ID: 1083259922

View in Genome Browser
Species Human (GRCh38)
Location 11:61517384-61517406
Sequence CGGGCAGAAGGAGCTGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 295}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083259914_1083259922 8 Left 1083259914 11:61517353-61517375 CCTGCCTCCTTTCCCTGCACTGT 0: 1
1: 0
2: 9
3: 90
4: 719
Right 1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG 0: 1
1: 1
2: 2
3: 22
4: 295
1083259918_1083259922 -4 Left 1083259918 11:61517365-61517387 CCCTGCACTGTGAGTGAGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG 0: 1
1: 1
2: 2
3: 22
4: 295
1083259915_1083259922 4 Left 1083259915 11:61517357-61517379 CCTCCTTTCCCTGCACTGTGAGT 0: 1
1: 0
2: 2
3: 34
4: 344
Right 1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG 0: 1
1: 1
2: 2
3: 22
4: 295
1083259912_1083259922 20 Left 1083259912 11:61517341-61517363 CCTGGTCTTTTCCCTGCCTCCTT 0: 1
1: 0
2: 6
3: 58
4: 672
Right 1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG 0: 1
1: 1
2: 2
3: 22
4: 295
1083259913_1083259922 9 Left 1083259913 11:61517352-61517374 CCCTGCCTCCTTTCCCTGCACTG 0: 1
1: 0
2: 11
3: 91
4: 681
Right 1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG 0: 1
1: 1
2: 2
3: 22
4: 295
1083259920_1083259922 -5 Left 1083259920 11:61517366-61517388 CCTGCACTGTGAGTGAGTCGGGC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG 0: 1
1: 1
2: 2
3: 22
4: 295
1083259916_1083259922 1 Left 1083259916 11:61517360-61517382 CCTTTCCCTGCACTGTGAGTGAG 0: 1
1: 0
2: 2
3: 26
4: 267
Right 1083259922 11:61517384-61517406 CGGGCAGAAGGAGCTGCTCCCGG 0: 1
1: 1
2: 2
3: 22
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083259922 Original CRISPR CGGGCAGAAGGAGCTGCTCC CGG Intronic