ID: 1083262359

View in Genome Browser
Species Human (GRCh38)
Location 11:61530206-61530228
Sequence AAGAGCAAGGCGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 374}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083262359_1083262371 28 Left 1083262359 11:61530206-61530228 CCTTCCACCTGCGCCTTGCTCTT 0: 1
1: 0
2: 1
3: 31
4: 374
Right 1083262371 11:61530257-61530279 CCCCGGTCCTGCCTAGTTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 83
1083262359_1083262363 0 Left 1083262359 11:61530206-61530228 CCTTCCACCTGCGCCTTGCTCTT 0: 1
1: 0
2: 1
3: 31
4: 374
Right 1083262363 11:61530229-61530251 GCCCTCAGATCTACAGTCTGAGG 0: 1
1: 0
2: 1
3: 14
4: 140
1083262359_1083262367 25 Left 1083262359 11:61530206-61530228 CCTTCCACCTGCGCCTTGCTCTT 0: 1
1: 0
2: 1
3: 31
4: 374
Right 1083262367 11:61530254-61530276 TTACCCCGGTCCTGCCTAGTTGG 0: 1
1: 1
2: 0
3: 7
4: 26
1083262359_1083262366 11 Left 1083262359 11:61530206-61530228 CCTTCCACCTGCGCCTTGCTCTT 0: 1
1: 0
2: 1
3: 31
4: 374
Right 1083262366 11:61530240-61530262 TACAGTCTGAGGCTTTACCCCGG 0: 1
1: 0
2: 1
3: 16
4: 123
1083262359_1083262369 27 Left 1083262359 11:61530206-61530228 CCTTCCACCTGCGCCTTGCTCTT 0: 1
1: 0
2: 1
3: 31
4: 374
Right 1083262369 11:61530256-61530278 ACCCCGGTCCTGCCTAGTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1083262359_1083262368 26 Left 1083262359 11:61530206-61530228 CCTTCCACCTGCGCCTTGCTCTT 0: 1
1: 0
2: 1
3: 31
4: 374
Right 1083262368 11:61530255-61530277 TACCCCGGTCCTGCCTAGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083262359 Original CRISPR AAGAGCAAGGCGCAGGTGGA AGG (reversed) Intronic
900479493 1:2891223-2891245 AAGAGGAAGCCGCAGGAGGGAGG + Intergenic
900501248 1:3005752-3005774 AAGAGCCCAGCGCAGGGGGAAGG - Intergenic
900676459 1:3890049-3890071 AAGATGAAGACGCAGGTGGGAGG + Exonic
900970514 1:5990101-5990123 AGGAGCAAGGAGCAGGTGGAAGG - Intronic
901171255 1:7259272-7259294 AAGTGCAAGGAGGACGTGGAAGG - Intronic
901443377 1:9292832-9292854 AAGAGAAAAGCGCCGGTGGGCGG - Intergenic
901903075 1:12383653-12383675 AATAGAAAGGTACAGGTGGAGGG + Intronic
903282381 1:22257392-22257414 AGGAGGAAGGGGCAGGGGGAGGG - Intergenic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
904555546 1:31360696-31360718 AAGATGAAGGCTCAGGAGGAGGG - Intronic
905908071 1:41633003-41633025 AGGAGAAAGGATCAGGTGGAAGG + Intronic
906199350 1:43949090-43949112 GAGGGCAAGGCCCAGGTGGAAGG - Intronic
908221534 1:62011814-62011836 AAGAGAAAGGTGCAGTTGTATGG + Intronic
908445524 1:64196295-64196317 AAGGTCAAGGGGCAAGTGGAGGG - Intergenic
908470361 1:64438226-64438248 AAGAGAAAGGGCCAGGTGCAGGG - Intergenic
908528252 1:65008634-65008656 AAGAGGAAGGCGAAGGGGAAGGG - Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910704237 1:90109869-90109891 AAGAGAAAAGGGCAAGTGGAGGG - Intergenic
911381778 1:97124207-97124229 TAGAGCAGGGCGGGGGTGGAGGG - Intronic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912147412 1:106810082-106810104 AAGAGCAAGTCACATGTGGATGG - Intergenic
912209404 1:107542351-107542373 ATGAGCAAGTCCCAGGGGGAAGG - Intergenic
915287522 1:154862426-154862448 AAGAGCAAGGTGGAGGTGAGGGG + Intronic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
916514152 1:165499614-165499636 AACAGCAAGGCCAAGGTGGGGGG + Intergenic
916717574 1:167458146-167458168 CTGAGCAGGGCACAGGTGGAAGG - Intronic
917021356 1:170591668-170591690 AAGAGAAAGGCTCAGGAAGATGG + Intergenic
