ID: 1083262435

View in Genome Browser
Species Human (GRCh38)
Location 11:61530546-61530568
Sequence GATCCCTCTGCCAGTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083262435_1083262441 -1 Left 1083262435 11:61530546-61530568 CCTGACCCACTGGCAGAGGGATC 0: 1
1: 0
2: 2
3: 12
4: 116
Right 1083262441 11:61530568-61530590 CGAGCACCTGGGGCATAGCATGG 0: 1
1: 0
2: 0
3: 6
4: 146
1083262435_1083262442 0 Left 1083262435 11:61530546-61530568 CCTGACCCACTGGCAGAGGGATC 0: 1
1: 0
2: 2
3: 12
4: 116
Right 1083262442 11:61530569-61530591 GAGCACCTGGGGCATAGCATGGG 0: 1
1: 0
2: 0
3: 23
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083262435 Original CRISPR GATCCCTCTGCCAGTGGGTC AGG (reversed) Intronic
900979584 1:6038892-6038914 CATCCCTTTGCCTGTGGGTGTGG + Intronic
902868249 1:19295416-19295438 GATTCCTATGCCACTGGGTAGGG + Intergenic
903265597 1:22156236-22156258 GATCCATCTGAGAGTGGTTCAGG + Intergenic
903324865 1:22563841-22563863 GATCCCTCGGCCCGGGGGGCGGG + Intronic
903907056 1:26695349-26695371 GGGCCCGCTGCCAGGGGGTCAGG + Intergenic
906520774 1:46465758-46465780 GGTGCCTGTGCCTGTGGGTCTGG + Intergenic
915907904 1:159892476-159892498 AATGCCTCTGCCAGTGGGGAAGG - Intronic
917052625 1:170941044-170941066 GGTCCTTCTAACAGTGGGTCCGG - Intronic
919755393 1:201062970-201062992 CATCCTCCTGCCAGTGGGGCGGG + Intronic
922022174 1:221716384-221716406 AGTCCCTCTGCCAGAGGGGCAGG + Intronic
1067430565 10:46240826-46240848 GAGCACTCTGCCAGTGGGCCTGG + Intergenic
1067438835 10:46296889-46296911 CCTCCCTCTGCCCGTGGGACAGG + Intronic
1070247308 10:74744453-74744475 CCTCTCTCTGCCTGTGGGTCTGG + Intergenic
1080251031 11:30233926-30233948 GTTCCCTCTGCCAGTAGACCAGG - Exonic
1080310845 11:30889957-30889979 GAGCCCTATTCCAGTGGGACTGG + Intronic
1083262435 11:61530546-61530568 GATCCCTCTGCCAGTGGGTCAGG - Intronic
1083766286 11:64843085-64843107 GATCCTCCTGCCTGTGGGCCTGG - Intronic
1085783021 11:79426364-79426386 GGTCACTCTACCAGTGAGTCAGG - Intronic
1091308206 11:134554305-134554327 CATCCCTCAGCCTGTGGGCCAGG - Intergenic
1093732641 12:22583156-22583178 GCTCCCTCTCCCAGTGGATAGGG - Intergenic
1094184753 12:27629033-27629055 GAGCCCTCTGCCATTGGATGTGG - Intronic
1098749679 12:74278279-74278301 GATCCAACTTACAGTGGGTCTGG + Intergenic
1102528265 12:113527532-113527554 GATCCCTCTGGCAGTGCAGCAGG - Intergenic
1103668724 12:122593212-122593234 GTCCCCTCTGCTAGTGTGTCCGG - Intronic
1122313760 14:100813576-100813598 GATTCCTGTGGCAGTGGGTCTGG + Intergenic
1122347994 14:101072248-101072270 GACCCCTGTGCCAGCGGGCCTGG + Intergenic
1122965828 14:105125152-105125174 AATCCATCTGGCAGTGGGTCTGG + Intergenic
1127961213 15:63892360-63892382 CTTCCCACTGCCAGGGGGTCTGG - Intergenic
1130115830 15:81003174-81003196 GATCCCTGAGGCACTGGGTCAGG - Exonic
1130874403 15:87999934-87999956 GATCCCTAAGTCTGTGGGTCAGG - Intronic
1134076744 16:11297370-11297392 GTTACCTCTGCTAGTGGGGCCGG + Intronic
1135818919 16:25661941-25661963 GATGCCTCTGCTAGTGGGTAGGG - Intergenic
1137603830 16:49774245-49774267 CAGCCCTGGGCCAGTGGGTCAGG + Intronic
1137691387 16:50430405-50430427 GATTTCTCTGCCCGTGGGGCGGG - Intergenic
1141630133 16:85283190-85283212 CATGCCTCTGCCATTGGGCCCGG + Intergenic
1142271586 16:89092534-89092556 CAACCCTCTGCCACTGGGACAGG - Intronic
