ID: 1083266618

View in Genome Browser
Species Human (GRCh38)
Location 11:61549961-61549983
Sequence TTACAGCCGCGGGCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083266618_1083266631 10 Left 1083266618 11:61549961-61549983 CCAGCCCTGGCCCGCGGCTGTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1083266631 11:61549994-61550016 CTGGAGGAGGCACAGGTGCTGGG 0: 1
1: 0
2: 4
3: 59
4: 509
1083266618_1083266630 9 Left 1083266618 11:61549961-61549983 CCAGCCCTGGCCCGCGGCTGTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1083266630 11:61549993-61550015 CCTGGAGGAGGCACAGGTGCTGG 0: 1
1: 0
2: 9
3: 82
4: 660
1083266618_1083266625 -6 Left 1083266618 11:61549961-61549983 CCAGCCCTGGCCCGCGGCTGTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1083266625 11:61549978-61550000 CTGTAAACGGCCTGTCCTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1083266618_1083266624 -9 Left 1083266618 11:61549961-61549983 CCAGCCCTGGCCCGCGGCTGTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1083266624 11:61549975-61549997 CGGCTGTAAACGGCCTGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 20
1083266618_1083266632 14 Left 1083266618 11:61549961-61549983 CCAGCCCTGGCCCGCGGCTGTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1083266632 11:61549998-61550020 AGGAGGCACAGGTGCTGGGCTGG 0: 1
1: 1
2: 5
3: 74
4: 750
1083266618_1083266627 3 Left 1083266618 11:61549961-61549983 CCAGCCCTGGCCCGCGGCTGTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1083266627 11:61549987-61550009 GCCTGTCCTGGAGGAGGCACAGG 0: 1
1: 1
2: 4
3: 59
4: 408
1083266618_1083266626 -3 Left 1083266618 11:61549961-61549983 CCAGCCCTGGCCCGCGGCTGTAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1083266626 11:61549981-61550003 TAAACGGCCTGTCCTGGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083266618 Original CRISPR TTACAGCCGCGGGCCAGGGC TGG (reversed) Intronic
900147763 1:1165880-1165902 TGACAGGCTGGGGCCAGGGCAGG + Intergenic
900385201 1:2407430-2407452 AGACAGCCTCGGCCCAGGGCCGG + Intronic
900574024 1:3374145-3374167 TGACCGCCAGGGGCCAGGGCCGG + Intronic
904212610 1:28895947-28895969 TTACAGCAGCAGGCCTGGGTGGG - Intronic
917380585 1:174401932-174401954 TTACAGCCCCTGACCATGGCAGG - Intronic
1063151932 10:3345027-3345049 TTACAGCCACGGAGCAGGGTGGG - Intergenic
1063354685 10:5387042-5387064 TTACAGGTGCGTGCCATGGCTGG - Intergenic
1063918770 10:10911211-10911233 TTACAGATGCCAGCCAGGGCCGG + Intergenic
1065967554 10:30781827-30781849 TTGCAGCCCCAGGCCAGGGCTGG - Intergenic
1070160761 10:73865535-73865557 TTGCAGCCGTGGGCCAGCCCTGG - Intronic
1070676032 10:78411902-78411924 CCACAGCCGAGTGCCAGGGCAGG + Intergenic
1071291834 10:84194492-84194514 TCCCAGCCGCGGGCGGGGGCAGG - Intergenic
1075645285 10:124092709-124092731 TTCCAGGCGCGGCCCGGGGCAGG - Intronic
1075710315 10:124527179-124527201 TTACAGCCCAGGGGCAGGGGAGG + Intronic