917336491 1:173928996-173929018 AAGAGCAAGGAGCAGTGAGATGG - Intergenic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919819336 1:201463099-201463121 AAGGGCAGAGGGCAGGTGGAGGG - Intergenic
920040120 1:203090106-203090128 AGGAGCAGGGAGCAGGTGAAGGG - Intergenic
921179677 1:212622154-212622176 AAGCCAAAGGGGCAGGTGGAAGG - Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922737752 1:227998430-227998452 AAGAGGAAGCTGCAGGTAGAGGG + Intergenic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923118578 1:230968565-230968587 TAGAGCAGGGGGCAGGTGGGAGG + Intronic
923139401 1:231148280-231148302 AAGACCATGGAGCAGGTTGAAGG - Intergenic
924707413 1:246511335-246511357 AAGAGGAAGGCCCAGGTAGTAGG + Intergenic
924788149 1:247219427-247219449 AAGATCAAGGGGCAGCAGGAGGG + Intergenic
924805028 1:247355105-247355127 AAGATCAAGGGGCAGCAGGAGGG + Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1065664337 10:28041725-28041747 GACAGCAAGGAGGAGGTGGAAGG + Intergenic
1069664274 10:70144654-70144676 AGGAGCAAGGGGCATGTGGGGGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1073959679 10:108912117-108912139 AGGAGCCCGGCGCAGGTGGTGGG + Intergenic
1073959733 10:108912371-108912393 AGGAGCAAGTCGCAGGCGGAGGG + Intergenic
1074759830 10:116658712-116658734 AAGAGCAGGGCGGAGGAGCAAGG + Intergenic
1076193198 10:128497597-128497619 AAGAGCAAGGTGCTGCTGGCTGG - Intergenic
1076825009 10:132962565-132962587 AAGGGCAAGCCGCAGGTAGAAGG - Intergenic
1078192827 11:9106572-9106594 AAGAGCAAGGAGCAAGGGGGAGG + Intronic
1078480635 11:11672366-11672388 TTGAGCAAGGCGGAGGTGCATGG - Intergenic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1083853554 11:65381045-65381067 GAGAGGAAGGCACAGGTGGGAGG - Intronic
1083893375 11:65607939-65607961 AAGGGCTCGGGGCAGGTGGATGG + Exonic
1084365359 11:68694010-68694032 TAGAGCAAGTAGGAGGTGGACGG - Intergenic
1085530896 11:77191440-77191462 AAGAGCATGGCACAGGCTGATGG + Intronic
1085940107 11:81198168-81198190 AAGATCAAGGGGCAGCAGGAGGG + Intergenic
1086216365 11:84387070-84387092 AAGAGCAAGGAAGAGGTGGTGGG - Intronic
1086407689 11:86512797-86512819 GAGAGCAAGGTCCAGGTGAAGGG + Intronic
1087528049 11:99343126-99343148 AATAGCAAGCTGCAGGTGGCTGG + Intronic
1089175805 11:116547975-116547997 AAGAGGGAGGCACAGGTGGAGGG - Intergenic
1089849254 11:121482231-121482253 AAGAGCAAGGGGAAACTGGAGGG + Intronic
1089906643 11:122046786-122046808 AAGAGAAACACGCAGGTGAAAGG - Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091769653 12:3142635-3142657 AAGAGCATGGCGCAGGGGGCAGG - Intronic
1091792907 12:3281633-3281655 AAGAGCGAGGACGAGGTGGAAGG + Intronic
1091931503 12:4399326-4399348 GAGAGCATGGGGCAGGGGGAGGG + Intergenic
1092218126 12:6696410-6696432 AGGAGGAAGGTGCTGGTGGATGG - Intronic
1092284510 12:7121118-7121140 AAGAGCAGGGAGCCGCTGGAGGG + Intergenic
1092702574 12:11248466-11248488 AAGAGCAAGGGGCAGCTTCATGG - Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1094841731 12:34345178-34345200 GAGGCCAAGGCACAGGTGGAAGG - Intergenic
1098429354 12:70402701-70402723 AGGAGAAATGCACAGGTGGACGG + Intronic
1099749001 12:86746685-86746707 AAGAGCGAGGAGCATGTAGAAGG - Intronic
1100328950 12:93568187-93568209 AAGAGAAATGTGCAGGGGGAAGG + Intergenic
1100342247 12:93690396-93690418 TACAGCAAGGCCCAGGTTGAGGG + Intronic
1101786020 12:107884310-107884332 TAGAGGGAGGCGGAGGTGGAAGG - Intergenic
1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG + Intergenic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1104586262 12:130050424-130050446 AAAAGCAAAGCTAAGGTGGAAGG - Intergenic
