ID: 1083265987

View in Genome Browser
Species Human (GRCh38)
Location 11:61547011-61547033
Sequence CTCCATGGTCGGCCTGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083265987 Original CRISPR CTCCATGGTCGGCCTGCCCA TGG Intronic
900426389 1:2581686-2581708 CTCCATGGTCCACCTGCCACGGG - Intergenic
900487568 1:2930646-2930668 CTCGATGGCCGGGCTGCGCATGG + Intergenic
900733737 1:4281198-4281220 CTCCATGACCCACCTGCCCAAGG - Intergenic
904089877 1:27937336-27937358 CTCCCTGGAAGGCCAGCCCAGGG + Intronic
904401522 1:30259822-30259844 CTCCATTGCCGGCTTCCCCAGGG - Intergenic
907272439 1:53298785-53298807 CTCCAAGGTCAGCCTGCCCAAGG - Intronic
919755106 1:201061761-201061783 CTCCAAAGTAGGCCTGACCAGGG - Intronic
919795084 1:201316718-201316740 CTCCTTGGTGGGCCTGCGGAGGG + Intronic
920424154 1:205860108-205860130 TTCCATGGTCTGCTTCCCCAGGG + Intergenic
923555286 1:234995205-234995227 CTCCAAGCACAGCCTGCCCAGGG - Intergenic
923701274 1:236302367-236302389 CTCCAGTGTCGGCTTGCCCCAGG - Intergenic
1062769928 10:91443-91465 CTCCATGGTTGGCTCGCCCTTGG - Intergenic
1062963249 10:1589424-1589446 ATCCATGGTCGGGGTGTCCATGG + Intronic
1062963254 10:1589439-1589461 GTCCATGGTCGGGGTGTCCATGG + Intronic
1067529182 10:47058194-47058216 CTTCATGCTAGACCTGCCCAAGG + Intergenic
1069212625 10:65780219-65780241 CTCCATGCCTGGCTTGCCCATGG + Intergenic
1070387780 10:75941486-75941508 CGCCATGGTTTGCTTGCCCAGGG + Intronic
1070830400 10:79414749-79414771 ATCCAGGGTGGGCCTGGCCAAGG - Intronic
1074301679 10:112239503-112239525 CTCCATGCTTGGCTTGCCCTTGG - Intergenic
1074745672 10:116529560-116529582 CTCCATGGGCAGCCTGCCCCGGG + Intergenic
1074751475 10:116591377-116591399 CTTCATGCTCGGGGTGCCCAAGG + Intronic
1076236535 10:128867981-128868003 CTCTATTGTCAGCCTGCCCCAGG - Intergenic
1076807806 10:132867870-132867892 CTCCCCGCTCGGCCTTCCCACGG + Intronic
1076918994 10:133441571-133441593 CTCCATGGACGGCTGGCCCCCGG - Intergenic
1077232570 11:1464604-1464626 CTCCATGGGGAGCCTGCCCTGGG + Intergenic
1077412132 11:2408580-2408602 CTCCAGGGTGTCCCTGCCCAGGG - Intronic
1080178453 11:29394712-29394734 CTCCCTGTTAGGCCTTCCCAAGG + Intergenic
1083265987 11:61547011-61547033 CTCCATGGTCGGCCTGCCCATGG + Intronic
1084161294 11:67351862-67351884 CTCCAGGTTCTGCCTGCCAAGGG + Exonic
1084258098 11:67956014-67956036 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
1084495750 11:69502093-69502115 CCCCATGGCCTGCCTGTCCATGG + Intergenic
1084814653 11:71639205-71639227 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1089268269 11:117282449-117282471 CACCATGGCAGGCCTGACCATGG + Exonic
1100330144 12:93573555-93573577 TTCCATGGTCGGCGCGCCCAGGG + Intronic
1102679684 12:114683003-114683025 ATCCATGATCGGCTTGGCCAGGG + Exonic
1104590689 12:130082226-130082248 CTCCATGGCAGCCCTGCCCTGGG + Intergenic
1104840776 12:131824312-131824334 CTCCCAGGTGGCCCTGCCCACGG - Intergenic
1104974989 12:132548305-132548327 CCCCATGGCAGCCCTGCCCAGGG - Intronic