1076217756 10:128710173-128710195 TGACTGTCGCGGGCCGGGGCTGG + Intergenic
1076818745 10:132927558-132927580 TTGCAGCCGCTGGACAGGCCGGG - Intronic
1077148048 11:1054604-1054626 CAACAGCTGCGGGCCAGGGCGGG - Intergenic
1077375147 11:2202251-2202273 TTGCAGGCACGGGCCAGGGCGGG - Intergenic
1077998749 11:7476079-7476101 GTACACCCCAGGGCCAGGGCTGG - Intergenic
1081673753 11:44956435-44956457 GTGCTGCCGCTGGCCAGGGCAGG + Intergenic
1081965337 11:47165796-47165818 TTTCAGCTCCGTGCCAGGGCCGG - Intronic
1082790871 11:57346050-57346072 GTACAGCCGTGGGCCAAGGCTGG + Intronic
1083266618 11:61549961-61549983 TTACAGCCGCGGGCCAGGGCTGG - Intronic
1084192104 11:67504025-67504047 TCCCAGCCCCGGGGCAGGGCTGG + Intronic
1085462184 11:76700830-76700852 TTGGAACCGCAGGCCAGGGCGGG + Intergenic
1090356945 11:126146670-126146692 TTAAACCCAGGGGCCAGGGCAGG - Intergenic
1091600562 12:1915423-1915445 GGACAGCCTCAGGCCAGGGCCGG + Intronic
1096611036 12:52801871-52801893 TTACAGCTGCGTGGCAGGGGAGG + Intergenic
1097018604 12:56004562-56004584 TTACAGCCACTGGCAACGGCGGG + Exonic
1101880508 12:108622815-108622837 TTTCAGCCGAGGTCCAAGGCAGG - Exonic
1102577208 12:113863308-113863330 TAGCAGCTGCTGGCCAGGGCTGG - Intronic
1102989700 12:117306085-117306107 TTAAAACCACGGGCCAGGCCAGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104735020 12:131131262-131131284 GCACAGCCGCAGGCCTGGGCCGG + Intronic
1104910784 12:132240015-132240037 TTAGAGCGGCGGGCCTGGGTTGG - Intronic
1108195392 13:47989483-47989505 TTACAGGCGTGAGCCAGTGCTGG + Intronic
1113438042 13:110307929-110307951 TTACCGCCGTAGGGCAGGGCCGG - Exonic
1113458945 13:110468443-110468465 CTACAGCCGTGTGCCAAGGCCGG + Intronic
1117875866 14:60249545-60249567 CTGCAGCGGCGGGCCAGGTCAGG - Intronic
1118723417 14:68609770-68609792 TAGCAGCCGATGGCCAGGGCTGG - Intronic
1122771466 14:104099750-104099772 AAACAGCAGGGGGCCAGGGCAGG - Intronic
1127322100 15:57856785-57856807 TTACAGCCATGGCCCCGGGCAGG - Intergenic
1128061252 15:64737176-64737198 TTAAAAACGCTGGCCAGGGCTGG + Intergenic
1129823513 15:78620080-78620102 TCCCAGCGGCGGGCCAGGGCCGG + Intronic
1130016334 15:80189420-80189442 CTACTGCCCGGGGCCAGGGCAGG + Intergenic
1130551973 15:84895134-84895156 TCACAGCCCCGAGGCAGGGCAGG + Intronic
1132869641 16:2110125-2110147 TTGCCGCTGCCGGCCAGGGCCGG + Exonic
1134717776 16:16365474-16365496 TTGCCGCTGCCGGCCAGGGCCGG - Intergenic
1134956975 16:18386685-18386707 TTGCCGCTGCCGGCCAGGGCCGG + Intergenic
1138641611 16:58392365-58392387 TTAGAGCAGCGGGACACGGCTGG - Intronic
1142599683 17:1047506-1047528 CTGCAGCGGAGGGCCAGGGCCGG + Intronic
1142753999 17:2004774-2004796 TTCCTGCCCCTGGCCAGGGCTGG + Intronic
1143174373 17:4948005-4948027 TTACATCCGGGGCACAGGGCGGG - Intronic
1143663266 17:8340390-8340412 TGACATCCACGGGCCAGCGCTGG - Exonic
1146273267 17:31498235-31498257 TTAGGGCCTCCGGCCAGGGCAGG - Intronic