1104864333 12:131943959-131943981 AAGAGAAAGGCCCAGGAGGTTGG + Exonic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1107523429 13:41205687-41205709 AAGAGCAAGAAGCAGGGGAAGGG - Intergenic
1108144537 13:47463205-47463227 AAGACCAAGGTTCATGTGGAAGG + Intergenic
1108275381 13:48804119-48804141 AAGGACAAGGGACAGGTGGATGG - Intergenic
1109798703 13:67347215-67347237 AAGATCAAGGGGCAGCAGGAGGG - Intergenic
1113337505 13:109391286-109391308 AACAGTAAAGTGCAGGTGGAGGG - Intergenic
1113679386 13:112232530-112232552 AAGGGCATGGAGCAGGTGGGTGG - Intergenic
1114236042 14:20824613-20824635 TAGAGGAAGGTGCAGGTGGTGGG + Intergenic
1114523380 14:23352507-23352529 AAGGGCAGGGGGCAGGTGGGAGG + Intronic
1115058874 14:29166836-29166858 AACAGCAAGGTGGAGCTGGATGG - Intergenic
1115466965 14:33725963-33725985 AAGAGAAAGTGGGAGGTGGAGGG - Intronic
1117495237 14:56295862-56295884 AAGAGCAAGTCTCAGCAGGATGG + Intronic
1119261656 14:73241328-73241350 AAGGCCAAAGCCCAGGTGGAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119343033 14:73897022-73897044 AACAGGAAGGAGCAGCTGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1202856922 14_GL000225v1_random:57772-57794 AAGAGGAAGGGGCAGGGCGAAGG - Intergenic
1125262349 15:37841491-37841513 CATAGCATGGCGCAAGTGGAAGG + Intergenic
1125767855 15:42147058-42147080 AGAAGCAAGGGGCGGGTGGAAGG + Intronic
1125782756 15:42285173-42285195 AAGAGCAAGGATGTGGTGGAAGG + Intronic
1125891060 15:43267605-43267627 GGGAGAAAAGCGCAGGTGGAAGG + Intergenic
1127296232 15:57610972-57610994 AAGACCAAGAAGAAGGTGGACGG + Intronic
1128019876 15:64381157-64381179 AAGAGGAAGTCGCAGGGGCAGGG - Intronic
1129367416 15:75064849-75064871 AAGATCAAGGGGCAGCAGGAGGG + Intronic
1130518469 15:84644370-84644392 AAGAGCCAAGCTCAGGTAGAGGG - Intronic
1130532952 15:84761378-84761400 AAGAGCAAGGACCAGGGGGTCGG + Intronic
1130678890 15:85979282-85979304 TAGAGGAACACGCAGGTGGAAGG - Intergenic
1130684059 15:86021830-86021852 AGGAGCCAGGCCCTGGTGGAAGG + Intergenic
1131897125 15:97045786-97045808 AATAGCAATGTGCAGCTGGAAGG + Intergenic
1132014986 15:98307572-98307594 AAGAGGAAGGTGGAAGTGGATGG + Intergenic
1132461577 16:57892-57914 AAGAGCAAGGTGCACGTGCCTGG + Intergenic
1133973463 16:10583159-10583181 AATAGCAAGTAGCAGGTGAATGG - Intergenic
1134112399 16:11523859-11523881 AGGAGCAGGGAGCAGGTGGGTGG - Intergenic
1134805463 16:17120393-17120415 TGGAGCAAGGAGCAAGTGGAAGG - Intronic
1136060556 16:27723475-27723497 AAGCGCAAGGGGCAGGGGGCAGG - Intronic
1136109127 16:28053593-28053615 AAGAGCAAGGCGAGGCGGGAAGG + Intronic
1136265284 16:29113429-29113451 AAGAGGAAGGCACAGCTGGAAGG - Intergenic
1137374560 16:47941604-47941626 AAGAGGAAGGAGTAGGGGGAGGG + Intergenic
1137382926 16:48015196-48015218 AGGAGCAAGGGGCCGGGGGAGGG + Intergenic
1138106050 16:54287499-54287521 AGGAGCAGGGCGCCGGGGGACGG + Intergenic
1138385955 16:56635751-56635773 GACCGCAAGGCGCACGTGGACGG - Intergenic
1139432319 16:66917837-66917859 AAGACCAGAGCGCGGGTGGATGG - Intronic
1139747614 16:69087236-69087258 TAGAGCAAGGGGGTGGTGGATGG - Intergenic
1139747842 16:69088794-69088816 AAGAGCAGGTCTCAGGAGGAAGG + Intergenic
1140346716 16:74220400-74220422 AAAAGTAATGAGCAGGTGGAGGG + Intergenic
1141391263 16:83666673-83666695 AAGAGCAAAGGCCAGGTGGCGGG - Intronic
1142054088 16:87981361-87981383 AAGAGGAAGGCAGAGCTGGAAGG - Intronic
1142164780 16:88580415-88580437 AAGAGCCAGTCACAGATGGAAGG + Intronic