1146951544 17:36910137-36910159 GAGCCCTGTGGCAGTGGGGCAGG + Intergenic
1148043797 17:44729625-44729647 CAGCCTTCTGCCACTGGGTCAGG + Intronic
1148659424 17:49316596-49316618 GATCCCCCTTCCAGTGTGCCTGG + Intronic
1151706984 17:75774364-75774386 GATCCCTTTGTCAGCAGGTCTGG - Intergenic
1152286234 17:79414860-79414882 CAACCCCCTGGCAGTGGGTCTGG + Intronic
1152376922 17:79923493-79923515 GATCCGTGTGCCAGTGGCTAGGG + Intergenic
1152594205 17:81230395-81230417 GCTCCCTCTGCCAGCGGGACAGG + Intronic
1152642140 17:81453768-81453790 GACCCCTCTTCCCGAGGGTCAGG + Intronic
1152757225 17:82092073-82092095 CAGGCCTCTGCTAGTGGGTCAGG + Intronic
1158624372 18:59058635-59058657 GAGCCCACTGCCAGTAGGTCAGG + Intergenic
1159855768 18:73585926-73585948 GTTCCCCCTGCCAGTGGTGCTGG - Intergenic
1160507799 18:79437063-79437085 GAGCCGTCTGCGAGGGGGTCTGG + Intronic
1163984472 19:20932077-20932099 GATCCTTCTGCCTGTGGGTCTGG + Intronic
1164044806 19:21527720-21527742 GATTCTTCTGCCTGTGGGTGTGG + Intronic
1164076304 19:21822039-21822061 GGTCCTTCTGCCTGTGGGTGTGG - Intronic
1164224763 19:23233921-23233943 GGTCCTTCTGCCTGTGGGTGTGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1168721891 19:58558773-58558795 GATCCCTCCGCGAGGGGGTGCGG + Exonic
925628884 2:5868801-5868823 GCTCCCTGTGCCACTGTGTCCGG - Intergenic
926091664 2:10055188-10055210 GGCCACTCTGGCAGTGGGTCTGG + Intergenic
927015262 2:18952822-18952844 AATCCCCCTGCCAGTAGGCCAGG + Intergenic
933841744 2:86292593-86292615 GAACCCTCTGGCTGGGGGTCAGG - Intronic
935944842 2:108276314-108276336 GGTCCTTCTCACAGTGGGTCCGG - Intergenic
936756747 2:115723015-115723037 GAAGCCTCTGGCAGTGGCTCTGG - Intronic
937145159 2:119638430-119638452 GGTCACTCTGCCAGTGAGCCTGG - Intronic
938582745 2:132661984-132662006 GATCACACAGCCAGTGGGACAGG - Intronic
941922472 2:170864937-170864959 CATCCCTGTGCCAGTGGAGCTGG + Intergenic
949052514 2:241904720-241904742 GATTCCTCTGCAGGTGGCTCTGG - Intergenic
1169677694 20:8172988-8173010 GATCCCTTTGCCAATGGTGCTGG - Intronic
1170025160 20:11881323-11881345 AGTGCCTCTGACAGTGGGTCAGG - Intergenic
1170348372 20:15412760-15412782 AATGACTTTGCCAGTGGGTCTGG + Intronic
1171163872 20:22953550-22953572 TACCCCTTTGCCAGTGGTTCTGG - Intergenic
1174505812 20:51016829-51016851 GATCCAAATCCCAGTGGGTCAGG - Intronic
1175860792 20:62149051-62149073 GGGCCCTGGGCCAGTGGGTCGGG + Intronic
1180913095 22:19466965-19466987 CATCCCCCTGCCTGTGGGACAGG + Intronic
1183058681 22:35322268-35322290 GCTCTCCCTGCCAGTGGTTCTGG - Intronic
1183565579 22:38612058-38612080 GATCCATCTCCCAATGCGTCAGG + Intronic
1184259261 22:43305431-43305453 GGTCCCTCTGCCCGGGGGGCTGG + Intronic
1184800043 22:46753541-46753563 GAGCCCTCTGCCAGCAGGTGAGG + Intergenic
1185107940 22:48884968-48884990 GTCCCCTGCGCCAGTGGGTCTGG + Intergenic
953567154 3:44042500-44042522 AATCCCACTGCTGGTGGGTCAGG - Intergenic
956524158 3:70139374-70139396 GACCACTGTCCCAGTGGGTCTGG - Intergenic
961563955 3:127750123-127750145 GATCCCTCTGCCCGTGTGTGGGG + Intronic
962755085 3:138460451-138460473 GCACCCTCTGCCAGGGTGTCAGG - Intronic
967137003 3:186521054-186521076 GATCCCTCTGCCTTTGAGACCGG + Intergenic
967210297 3:187162376-187162398 GATCCCTCTCCCTGGGGGTGGGG - Intronic
968509189 4:987914-987936 GCTCCAGCAGCCAGTGGGTCCGG - Exonic
968580143 4:1385996-1386018 TCTCCCTCTGCCAGTGTCTCAGG + Exonic