1105885324 13:24637089-24637111 CTCCAGGGTGGGCTTTCCCACGG - Intergenic
1112556356 13:100472264-100472286 CACCAAGGTCGTCGTGCCCAGGG - Intronic
1113069454 13:106406407-106406429 CTCCATGGAGGGCTTGTCCAAGG - Intergenic
1114779816 14:25525898-25525920 CTCCATGCTCGGCCTTCCTCTGG + Intergenic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1119768670 14:77206485-77206507 CTTCTTGATCTGCCTGCCCATGG + Intronic
1124212705 15:27776565-27776587 CTCCGTGGCCGCCCTCCCCATGG + Intronic
1128173153 15:65530615-65530637 CTCCATGGCCACACTGCCCAGGG - Exonic
1128570515 15:68730072-68730094 CCCCCTGGTCAGCCTGCACAGGG + Intergenic
1129476874 15:75791572-75791594 AACCATGGTCAGCATGCCCACGG - Intergenic
1132372109 15:101306409-101306431 CTCCATGCTCTGCCTGGACAGGG + Intronic
1132592869 16:733958-733980 CTCCAGGCCCGGACTGCCCAGGG + Intronic
1132738442 16:1398871-1398893 CCCAAGGGTCGCCCTGCCCAGGG - Exonic
1133369878 16:5239542-5239564 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1133822036 16:9245515-9245537 CTCCATGGTCTCCATCCCCAGGG + Intergenic
1138029334 16:53547401-53547423 CTCCATGTTCTGCCTTACCATGG + Intergenic
1138607589 16:58098811-58098833 CTCCATGGACTGTCTGCCCCGGG - Intergenic
1139531645 16:67545484-67545506 CTCCATGGTGGGGCTGTCCAAGG - Exonic
1140469785 16:75207478-75207500 CACCATGCCCGGCCTGCCCAGGG - Intergenic
1143196675 17:5081166-5081188 CTGCAAGCTCGGCCTGCCCCGGG + Intronic
1143378781 17:6482896-6482918 CCCCAGGGTCGCCCAGCCCATGG - Intronic
1146901442 17:36592008-36592030 CTCCATGCCGGGCCTGGCCATGG - Exonic
1148163279 17:45464039-45464061 CCCCATGGACCACCTGCCCATGG - Intronic
1149035770 17:52132991-52133013 CTGCATACTCAGCCTGCCCATGG - Intronic
1149853523 17:60057131-60057153 TTCCATTGTCGTACTGCCCAAGG - Exonic
1150394511 17:64810691-64810713 CCCCATGGACCACCTGCCCATGG - Intergenic
1151657256 17:75501870-75501892 CTCCAGTGCCGCCCTGCCCAGGG - Exonic
1153457110 18:5294827-5294849 CGCCATTGTCGGGCTGCCCGGGG - Intronic
1155201064 18:23518111-23518133 CTCTGTGCTGGGCCTGCCCAGGG - Intronic
1156859073 18:41815558-41815580 CTTCATGCTCAGCCTGTCCATGG - Intergenic
1159070110 18:63613560-63613582 CACCAGGGTGGGGCTGCCCAAGG - Intergenic
1159924781 18:74258256-74258278 CTCCATGTTAGACCTGCCAAGGG - Intronic
1162532129 19:11242095-11242117 CTCCTTGGTGGGCCGGCCCCTGG + Exonic
1162816947 19:13201548-13201570 CTCCATGATCTGCCTGCCTCAGG + Intergenic
1165172822 19:33906023-33906045 CTCCACGGTCTGCCTGGCCCCGG + Intergenic
1165758500 19:38307692-38307714 CTCCAGGGTCAGCCAGGCCAGGG + Exonic
1167269378 19:48498902-48498924 CTCCCTGGCCGACTTGCCCATGG - Exonic
1167635060 19:50649479-50649501 GTGCATGGTGGGGCTGCCCATGG - Exonic
925258218 2:2507649-2507671 CTCCGTGGCTGGCCTGGCCACGG + Intergenic
925379858 2:3417201-3417223 CTCCATGTCCGGCCTGCCCTGGG + Intronic
927477522 2:23425437-23425459 CTCCAGGGCCGGCCAGACCAGGG + Intronic
927913512 2:26918202-26918224 CTGCATGGGCGACATGCCCATGG + Intronic