1142610439 17:1106862-1106884 CAGAGCAAGGGGCAGGTACAGGG - Intronic
1143205704 17:5138352-5138374 AAGAGGAAGGCCCAGGTAGTAGG - Intronic
1143953992 17:10654807-10654829 AAGCACAAGGACCAGGTGGAGGG + Intronic
1143963621 17:10740035-10740057 AAAAGTAAGGTGCAGGTGCAGGG + Intergenic
1144243379 17:13336174-13336196 TAGAGCAAGGTGCAGGGGTAGGG - Intergenic
1144876744 17:18401040-18401062 AAGAGGAAGGCCCAGGTAGTAGG - Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145155483 17:20543379-20543401 AAGAGGAAGGCCCAGGTAGTAGG + Intergenic
1146055581 17:29579148-29579170 AAGAGCAAGCCAGAGGAGGAGGG - Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146842914 17:36167443-36167465 AAGAGGAAGGCCCAGGTAGTAGG + Intronic
1146855219 17:36255384-36255406 AAGAGGAAGGCCCAGGTAGTAGG + Intronic
1146865401 17:36332991-36333013 AAGAGGAAGGCCCAGGTAGTAGG - Intronic
1146871125 17:36379295-36379317 AAGAGGAAGGCCCAGGTAGTAGG + Intronic
1146878485 17:36430377-36430399 AAGAGGAAGGCCCAGGTAGTAGG + Intronic
1146882433 17:36451523-36451545 AAGAGGAAGGCCCAGGTAGTAGG + Intergenic
1147068262 17:37933585-37933607 AAGAGGAAGGCCCAGGTAGTAGG - Intronic
1147074011 17:37979919-37979941 AAGAGGAAGGCCCAGGTAGTAGG + Intronic
1147079793 17:38013140-38013162 AAGAGGAAGGCCCAGGTAGTAGG - Intronic
1147085532 17:38059457-38059479 AAGAGGAAGGCCCAGGTAGTAGG + Intronic
1147095734 17:38137082-38137104 AAGAGGAAGGCCCAGGTAGTAGG - Intergenic
1147101479 17:38183423-38183445 AAGAGGAAGGCCCAGGTAGTAGG + Intergenic
1147145788 17:38483810-38483832 AATAGGAGGGGGCAGGTGGACGG + Intronic
1147210617 17:38870653-38870675 AAGCGCGGGGCGCTGGTGGAGGG + Intronic
1149195167 17:54110786-54110808 AAGAGAGAGGGGGAGGTGGAGGG + Intergenic
1149846078 17:60009929-60009951 AAGAGGAAGGCCCAGGTAGTAGG + Intergenic
1150084427 17:62266509-62266531 AAGAGGAAGGCCCAGGTAGTAGG + Intergenic
1150125550 17:62632390-62632412 GGGAGCAGAGCGCAGGTGGAAGG - Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1153815181 18:8784865-8784887 AAGAGCAAGGCGGAGCAGGGAGG - Intronic
1153954973 18:10088339-10088361 AAGAGCAGTGCCCAGGTGTAAGG + Intergenic
1154323856 18:13375822-13375844 AAGAGCAAGGCGCTGGCGGGCGG - Intronic
1155416512 18:25605075-25605097 AAGGGCAAGGGGCAGGTGCATGG + Intergenic
1157332758 18:46715351-46715373 AATTGCCAGGAGCAGGTGGAGGG + Intronic
1158884791 18:61816481-61816503 AAGGGCAAGGCCAAGGTGAAGGG + Exonic
1159286358 18:66358815-66358837 AAAACCAAGGCACAGGTGTATGG + Intergenic
1160731355 19:643010-643032 AGGAGCAAGGAGCAGGCAGAGGG - Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1161312511 19:3602791-3602813 AAGAGGGAGGCCCAGGTGGGCGG + Intronic
1161611046 19:5243056-5243078 AAGAGGCAGACGCAGGAGGATGG - Intronic
1163257748 19:16167944-16167966 AACAGCAAGGCCCATGTGGCTGG + Intronic
1163493799 19:17632922-17632944 AAGAGGATGGCACAGCTGGAAGG + Intronic
1164541942 19:29128024-29128046 AAGAGCAAGGGGAAAGCGGAGGG + Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1164990026 19:32676276-32676298 GAGTGCAAGGCGCTGCTGGACGG + Exonic
1166329506 19:42069975-42069997 AAGAGAAAGGCGGAGGAGGGTGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1168675145 19:58272316-58272338 CAGACCAAGGCCCAGGTGGAAGG + Intronic
925225774 2:2183109-2183131 AAAAGCATGGAGCAGTTGGAGGG + Intronic
926037414 2:9646400-9646422 GAGAGCAAGGGGCAGGGCGAGGG - Intergenic
926111735 2:10188163-10188185 ATGAGCAGGGCCCAGGTGGCTGG + Intronic
