698 Original CRISPR CATAGTTGCCTCTGTGAGGT GGG Intergenic
No off target data available for this crispr