ID: 1083266549

View in Genome Browser
Species Human (GRCh38)
Location 11:61549693-61549715
Sequence GCCTGACCACTCAGCAGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083266548_1083266549 -9 Left 1083266548 11:61549679-61549701 CCTCGGGGCAGAGGGCCTGACCA 0: 1
1: 0
2: 4
3: 12
4: 156
Right 1083266549 11:61549693-61549715 GCCTGACCACTCAGCAGCTTCGG 0: 1
1: 0
2: 1
3: 10
4: 188
1083266547_1083266549 -8 Left 1083266547 11:61549678-61549700 CCCTCGGGGCAGAGGGCCTGACC 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1083266549 11:61549693-61549715 GCCTGACCACTCAGCAGCTTCGG 0: 1
1: 0
2: 1
3: 10
4: 188
1083266539_1083266549 27 Left 1083266539 11:61549643-61549665 CCTAGGTGCATGCAGACACACAC 0: 1
1: 1
2: 8
3: 76
4: 528
Right 1083266549 11:61549693-61549715 GCCTGACCACTCAGCAGCTTCGG 0: 1
1: 0
2: 1
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083266549 Original CRISPR GCCTGACCACTCAGCAGCTT CGG Intronic