926389014 2:12368387-12368409 AAGACCAAGGTGGAGGTGGAAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
929034717 2:37679741-37679763 AAGAGGAAGGCACAGGAGGCTGG - Intronic
930970255 2:57386225-57386247 AAGAGGAAGGAGTAGTTGGAAGG + Intergenic
931586246 2:63832483-63832505 AAGAGCAAGGGGCACAGGGATGG + Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932064067 2:68534598-68534620 AAGAGCATGGAGCTGGTAGAGGG - Intronic
932285180 2:70525606-70525628 AGAAGCAAGGGGCAGGAGGAGGG + Intronic
933012767 2:77088726-77088748 AGGAGCAAAGAGCAGGAGGACGG - Intronic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
936542529 2:113363795-113363817 AAGTGCAGGGAGCAGGTGGGAGG - Intergenic
936607991 2:113976713-113976735 AAGTGCATGGTGCAGGAGGAAGG - Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937250638 2:120521688-120521710 AGCTGCAAGGGGCAGGTGGAGGG - Intergenic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
937905030 2:127049017-127049039 AAGGGCAAGTCGAAGTTGGAGGG - Intronic
938373933 2:130791890-130791912 GAGAGCATGGGGCAGGTGCAGGG - Intergenic
939252407 2:139698770-139698792 AAGAGCAAAGCCCAGGCTGAGGG - Intergenic
939355446 2:141095755-141095777 AAGACCAAAGGGCAGCTGGATGG - Intronic
939995028 2:148911964-148911986 AAGAGGGAGGGGCAGGAGGAAGG - Intronic
941262787 2:163318221-163318243 AGGATCCAGGCCCAGGTGGAGGG - Intergenic
941686977 2:168456868-168456890 GAGAGCAGGGCCCAGGAGGAGGG - Intronic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
943325551 2:186493391-186493413 AAGAGAAAAGAGCAGGTAGAAGG - Intronic
944176094 2:196830794-196830816 AAGATCAAGGGGCAGCAGGAGGG - Intergenic
945047554 2:205795198-205795220 AAAAGCGAGTCGCAGGAGGAAGG + Exonic
946326529 2:218987301-218987323 AAGATCAAGACTCAGGTGGGTGG - Intergenic
947052726 2:226064664-226064686 AGGAGCAAGACGGAGGTGGTAGG - Intergenic
947389989 2:229628966-229628988 AAGAGGAAGGAGCAGGGTGAGGG - Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947966603 2:234287425-234287447 AAAAGTAAGGCCCAGGTGCAGGG + Intergenic
948498407 2:238370805-238370827 AAGAGAAAGGGGGAAGTGGAAGG + Intronic
1169277829 20:4245446-4245468 AAGAGGAAGGGACAGGAGGAGGG + Intronic
1169473749 20:5911561-5911583 AGAAGCGAGGCGCAGGAGGAAGG - Exonic
1170317650 20:15060361-15060383 AAGAGCAAGACGCAGGGTGGAGG - Intronic
1171235510 20:23521094-23521116 AAGAGCCAGGAGCAGGTGGGTGG + Intergenic
1171779804 20:29408717-29408739 AAGAGCAAGGGACAGAGGGATGG - Intergenic
1172325159 20:34028931-34028953 AAGAGCAAGGCTGAGGTGACTGG + Intronic
1172446335 20:34995384-34995406 AAGTCCAAGGTGCAGCTGGAGGG + Exonic
1172473359 20:35217943-35217965 GACAGCAAGGCGCACGTGGACGG - Intergenic
1172842918 20:37912783-37912805 GAGAGTAAGGGGCCGGTGGAGGG - Intronic
1172925049 20:38526353-38526375 AAGAGAAAGAGGCAGGAGGAAGG - Intronic
1173474906 20:43352088-43352110 AAGAGAAAGGGGGAGGTGGGAGG + Intergenic
1173909745 20:46657818-46657840 AGGAGCAAGGCGCTGGGGGGAGG + Intronic
1174294326 20:49534020-49534042 AAGAGCAAGCTGCAGGCAGAGGG - Intronic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1177655322 21:24009516-24009538 AAGAGCAAGAATTAGGTGGATGG + Intergenic
1178886754 21:36490776-36490798 CAGAGAAAGGCCCAGGTGGGAGG - Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1179477661 21:41658233-41658255 AAGGGCAAGGCAGAGGTAGAAGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180639465 22:17286778-17286800 AAGAGCAGATCGCAGGTGGTGGG + Intergenic
1181407056 22:22692535-22692557 AAGAGCAAGGGGCAGATGTGTGG - Intergenic