1148782724 17:50130537-50130559 CTACAACTGCGGGCCAGGGTAGG + Intergenic
1151226965 17:72655009-72655031 TGGCAGCCCCGTGCCAGGGCTGG - Intronic
1152244998 17:79180803-79180825 GAACAGCCGCGGGCGAGGGAAGG + Intronic
1152571549 17:81123352-81123374 CGACAGCCGTGAGCCAGGGCTGG + Intronic
1157090406 18:44630215-44630237 TTACTGCTGCAGACCAGGGCTGG - Intergenic
1157409111 18:47449054-47449076 TTAGAGCCGCCTGCCTGGGCTGG + Intergenic
1157763147 18:50279946-50279968 TTCCAGCCAGGGCCCAGGGCCGG + Exonic
1161279834 19:3440005-3440027 TAACACCCGTGGCCCAGGGCTGG + Intronic
1161753433 19:6114136-6114158 TTTCCGCCTCTGGCCAGGGCTGG - Intronic
1161768807 19:6220578-6220600 TCACTGCCGGGGGCCAGGCCGGG + Intronic
1162053769 19:8050793-8050815 TTAGAGCCCAGGGGCAGGGCTGG - Intronic
1162503397 19:11067599-11067621 TGACAGCTGAGGGCTAGGGCTGG - Intergenic
1165951574 19:39476447-39476469 TCACAGCCAAGGGCCAGGGAAGG - Exonic
1166356484 19:42230420-42230442 TTACACCCGGGGGCCAGGGAAGG + Exonic
1166765613 19:45251182-45251204 TTAAAGGCGCAGGCCCGGGCTGG - Intronic
1168650083 19:58087099-58087121 TTAGAGTCCCTGGCCAGGGCTGG - Intronic
926062218 2:9811826-9811848 TTCCAGCCGCTGGCCTGGCCGGG - Intergenic
933436960 2:82260669-82260691 TGACAGCAACTGGCCAGGGCCGG - Intergenic
934523338 2:95033414-95033436 TTTCAGTGGCGGGCCAGGGAGGG + Intronic
934686842 2:96327397-96327419 CCACAGCGGCGGCCCAGGGCTGG - Exonic
935046677 2:99489657-99489679 GGACGGCCGCGGGCCGGGGCCGG + Intronic
938325007 2:130392480-130392502 TTACAGGCGTGAGCCACGGCTGG - Intergenic
946432358 2:219632453-219632475 TTGCAGCCTCGGGCCAGGCCTGG - Intronic
948619379 2:239224536-239224558 TTACACCCGCTGGTGAGGGCAGG - Intronic
948859475 2:240745957-240745979 TTCCAGCCACAGGCCTGGGCCGG + Intronic
1171393541 20:24816457-24816479 TCTCAGCCCAGGGCCAGGGCAGG + Intergenic
1171483066 20:25468455-25468477 TGACAGTCGGGGGACAGGGCAGG - Intronic
1172564466 20:35918200-35918222 TTACAGACAAGGGACAGGGCAGG - Intronic
1172949088 20:38710842-38710864 TTGCAGCTGCAGACCAGGGCTGG - Intergenic
1175828564 20:61950243-61950265 TTACAGCCGTGTGCCAGAGCGGG - Intergenic
1182577417 22:31282466-31282488 TGACAACCGTGGGCCAGGCCTGG - Exonic
1182859346 22:33545856-33545878 TTACAGGCGTGAGCCATGGCAGG + Intronic
1183214142 22:36468220-36468242 TTGCAGCTGCAGGCCAGGGCTGG + Intronic
1185259280 22:49852961-49852983 GCACAGCCGCGGGGCAGGGGCGG + Intergenic
949345591 3:3073366-3073388 CTACAGCCGCGGGCCAAATCTGG + Intronic
950045648 3:9947253-9947275 CAACAGCCGAGGGCCCGGGCTGG + Exonic
951995037 3:28718088-28718110 TTACAGCCCCTGGCCATGGATGG + Intergenic
952248537 3:31625635-31625657 TCACAACCGCAGGCCAGGGCTGG - Intronic
954278016 3:49554808-49554830 TTACCTGCCCGGGCCAGGGCCGG - Exonic
960356086 3:116655282-116655304 TTTCAGCCCCAGCCCAGGGCAGG - Intronic
960944710 3:122958156-122958178 TGACAGCCAGGGGCCAGGGTGGG + Intronic