969631940 4:8343943-8343965 GATCCCTCTGAGAGTGGAGCTGG + Intergenic
972326769 4:38023923-38023945 AATCCCACTGGCAGTGGGTAAGG + Intronic
977772429 4:100875655-100875677 ATGCCCTCTGCCAGTGAGTCAGG + Intronic
983831124 4:172329550-172329572 AATCTCCCTGCCAGTGGTTCAGG - Intronic
985107705 4:186515124-186515146 GATCCCACTGACACAGGGTCTGG + Intronic
989777611 5:45227675-45227697 GATCCCTCTCCCAGAGATTCTGG - Intergenic
997579573 5:135008787-135008809 GAGGCCTGTGCCACTGGGTCTGG + Intronic
999671846 5:153965267-153965289 GATCCCCCAGCCAGTGGGAAAGG - Intergenic
1004157729 6:13184810-13184832 AGTCCCTCTGCCAGTGAGTCTGG + Intronic
1004957779 6:20749426-20749448 GATGCCTCTGTCAGTGGTTCGGG + Intronic
1005497828 6:26404157-26404179 AATCCCTCTTGCTGTGGGTCTGG - Intronic
1005996956 6:30937330-30937352 GATCCCTGTGCCAGTGGGGCTGG + Intergenic
1006408761 6:33859948-33859970 GATCCCTCTGCCATGGGAGCAGG - Intergenic
1011460151 6:87594391-87594413 GATCTCTCTGCCAATAGGTAAGG + Exonic
1015816620 6:137218135-137218157 GACCTCTCTGCCAGTTGGGCAGG + Intronic
1017095428 6:150800509-150800531 GGTGCCACTGCCAGTGGGTCCGG + Intronic
1017908551 6:158773306-158773328 GAGTCCACTGCCAGTGGGTGAGG + Intronic
1018714522 6:166521381-166521403 GACCCCTGCTCCAGTGGGTCTGG + Intronic
1018854593 6:167666516-167666538 GAGCCCTCAACCTGTGGGTCTGG + Intergenic
1019500536 7:1362374-1362396 GACCCCTCTGCCAGTGCCCCAGG + Intergenic
1022032216 7:26502916-26502938 TAGACCTCTGCCAGTGGGACTGG + Intergenic
1022136917 7:27457664-27457686 GTTCCCTCTGTCAGTGACTCTGG + Intergenic
1025160316 7:56653719-56653741 GGTCCTTCTGCCTGTGGGTGTGG - Intergenic
1025263595 7:57438648-57438670 GATCCCGCTGCCTCTGGCTCAGG + Intergenic
1025755222 7:64331973-64331995 GGTCCTTCTGCCTGTGGGTGTGG + Intronic
1025764242 7:64427940-64427962 GGTCCTTCTGCCTGTGGGTGTGG - Intergenic
1026926225 7:74195785-74195807 GTTCCCTCTGTCAGTGACTCTGG - Exonic
1030818962 7:114073329-114073351 GATCCCTCTACAAGAGGGTCTGG - Intronic
1037769509 8:21790042-21790064 GATCCATCTGTCGGTGGGCCGGG + Intronic
1040950788 8:52937566-52937588 GATCCCCCTGTCAGTGGTTTTGG + Intergenic
1041971465 8:63747608-63747630 GAACTCTCTTCCAGTTGGTCAGG - Intergenic
1048522627 8:135170992-135171014 CATCCCCATGCCTGTGGGTCTGG + Intergenic
1049720582 8:144113704-144113726 GCTTCCTCTGCCACTGGGTTTGG - Exonic
1049751333 8:144285730-144285752 GATGCCCCTGCCAGTGGTTGTGG - Intronic
1053122114 9:35555309-35555331 GGCACCTCTGCCAGTGGCTCGGG - Exonic
1057830191 9:98400410-98400432 GAATCCTCTGCCAGTGGGTGTGG + Intronic
1059665453 9:116442334-116442356 TCTCCCTGTGCCAGTGTGTCAGG + Intronic
1060278215 9:122198223-122198245 CATCTCTCTGCCCCTGGGTCTGG + Intronic
1062021731 9:134322765-134322787 GACCCCTCTGCTCCTGGGTCTGG - Intronic
1062234098 9:135499961-135499983 GGTTCCTCTGCGGGTGGGTCCGG + Intronic
1062657975 9:137613963-137613985 GATCCCTGTGGCATTGGGACAGG - Intronic
1062719017 9:138025180-138025202 TCTCCCTGTGCCAGTGGGGCAGG + Intronic
1191631171 X:63323675-63323697 GATTCCACTCACAGTGGGTCCGG + Intergenic
1196731579 X:118946261-118946283 AATACCTCTGTCAGTGTGTCAGG - Intergenic
1198254162 X:134910844-134910866 ATTCCCTATGCCAGTGGTTCTGG + Intronic
1202302803 Y:23435467-23435489 GATCCTGCTGGCAGTGAGTCTGG - Intergenic
1202568008 Y:26235127-26235149 GATCCTGCTGGCAGTGAGTCTGG + Intergenic