1181418566 22:22779723-22779745 AAGAGGAAGACAGAGGTGGAGGG + Intronic
1181471434 22:23142681-23142703 AAGAGCAAGGGGCATGGGCAGGG - Intronic
1181666881 22:24404665-24404687 AACAGCCAGGAGCAGGGGGAGGG - Intronic
1182351351 22:29701796-29701818 AAGCTCAGGGTGCAGGTGGAGGG - Intergenic
1182425677 22:30270831-30270853 AAGAGGAAGGCATAGCTGGAGGG + Intergenic
1183177180 22:36232822-36232844 AAGAGCAGGGTCCAGGAGGAGGG - Intronic
1183189352 22:36311840-36311862 AACAGCATGGAGCAGGTGAAGGG + Intronic
1184094986 22:42311580-42311602 AGGAGCAAGGTGCAGTTGAAGGG + Intronic
1184977934 22:48076320-48076342 GAGAGCAAGGCCCAGAAGGAGGG + Intergenic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185338440 22:50281133-50281155 AAGATCAAGTCCCAGCTGGAGGG - Exonic
1185343795 22:50302744-50302766 AGGGGCAAGGGGCAGGTGGTGGG - Intronic
949883738 3:8679326-8679348 AAGAGCAAGGGGCGGGAAGAGGG - Intronic
949928608 3:9060857-9060879 AGGTGCAAGGTGCAGGTGTAAGG - Intronic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950566443 3:13772403-13772425 AAGAGCCAGGCAAAGGTGTAGGG + Intergenic
951726602 3:25767489-25767511 AAGAAAGAGGTGCAGGTGGAGGG + Intronic
952968576 3:38636673-38636695 CAGAGCCAGGTGCAGGTGGTGGG - Intronic
953454663 3:43032133-43032155 AAGAGCACAGCCCAAGTGGAGGG - Intronic
953910598 3:46890934-46890956 AAGAGGAGGGCACAGCTGGAGGG + Intronic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954812804 3:53258238-53258260 GAGAGAAAGGAGCAGGTGAAAGG - Intergenic
956009634 3:64817047-64817069 AAGAGAAAGGAGCTGGGGGAGGG - Intergenic
956272422 3:67462199-67462221 AAGAAAAAGGAGCAGGTGAAAGG - Intronic
957085311 3:75671787-75671809 AAGAGCAAGGGACAGAGGGATGG + Intergenic
957687735 3:83524566-83524588 AAGAGCAAAGCAGAGGGGGATGG - Intergenic
958912862 3:100013974-100013996 AGGAGCAAGGGGCAGTGGGAAGG - Intronic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
960726684 3:120677410-120677432 AAGAGACAGGCGCACCTGGAGGG - Intronic
961091555 3:124117140-124117162 AAGATCAAGTGGCAGATGGAAGG + Intronic
961311792 3:126007047-126007069 AAGAGCAAGGCAGAGCTGGGTGG - Intronic
966425494 3:179775852-179775874 GAGGGAGAGGCGCAGGTGGAGGG - Intronic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG + Intergenic
966974303 3:185071159-185071181 AGGAGGAAGGCGCAGATGCAGGG - Intergenic
968424036 4:509515-509537 AGAAGCCAGGCGCAAGTGGAAGG - Intronic
969462822 4:7337806-7337828 AGGGGGAAGGTGCAGGTGGAAGG - Intronic
970092555 4:12426887-12426909 AAGAGGAAGGTGCAGGCGGTGGG + Intergenic
970678571 4:18481032-18481054 AAGAGCCAGGAGCAGGTGACAGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971241264 4:24891044-24891066 ATGAGCAAGGCGCAGTGAGAGGG - Intronic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
975618816 4:76275221-76275243 ATGAGCAAGGCTAAGGTGGCAGG - Intronic
975694084 4:76994358-76994380 AAGAGGAAGGGGCAGGTACAAGG + Intronic
977060995 4:92256669-92256691 AAGTGCAAGGAGCAGGAGAAGGG + Intergenic
977238283 4:94535315-94535337 AAGAGCAAGAGGAAGGTGAAAGG - Intronic
978314224 4:107418001-107418023 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
978941382 4:114440036-114440058 AAAAGCAAGGTGCAGGGTGAGGG - Intergenic
978970984 4:114806698-114806720 AAGATCAAAGTGCAGGTGAATGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981316610 4:143346473-143346495 AAGACTAAGGTGCTGGTGGAGGG + Intronic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
984609210 4:181819036-181819058 AAGAGCCAGAGGCAGGTGGATGG - Intergenic