960966483 3:123108611-123108633 TTACAGGCGTGAGCCAGTGCCGG - Intronic
961523053 3:127479098-127479120 GTACAGGCTCTGGCCAGGGCAGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968556564 4:1248871-1248893 TTCCGGCCGCGGGCGGGGGCGGG - Intronic
968662539 4:1804748-1804770 GTACAGCCGGGGGTCAGTGCTGG - Intronic
969043230 4:4317490-4317512 TGGCAGCCAGGGGCCAGGGCTGG - Intronic
969581624 4:8068711-8068733 GCTCAGCCGAGGGCCAGGGCTGG + Intronic
969656079 4:8499288-8499310 TTAGAGACACGGCCCAGGGCAGG - Intergenic
983514944 4:168645867-168645889 TTACAGCCCCGTGCCTGAGCTGG - Intronic
985058100 4:186052780-186052802 TTACAGGCGCCTGCCAGGACCGG + Intergenic
989568302 5:42923434-42923456 TTACAGGCGTGAGCCAGGTCAGG - Intergenic
992530887 5:77650828-77650850 TTAAAGCCAAGGTCCAGGGCAGG - Intergenic
998689141 5:144567615-144567637 TTACAGCCTCAGGCCACAGCTGG + Intergenic
1006300863 6:33192904-33192926 TTACAGAGCCGGGCCGGGGCGGG + Intergenic
1006610380 6:35291128-35291150 TTCCAGCCCCTGCCCAGGGCAGG + Intronic
1006650226 6:35545203-35545225 TTTCACCCGCAGGGCAGGGCAGG + Intergenic
1007662821 6:43496861-43496883 TTACAGGTGGGGGCCAGGGAGGG + Intronic
1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG + Intergenic
1017719725 6:157236131-157236153 TGGCATCCGCGGGGCAGGGCGGG + Intergenic
1018910810 6:168100190-168100212 GTGCTCCCGCGGGCCAGGGCAGG - Intergenic
1018999449 6:168736642-168736664 TTACAGCTGCAGCTCAGGGCGGG + Intergenic
1019157718 6:170050313-170050335 GTGCAGCCGTGGCCCAGGGCAGG - Intergenic
1019178575 6:170173633-170173655 TGGCTGCCTCGGGCCAGGGCTGG - Intergenic
1019509608 7:1411218-1411240 TTAGAGCTGAGGGCCAGGCCAGG - Intergenic
1021998234 7:26201269-26201291 CCACAGACGCGGGCCAGGGGTGG - Exonic
1024063306 7:45714473-45714495 TTGAAGCCGCTGCCCAGGGCTGG - Exonic
1028941348 7:96525667-96525689 TTCCAGCCTGGGGCCAGGGGTGG - Intronic
1033652872 7:143355449-143355471 TTGCAGCTGAGGGCCAGGGTGGG - Exonic
1037819731 8:22129910-22129932 TTCCCGCTGGGGGCCAGGGCGGG - Intronic
1038525298 8:28267863-28267885 AGACAGCCGTGGCCCAGGGCTGG + Intergenic
1038865126 8:31431228-31431250 TTACAGCCAAGGAGCAGGGCAGG - Intergenic
1047760375 8:127949888-127949910 ATCCAGCCGCTGGGCAGGGCCGG - Intergenic
1049685555 8:143937944-143937966 TCACAGCCGAGGGCCTGGCCTGG - Intronic
1057866698 9:98687223-98687245 TTACAGCCAAGGGGCAGGGTGGG + Intronic
1059350275 9:113659420-113659442 TTACAGCTGAGGGGCAGGGTGGG + Intergenic
1060813642 9:126623783-126623805 TTTCTTCCGCTGGCCAGGGCTGG - Intronic
1062037057 9:134387052-134387074 CCACAGCAGCGGCCCAGGGCAGG - Intronic
1195649913 X:107273488-107273510 CTAGAGCAGCTGGCCAGGGCGGG - Intergenic
1197725111 X:129771062-129771084 TTCCAGCCACGTTCCAGGGCTGG - Intergenic
1198184172 X:134237482-134237504 TTAGAGCCCCAGGCCGGGGCTGG + Intronic
1202056586 Y:20839616-20839638 TTACAGCCGAGGTGCAGGCCTGG - Intergenic