932335996 2:70931716-70931738 CTCCAGGGTCAGTCTTCCCAAGG + Intronic
933615029 2:84475021-84475043 CTCCGTGGTCTGCCTCCCCAGGG - Intergenic
936485376 2:112920947-112920969 CTGCATGTTCGGCCTCCTCAAGG - Intergenic
937217964 2:120324597-120324619 CTCCAGGGTCGCCCTTCCTAAGG - Intergenic
938132014 2:128724805-128724827 CTCCATGCCGGGCCTGCCCAGGG - Intergenic
938903759 2:135819941-135819963 CTCCATGGCCGGCAAACCCAGGG - Intronic
940998317 2:160174589-160174611 CTCCCAGGTCTGCCTGCCAAGGG + Intronic
944379614 2:199092688-199092710 CTCCATGGGCTCACTGCCCAGGG - Intergenic
946768228 2:223060145-223060167 CCCCATGGTGGGCATGACCACGG - Intronic
947731477 2:232433800-232433822 CTCCATGGCCGGGCAGCCCATGG - Intergenic
1173546794 20:43903929-43903951 GTCCATGGGGGGCCTGCCCTTGG + Intergenic
1173668198 20:44778015-44778037 CTCCATGGTCAGCCTCTCCCTGG + Intronic
1174836726 20:53862798-53862820 TTCCATGATGGTCCTGCCCATGG + Intergenic
1175378041 20:58542726-58542748 CTCCATGCTCTGCCTTCCCAAGG - Intergenic
1176141170 20:63545736-63545758 CTCCATGGACGCTCTGTCCATGG + Intronic
1176274449 20:64255848-64255870 CTCCAGGCTCGGCCGGCCGACGG - Exonic
1177479996 21:21674401-21674423 CTCCATGGTCTGCCCTCCCCCGG + Intergenic
1181478286 22:23181565-23181587 CTGCATGGCCTGGCTGCCCAGGG - Exonic
1183153491 22:36055898-36055920 ATCCATGCTCAGCCTTCCCACGG + Intergenic
1184246196 22:43237004-43237026 CTCCATGGACGCCCAGCCCTGGG - Intronic
1185127702 22:49021056-49021078 CTCCCTGCTCTGCCTGGCCAGGG + Intergenic
1185127733 22:49021193-49021215 CTCCATGGTGGCCCTGCAGAGGG - Intergenic
1185205108 22:49533363-49533385 TTCCATGGTCAGCGTGCCTACGG - Intronic
1185373344 22:50470840-50470862 CTCCATGGCCTGCCTTTCCAGGG - Intronic
950695901 3:14701065-14701087 CTCCATGTCTGGCCTGCCCCAGG - Intronic
951522987 3:23626568-23626590 CTCCATGGGCTTCCTGCCTAGGG - Intergenic
953748049 3:45590324-45590346 CTCCATGGCTGGCTTGCCCTTGG - Intronic
953769200 3:45765729-45765751 TGCCCTGGACGGCCTGCCCAGGG + Exonic
954784296 3:53081668-53081690 CTCCTTGGTGGTGCTGCCCAGGG + Intronic
957073041 3:75580522-75580544 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
960675221 3:120186872-120186894 CTCCAAGGTCAGCCCTCCCAAGG + Intronic
961281042 3:125766255-125766277 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
961873350 3:130003330-130003352 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
969016644 4:4107819-4107841 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
969632173 4:8345194-8345216 CTCCACGGCCGGGCTGCCCTGGG - Intergenic
969737311 4:9000496-9000518 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
969903156 4:10368575-10368597 CTCCTGGATCAGCCTGCCCAGGG - Intergenic
975240122 4:72047395-72047417 CTCCATGGGCTCACTGCCCAGGG + Intronic
981178948 4:141716318-141716340 CTCCATGGGCATACTGCCCAGGG + Intronic
981536883 4:145809380-145809402 CCCCATGGTTAGCCTGCCCTAGG - Intronic
982202843 4:152975820-152975842 CTGCAAGGGCGGCCTGCCCAGGG + Exonic
985087596 4:186329414-186329436 CTGCATGGTCCGCATTCCCAAGG - Intergenic
986667754 5:10118013-10118035 GACCATGGTCAGCCTGCCCCTGG + Intergenic
986985870 5:13500587-13500609 CTCCATGGACTCACTGCCCAGGG + Intergenic
1002100605 5:176855770-176855792 CTCCATGGGGAGGCTGCCCAGGG + Intronic
1002603186 5:180366552-180366574 CTCCATAGTTGGGCTGGCCAGGG + Intergenic
1002897666 6:1389097-1389119 CTCCCTGGCCGCCCTCCCCAGGG - Intergenic
1003104531 6:3205234-3205256 CTCCATGGTCTGCCTGACAATGG + Intergenic
1003117056 6:3289891-3289913 CTCTGTGGGCGGCCTGCCCAGGG - Intronic
1006278189 6:33022798-33022820 CTCCATGGTGGCCCTGCACATGG - Intergenic
1007810319 6:44480943-44480965 CTCCAGGGTCAGCTTGCCCCGGG + Intergenic
1018902243 6:168057462-168057484 GTGCATGGCCGGCCTGCCCCTGG + Intronic
1019004160 6:168782449-168782471 CCCCATGGCCAGCATGCCCAGGG - Intergenic
1019473467 7:1233173-1233195 CTCCATCGACGGCCTGCTCGGGG + Exonic
1019777665 7:2922208-2922230 CTCTAGGGTCAGTCTGCCCACGG - Intronic
1021324782 7:19253509-19253531 CTCAAAGGTAGGCCTGCCAAAGG - Intergenic
1021411830 7:20337790-20337812 CCCCATGGACTCCCTGCCCATGG - Intronic
1024698109 7:51877478-51877500 CTCCATGGTGAGCCTTCCCATGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1035563861 8:628507-628529 CACCCTGATCGGCCTGGCCAAGG - Intronic
1036286462 8:7447823-7447845 CTCCATGGACTGGCTCCCCAGGG - Intronic
1036307183 8:7611127-7611149 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1036359101 8:8065256-8065278 CCCGATGGTCTCCCTGCCCAAGG - Intergenic
1036830326 8:12015371-12015393 CCCGATGGTCTCCCTGCCCAAGG + Intronic
1036891857 8:12601696-12601718 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
1036892922 8:12607832-12607854 CCCGATGGTCTCCCTGCCCAAGG + Intergenic
1037776328 8:21838360-21838382 CTCCCTGGTCTGCTTACCCACGG + Intergenic
1038206457 8:25471277-25471299 CTGCATGGTCCCCCTGCACAGGG + Intronic
1039637585 8:39182910-39182932 CACCAAGGTCTGCCTGTCCACGG - Intronic
1041717381 8:60944393-60944415 CAGCCAGGTCGGCCTGCCCAGGG + Intergenic
1043495692 8:80797633-80797655 CTCCGTGGGCTTCCTGCCCAGGG - Intronic
1043503282 8:80876910-80876932 CTACATGCTTGGCCTGACCATGG - Intergenic
1048001362 8:130381996-130382018 CACCATGCTCGGCCTGAACAAGG - Intronic
1049449538 8:142653018-142653040 CACCATGGTCTGCCTGCTGATGG - Intergenic
1059681652 9:116591417-116591439 CTCCATGGCTGGCTTGCCCTTGG + Intronic
1060044626 9:120330037-120330059 CTCCATGGTGGGCCTTGCAAGGG - Intergenic
1062472327 9:136712101-136712123 CTGCAGGCTCGGCCAGCCCAGGG + Intergenic
1062619099 9:137411534-137411556 CTTCAAGGTCGGCCTGTTCAGGG - Intronic
1186583749 X:10849566-10849588 ACCCTTGGTCAGCCTGCCCATGG - Intergenic
1186618791 X:11215645-11215667 CTCCATGAGCTTCCTGCCCACGG - Intronic
1195687915 X:107602289-107602311 CTCCCTGGGCAGCATGCCCAGGG - Exonic
1199569369 X:149252295-149252317 CTCCATGAGCGCCCTGCCCCTGG + Intergenic