985618448 5:938505-938527 GAGAGGAAGGCTCAGGGGGAAGG + Intergenic
985822375 5:2169071-2169093 AATTGCAAGGAGTAGGTGGAGGG - Intergenic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
986193103 5:5514893-5514915 AGCACCAAGGCCCAGGTGGATGG + Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
992549288 5:77845957-77845979 AAGAGCAAGGTGGAGGTGCAGGG + Intronic
994703856 5:103174645-103174667 GAGAGCAAGGTGCAAGTGCATGG + Intronic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
996065347 5:119072899-119072921 GAGAGCAATGCCCAGGTGTAAGG - Intronic
997064896 5:130548733-130548755 AAGATCAAGGGGCAGCAGGAGGG - Intergenic
997696306 5:135863808-135863830 AGGAGGAAGGAGCATGTGGAGGG + Intronic
997705047 5:135942558-135942580 AAGGGCAAGGGGCAGCTTGATGG - Intronic
998161456 5:139814966-139814988 AAGGGCCAGGGGCAGGTGGTGGG - Intronic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
998678272 5:144434968-144434990 AAGAGGAAGGCGCATGAGGAAGG + Intronic
999079970 5:148834028-148834050 ACTAGCAAGGGGCAGGGGGAGGG - Intergenic
999317639 5:150594500-150594522 CAGATCCAGGGGCAGGTGGAGGG - Intergenic
999392640 5:151205492-151205514 AACAGCAAGGCGTGGGTAGAGGG + Intronic
999992675 5:157063705-157063727 AAGAGCAGGGTGAAGGTGGTTGG + Intergenic
1002166889 5:177353331-177353353 AAGAGGAAGGCATTGGTGGAGGG - Intergenic
1002775142 6:322247-322269 AAAAGCAAGACGCTGGAGGATGG - Intronic
1002795094 6:465631-465653 AAGAGGATGGGGCAGGTGGCGGG - Intergenic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1004271883 6:14202951-14202973 ATGAGGCAGGCGCTGGTGGACGG + Intergenic
1004424986 6:15501155-15501177 AAGCGCAAGGGGCCGCTGGAAGG + Exonic
1004697236 6:18044854-18044876 AAGAGAAAGGCAAAGGTTGATGG + Intergenic
1006073886 6:31516716-31516738 AAGAGGAAGAAGCCGGTGGAGGG - Intergenic
1007257827 6:40541061-40541083 CAGAGCCAGGCACAGGTGCAGGG + Intronic
1008768378 6:54948074-54948096 AAGAGCATGGAGCAGGTGAAAGG + Intergenic
1012602052 6:101110910-101110932 AAGAGAAAGGCGCAGCTGGGAGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017907969 6:158769779-158769801 AAGAGCCAGGAGCAGCTGGTAGG - Exonic
1019506709 7:1395082-1395104 AAGAGGAGGCCTCAGGTGGATGG - Intergenic
1019646889 7:2135616-2135638 CAGAGGAAGGCTCAGGTGGTGGG + Intronic
1021626291 7:22596039-22596061 AAGAGGAAGGAGCAGCTGGCAGG + Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022481005 7:30743032-30743054 AAGAAAGAGGCGCAGGAGGAGGG - Intronic
1023280692 7:38566055-38566077 AAGGGAAAGGAGCAGGTGGTGGG - Intronic
1024527866 7:50363836-50363858 GACAGCAAGGTGGAGGTGGATGG - Intronic
1024596454 7:50941535-50941557 AAGAACACAGCGCAGGGGGATGG + Intergenic
1024979469 7:55145307-55145329 AAAAGCCATGCACAGGTGGATGG - Intronic
1026869551 7:73842124-73842146 AGGAGCATGGCCCAGGAGGAGGG - Exonic
1027184329 7:75961463-75961485 AGGAGCAAAGCACAGGTGCAGGG - Intronic
1027336178 7:77152844-77152866 AAGAACAAGGCACTGGTGGGAGG + Intronic
1028334029 7:89629083-89629105 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
1029373783 7:100166186-100166208 AAGAGTAAGGGGCACCTGGAGGG + Intronic
1029779611 7:102718258-102718280 AAGAACAAGGCACTGGTGGGAGG - Intergenic
1030302884 7:107992111-107992133 GAGAGCAAGGCACTGGTGGTGGG - Intronic
1032009237 7:128331415-128331437 AAGAGCAAGCCTCAGGAAGAGGG - Intronic
1032301337 7:130690099-130690121 AGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1032779003 7:135147297-135147319 AAGAACTAGGGGCAGGGGGAGGG + Intronic
1034202865 7:149293424-149293446 AAGAGGAAGGGGCAAGTGGGAGG + Intronic
1034997410 7:155586944-155586966 AGGATGAAGGCGCAGGTGGTGGG - Intergenic
1035758284 8:2050333-2050355 AAGAGCCCGGGGCAGGTAGAAGG - Intronic
1036513495 8:9422079-9422101 AGGAGCAGGGCCGAGGTGGAGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036655272 8:10673693-10673715 AAGAGCAAGTCCCAGGAGGAGGG + Intronic
1037825876 8:22160262-22160284 AAGGGCAGGGCCCAGGTGGGAGG + Intronic
1038052967 8:23830754-23830776 AAGAGGGTGGCACAGGTGGATGG + Intergenic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1039551992 8:38450229-38450251 AAGAGCCAGGCCCAGGAGGAAGG + Intronic
1041085082 8:54249477-54249499 AAGAGCAAGGGTCAGGAGGTGGG - Intergenic
1041348916 8:56929490-56929512 AAGAGCAAGGTGCAGGTCAGTGG + Intergenic
1041511711 8:58660191-58660213 AGGAGCAAGGAGCAGGTGTTCGG + Intergenic
1042488291 8:69370690-69370712 AAGAGGAAAGCGCTGGAGGAGGG - Intergenic
1043420110 8:80089041-80089063 AAGATCAAGGTGCTGGTGGCAGG - Intronic
1043584961 8:81758210-81758232 AAGAGGAAGGCACATTTGGAAGG - Exonic
1045064755 8:98435370-98435392 AAAAGCAAGGTGCAGATGGGGGG + Intronic
1048299231 8:133239183-133239205 AAGAGCATGTGGCTGGTGGACGG - Intronic
1048817147 8:138344451-138344473 AATAGCCAAGCGCAGGTGGGAGG - Intronic
1048995168 8:139789650-139789672 AAGAGCCAGGAACATGTGGACGG - Intronic
1050755121 9:8992812-8992834 AAGTGCAAGGAGCAGTTAGAGGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052536595 9:29755698-29755720 AGGTGCAAGGGGCAGGTGGGTGG + Intergenic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1056051867 9:82777495-82777517 AATATCAAGGCACAGATGGAGGG - Intergenic
1056083691 9:83123620-83123642 AAGAGCACGGCTCAGTGGGAAGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056779476 9:89538700-89538722 AAGAGCAGGGCCCTGGTGGCAGG + Intergenic
1056943844 9:90977239-90977261 AAGAGCAAGGCGGTGGAGCAGGG + Intergenic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057755582 9:97832287-97832309 AAGAGCAGGGCTCAGGTGCTTGG - Intergenic
1058904052 9:109467087-109467109 AAGGGCAAGGCGGAGGTGGTGGG - Intronic
1059153139 9:111967043-111967065 AAGAGTAAGGCTCAGAAGGAAGG + Intergenic
1060561451 9:124548133-124548155 AAGAGCAAGGGGGAGGGGGGAGG + Intronic
1060745408 9:126127725-126127747 AAGATCAAGGCTCAGGTGTGTGG - Intergenic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061354561 9:130094582-130094604 AAGAGAAAGAGGCAGATGGAAGG + Intronic
1062000187 9:134211971-134211993 AAGAGCAAGCCTCAGGTGCAGGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1185790924 X:2928220-2928242 AAGGCCAAGGCGCCGGGGGATGG + Intronic
1186390658 X:9155513-9155535 AAGAGCAAGGGGCTGGAGCATGG - Intronic
1186456218 X:9712112-9712134 AAGAGGAAGAGGCAGGTGGAAGG - Intronic
1187381665 X:18807478-18807500 AAGAGCAAGAAGAGGGTGGAAGG - Intronic
1188057950 X:25563415-25563437 AGGAGCAAGGGGGAAGTGGAAGG + Intergenic
1188061477 X:25606561-25606583 AAGAGTAAGGTGCAGGTTCATGG - Intergenic
1190918017 X:54824509-54824531 AGGAGCGTGGGGCAGGTGGAAGG + Intergenic
1191148170 X:57190651-57190673 GAGTGCAAGGAGCGGGTGGAGGG - Intergenic
1193217452 X:78880876-78880898 AGGATCAAGGTGCAGGGGGAGGG + Intergenic
1195676895 X:107513427-107513449 AATGGCAAGGGGCAGGAGGATGG - Intergenic
1199817363 X:151410872-151410894 AAGAGCAGGGCGTATGTGAAAGG - Intergenic
1200135276 X:153871710-153871732 GAGACCAAGTCGGAGGTGGAGGG + Intronic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic