ID: 1083266983

View in Genome Browser
Species Human (GRCh38)
Location 11:61551301-61551323
Sequence CTGTGGGGCTGGGGGAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1445
Summary {0: 1, 1: 0, 2: 18, 3: 173, 4: 1253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083266983 Original CRISPR CTGTGGGGCTGGGGGAGAGA AGG Intronic
900154156 1:1197414-1197436 TGGTGCGGGTGGGGGAGAGAGGG - Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183821 1:1324048-1324070 CTGGGGGGCTGAGGGACTGAGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900291743 1:1926580-1926602 CCGTGGGGCTGGGGGAGGCGTGG + Intronic
900313865 1:2047715-2047737 CTCTGGGGTTGGGAGGGAGAGGG - Intergenic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900464250 1:2816738-2816760 TTTTGGGGGTGGGGAAGAGATGG + Intergenic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
901087922 1:6622899-6622921 TTCTGGGGCTGGGAGGGAGAGGG + Exonic
901215989 1:7555691-7555713 CCTTGGTGCTGGGGGAGACAGGG - Intronic
901692224 1:10980909-10980931 TTGTGGGGCTGGGCGAGCAAGGG - Intronic
901737091 1:11319526-11319548 CTGGGGGGTTGGGGGAGACAGGG + Intergenic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902234631 1:15049471-15049493 CTGGGGGGCTGGGGTGGAGGGGG - Intronic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902346343 1:15820862-15820884 CTGGGAGGCTGAGGCAGAGAGGG + Intergenic
902368229 1:15990810-15990832 CTGTGGGGCCGGAGGAGCCAGGG + Intergenic
903178626 1:21594663-21594685 AGGTGGGGCAGGAGGAGAGAGGG + Intergenic
903294091 1:22332655-22332677 ATCTAGGGTTGGGGGAGAGAAGG + Intergenic
903413912 1:23168600-23168622 GTGTGGAGTTGGGGGAGAGTTGG - Intronic
903542957 1:24107181-24107203 CCGTGGAGCTGGAGGAGCGAGGG - Exonic
903580308 1:24365811-24365833 CTGTGGGCCTGGGGGAAGGGAGG - Intronic
903831435 1:26177602-26177624 GGGTGGGGCTGGGGTAGAGTTGG + Intronic
903848229 1:26290985-26291007 CTGTGACGCTGGCAGAGAGAGGG + Intronic
903868128 1:26412737-26412759 CTTTGGGGGAGGGGTAGAGAAGG + Intronic
904058600 1:27688494-27688516 CAGAGGGGATGGGGGAGATAGGG + Intergenic
904205984 1:28855541-28855563 CTGTGGGTGGAGGGGAGAGAGGG + Intronic
904311547 1:29632685-29632707 CTGGGAGGCTGGGGGACTGAGGG - Intergenic
904311562 1:29632733-29632755 CTTGGGGGCTGGGGGACTGAGGG - Intergenic
904390208 1:30179994-30180016 CTGTGAGGGTGGGGCAAAGACGG + Intergenic
904449297 1:30600728-30600750 CTCGGGGTCTGGGGAAGAGAGGG - Intergenic
904480055 1:30787912-30787934 GTGTGGGTCAGGGAGAGAGAAGG - Intergenic
904826295 1:33275966-33275988 CTGTGAGGCTGGGGGACCCACGG + Intronic
905280804 1:36847890-36847912 CTGAGAGGCTGTGGGACAGATGG + Intronic
905304676 1:37009396-37009418 ATCTGGGGCTGGGGGTGTGAGGG - Intronic
905435307 1:37951574-37951596 GTGTGGGGCTGGGGCTGTGAGGG - Intergenic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
906136876 1:43506228-43506250 CTGTGGGGCTGGGCTGGAGCTGG - Intergenic
906143510 1:43547091-43547113 CTGGGGGCCTGGGGGTGGGAGGG - Intronic
906195703 1:43929628-43929650 CTATGGGGCCTGCGGAGAGATGG - Intronic
906593065 1:47046444-47046466 CTGTGAGGATGAGGGAGGGAAGG - Intronic
906785557 1:48612405-48612427 CTGGATGGCTGGGGCAGAGAAGG + Intronic
907121596 1:52012798-52012820 CATTGGGGATGGGGGTGAGAAGG - Intergenic
907267620 1:53272424-53272446 CTGGGGGGCAGAGGGGGAGAGGG - Intronic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
907333069 1:53684018-53684040 TTATGGGGCTGGAGTAGAGATGG + Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
907805001 1:57810104-57810126 CTAAAAGGCTGGGGGAGAGAAGG - Intronic
908398174 1:63745463-63745485 CTGTGGGGCTGGGTGAGAGTGGG - Intergenic
909033896 1:70574669-70574691 CTGAGGGGCTGGAGTAGAAAGGG - Intergenic
909548912 1:76876884-76876906 CTGCTGGGCTGAGGGAGAGAAGG + Intronic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911001753 1:93173048-93173070 GTGGGGGACTTGGGGAGAGAGGG + Intronic
911011606 1:93287165-93287187 CTGTGCTCTTGGGGGAGAGAAGG + Intergenic
911019905 1:93375661-93375683 CTGTGGGCCTGGGGCAGTGGTGG + Intergenic
911032693 1:93507162-93507184 TTGGGGGGGTGGGGGAGGGAGGG - Intronic
911087832 1:93993873-93993895 CTGTGGAGCTGGGGTAGTGTGGG + Intronic
911150381 1:94592499-94592521 ATGTGGGGCTGGGGGCGGGGTGG - Intergenic
911433839 1:97829885-97829907 GTGGGGGGCTGAGGGAGGGATGG - Intronic
911854537 1:102860016-102860038 GTGGGGGGAGGGGGGAGAGATGG + Intergenic
911960880 1:104301237-104301259 GCTTGGGGTTGGGGGAGAGATGG - Intergenic
912017407 1:105059356-105059378 TTCTGGAGCTGGGGAAGAGAAGG - Intergenic
912474089 1:109924729-109924751 CTGAGGAGCTGGGGGAGTGTGGG - Intronic
912885184 1:113463665-113463687 CTGTGAAGGCGGGGGAGAGATGG + Intronic
912935871 1:114003234-114003256 CTGTGGGTCTGGGGCAGGGAAGG + Intergenic
912970027 1:114272389-114272411 ATGTGGGGCGGGAGGAGAGCAGG + Intergenic
913538576 1:119797502-119797524 CTATTGGGCTGGGGTAGGGAGGG - Intronic
914263934 1:146021674-146021696 CTGGGGACCTGGGGGAGACACGG - Exonic
914461507 1:147889997-147890019 TTGTGGTGCTGTGGGAGACAGGG + Intergenic
914687076 1:149989761-149989783 GTGGGGGGCGGGGGGAGGGAGGG + Intronic
915034679 1:152911694-152911716 GGGTGAGGGTGGGGGAGAGAGGG + Exonic
915337154 1:155151430-155151452 TTGGGGGGGTGGGGGAGAGAGGG - Intergenic
915444459 1:155966888-155966910 CTGGGAGGGTGGGGTAGAGAGGG + Intronic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915518996 1:156430526-156430548 CAGTGGGGGAGGGTGAGAGAGGG - Intronic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915810925 1:158909830-158909852 CTGTGGGCCTGGGGCAGTGCTGG + Intergenic
916193563 1:162202000-162202022 CTATGGGGGTGGTGGAGAAACGG + Intronic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
917332651 1:173898113-173898135 TTGGGGGGCAGGGGTAGAGATGG + Exonic
917479004 1:175394520-175394542 CTGTGTGGTTGGGGGAGAAGGGG - Intronic
917629680 1:176879561-176879583 CTTGGGGGCGGGGGGAGAGGTGG - Intronic
917635823 1:176935018-176935040 CTGCAGGGTTGGGGGAGAGGAGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917797314 1:178541751-178541773 CTGTTGGCCTGGGGTGGAGAGGG + Intronic
918304211 1:183231118-183231140 CTGTGGGGTTGGGGGTGGTAAGG - Intronic
918989893 1:191684938-191684960 CTGTGGGCCTGTGGGGGTGATGG - Intergenic
919027332 1:192192581-192192603 CAGTGGGGGTGGGGTAGGGATGG + Intergenic
919423622 1:197403786-197403808 GAGCGGGGCAGGGGGAGAGAGGG - Intronic
919593922 1:199538175-199538197 CTGTGGGGCAGGGAGCAAGATGG - Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919828674 1:201522774-201522796 CTGTGGGGGTGGGGCAGGGCAGG + Intergenic
919919769 1:202160987-202161009 CTGTGGGGCAGAAGCAGAGAAGG - Exonic
919970036 1:202569934-202569956 CAGTGGGGCAGGGGGAGGGGAGG + Intronic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920192021 1:204199753-204199775 CTGTGTGCCTGGGGGAGCCAGGG - Intronic
920312797 1:205058382-205058404 CTTTGGGGGAGGGGGAGAGGGGG + Intronic
920364699 1:205441923-205441945 CAGTCTGGCTGGGGAAGAGAGGG + Intronic
920412607 1:205774295-205774317 TTGTGGGGCTGTGGGTGGGATGG - Intronic
920451174 1:206062351-206062373 CTCTGGGGCTGGGGGTGATCTGG - Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
920699416 1:208206550-208206572 CTGATGAGTTGGGGGAGAGAAGG - Intronic
920877543 1:209850606-209850628 CTGTGCAGCTGGGAAAGAGATGG + Intronic
920978534 1:210809166-210809188 CTGGGGAGGTGGGGGAGGGAGGG + Intronic
921285408 1:213604835-213604857 CTGTGGGTCTGGGGAAGGGTGGG + Intergenic
921343149 1:214154388-214154410 ATGTAGGGGTGAGGGAGAGAAGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922560374 1:226565211-226565233 CTGAGGGGCAGGGAGAGGGAAGG - Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922618273 1:226976124-226976146 CTGTGGGGCTGCGGGACTGCGGG + Intronic
922754803 1:228089787-228089809 GTGTGGGGCTGGGGGATCCAGGG - Intronic
922777028 1:228219553-228219575 CTGTGAGGCCAGGGGACAGAGGG + Exonic
923000795 1:230004963-230004985 CTGCGGGGTTGGGGGTGTGAGGG + Intergenic
923019968 1:230155571-230155593 CTTTGGGGCTGGGAGGGACAGGG + Intronic
923765824 1:236891488-236891510 CTGTGAGGACGAGGGAGAGAAGG + Intronic
923797133 1:237168311-237168333 GTGCTGGGTTGGGGGAGAGATGG + Intronic
923828566 1:237527538-237527560 CTGTGTGGGAGGGGCAGAGAAGG - Intronic
923835580 1:237607421-237607443 TTGTGGGGTTGGGGGAGGGAGGG + Intronic
923886687 1:238165021-238165043 GTTTGGGGTTGGGGGAGAGATGG + Intergenic
924139756 1:241010038-241010060 GTGTGGGGCTGGGGGAGGGATGG + Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924284450 1:242471227-242471249 GTTTGGGGCTGGGGCAGAGATGG - Intronic
924606600 1:245540877-245540899 GGGTGGGGCTGGGGGAGGGGAGG - Exonic
924723458 1:246645003-246645025 CTTTGGGGTGGGGAGAGAGAAGG + Intronic
1062771240 10:103284-103306 GCGTGGGGCTGGGGGTGAGGGGG - Intergenic
1062819231 10:521869-521891 CGGTGGGGGTGGGGGAATGATGG - Intronic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1063088265 10:2839018-2839040 CAGAGGGGCTGGGGAAGAGCTGG - Intergenic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063510735 10:6642843-6642865 CTGGAGGGCTGGGAGGGAGAGGG + Intergenic
1063527127 10:6796676-6796698 GGGTGGGGCTTGGGGAGAGAAGG - Intergenic
1064075350 10:12264393-12264415 CTGAGGGCCTGGGGGAGGGCGGG - Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064559092 10:16578055-16578077 CTGGGGGGCGGGGGGAAATAGGG + Intergenic
1064886433 10:20118362-20118384 CTCCTGGGCTGGGGGAGAGAAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065583113 10:27191510-27191532 AGGTGGGGCGGGGGGAGAGGAGG + Intergenic
1065660198 10:27998630-27998652 AGATGGGGCTGGGAGAGAGAAGG + Intronic
1065917354 10:30364922-30364944 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1066328223 10:34388080-34388102 ATGGGGGGCTGGGAGATAGAGGG + Intronic
1066373136 10:34834454-34834476 CTGTGGGGTTGTGGGAAACAGGG + Intergenic
1066620603 10:37345258-37345280 CAGTGGGGCTGGGCATGAGAGGG - Intronic
1066623860 10:37385789-37385811 CAGTGGGGCTGGGCATGAGAGGG - Intergenic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067343014 10:45419500-45419522 CTGCGGGGCTGGGGGAGGGCCGG - Intronic
1067539902 10:47143801-47143823 GCCTGGGGCTGGGGGAGGGAAGG + Intergenic
1067790031 10:49281094-49281116 GTGTGGGGCAGGGGTATAGATGG - Intergenic
1067903118 10:50262819-50262841 CAGTGAGGCTGGGGGAGGGGCGG + Intergenic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1068621164 10:59184793-59184815 TTGTGGGGTTGGGGGAGGGGGGG - Intronic
1068969174 10:62945285-62945307 GAGTGGGGGTGGGGGAGAGGAGG - Intergenic
1069455884 10:68553409-68553431 CAGAGGGGGTGGGGGAGGGAGGG + Intergenic
1069615724 10:69805033-69805055 CTTTGAGGCTGGGGGCCAGAGGG + Intronic
1069687254 10:70326189-70326211 TTGTGGGGCTGTGGAAGAGCAGG - Intronic
1069695462 10:70382446-70382468 TGCAGGGGCTGGGGGAGAGAGGG - Intronic
1069762568 10:70822589-70822611 CTGTGGGGGAAGGGGAGATAGGG + Intronic
1069834495 10:71300293-71300315 CCCTGGGGCTGTGGGAGGGAGGG - Exonic
1069853437 10:71425211-71425233 CAGTGGGGCAGAGAGAGAGAGGG + Intronic
1069908055 10:71743636-71743658 GGGTGGGGCTGGGGCAGAGAGGG + Intronic
1070238652 10:74656023-74656045 CTGTGGGCCTTGGAGAGAGTAGG + Intronic
1070307665 10:75249180-75249202 CTGTGGGGCTAGGCGGGGGAGGG - Intergenic
1070499969 10:77063352-77063374 CTGGGTTGCTGGGGGAGAGGTGG + Intronic
1070513380 10:77181100-77181122 CTGTGGGCCTGGGTGATGGAAGG - Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070896091 10:79983665-79983687 CAGTGGGGCTGGGAGAGTGTGGG - Intergenic
1071852732 10:89591667-89591689 CTGTGGGGCTGAATGAGTGAAGG - Intronic
1072121057 10:92405865-92405887 CCTTGGAGCTGGGGGAGAGATGG + Intergenic
1072153490 10:92702448-92702470 GTGCGGGGCTTGGGGAGGGAGGG - Intergenic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073257741 10:102164887-102164909 ATGTGGGGTGGGGGGAGGGAAGG + Intergenic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1073968391 10:109017785-109017807 CTATGGAGCTGGGTGGGAGAAGG + Intergenic
1074001768 10:109380587-109380609 TTTTGGGGCTGGGGCAAAGAAGG - Intergenic
1074095107 10:110304751-110304773 GTGTGGGGCTGGGGGCGGGGCGG + Exonic
1074706939 10:116141515-116141537 CGAGGGGGTTGGGGGAGAGATGG + Intronic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075205387 10:120443484-120443506 CTGTGGGGGTTGGGGAGCAAGGG + Intergenic
1075407786 10:122206083-122206105 CTGGGGGGCGGGGGGAAAGAGGG + Intronic
1075463339 10:122632962-122632984 CAATGGGGCTGGGGAGGAGATGG + Intronic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1075797939 10:125134626-125134648 CTGTGGTGCGGGGGCAGAAAAGG - Intronic
1076284129 10:129276963-129276985 CTCTGTGGCTGCTGGAGAGACGG + Intergenic
1076302258 10:129437243-129437265 CTCTGGGGCTGGGTGGTAGAAGG - Intergenic
1076357566 10:129864228-129864250 CTCTGGGGCTGGTGCAGGGAGGG - Intronic
1076365032 10:129916183-129916205 GTGAGAGCCTGGGGGAGAGACGG + Intronic
1076568175 10:131412941-131412963 GTGTGGGGCCGGGGGAAAGGCGG + Intergenic
1076696483 10:132249718-132249740 CTTTGGGGCTGGGGTCGGGAGGG - Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076847420 10:133076152-133076174 CTGTGATGCTGGGGGAGTGAGGG - Intronic
1076993058 11:285514-285536 TGGTGGGGCTGGGGGAGAAGGGG - Intergenic
1077077745 11:708992-709014 CTGTGGGGAGGGGGGTGGGATGG - Intronic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077094921 11:795237-795259 GTGAGGGGCTGCGTGAGAGAGGG - Intronic
1077300922 11:1846571-1846593 TGCTGGGGCTGGGGGAGAGTCGG - Intergenic
1077317329 11:1925334-1925356 ATGTGGGGGTGGGGGAGAGGGGG + Intronic
1077602298 11:3582020-3582042 CTGTGGGGCTGGAGCATGGAGGG + Intergenic
1077677770 11:4212208-4212230 CTGCGGGGCTGCGGCAGGGAGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077868618 11:6243013-6243035 GTGTGGGGAGGGTGGAGAGAGGG - Intronic
1077895103 11:6448334-6448356 TTGTGGGGTTGGGGGGGTGAGGG - Intergenic
1077988549 11:7380293-7380315 GTGAGGGGCTGGGGGAGTGTGGG + Intronic
1078107780 11:8369536-8369558 CAGTGGGGCCTGGGGAGGGAGGG + Intergenic
1079007282 11:16800846-16800868 ATCTGGGGCTGAGGGGGAGAAGG + Intronic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1079182731 11:18208257-18208279 CTGCTGGGCTGTGGGAGAGAGGG - Intronic
1079237624 11:18701229-18701251 TCCTGGGGCTGGGGGATAGAGGG + Intronic
1079463526 11:20706515-20706537 TTGTGGGGTTGGGGGGGAGGGGG + Intronic
1080206606 11:29736665-29736687 CTGTGTGGCTAGGTCAGAGAGGG - Intergenic
1080685447 11:34511544-34511566 CTGTGGGAGTGAGGCAGAGATGG + Exonic
1081253802 11:40868189-40868211 CACAGGGGTTGGGGGAGAGAAGG + Intronic
1081403890 11:42673964-42673986 CTGTGGGGGTGAGAGAGAGAGGG + Intergenic
1081496184 11:43612860-43612882 CTGTGGAACTGGGTGAGAAATGG + Intronic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081574165 11:44309147-44309169 CTGCGGGGCTGCGGGACAGCAGG - Intronic
1081577515 11:44328371-44328393 CTCTGGGCCTGGGGGAGAGGAGG - Intergenic
1081866776 11:46364614-46364636 CAGGGGTGTTGGGGGAGAGATGG - Intronic
1082000141 11:47389708-47389730 CACTGGGGCTGGGGCAGAGTGGG - Intergenic
1082005840 11:47418559-47418581 GAGTGGTGCTCGGGGAGAGAGGG + Intergenic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1082788447 11:57330628-57330650 CAGTGGGGCTGGGAGAGGGAGGG - Intronic
1083177064 11:60957038-60957060 TTGTGGGGGTGAGAGAGAGATGG - Intergenic
1083265797 11:61546297-61546319 GGGTGGCGGTGGGGGAGAGAGGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083493551 11:63030919-63030941 CTGGGGGGCTGTGGGGGAGACGG + Intergenic
1083629531 11:64088447-64088469 CTGTGGGCCTGGGGCAGGGCAGG + Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083803669 11:65060941-65060963 GTGTGGGGCAGGTGGAGAGTGGG - Intergenic
1083865097 11:65449323-65449345 CTTTTGGGCTGAGGGAGTGAGGG - Intergenic
1083998855 11:66285164-66285186 CTGCGAGTCTTGGGGAGAGAAGG - Intronic
1084218162 11:67662774-67662796 CAGTTGGGATGGGGCAGAGATGG + Exonic
1084272787 11:68038187-68038209 CTGTGGGGCTGCGGCAGGGGTGG - Intergenic
1084431765 11:69115314-69115336 CTGTGGGTCAGGGGGATGGAGGG + Intergenic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1084548870 11:69828897-69828919 CAGTGGGGCTGGGGGAGCCATGG - Intergenic
1084814553 11:71638643-71638665 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085224057 11:74902778-74902800 GTGGGGGCCTGGGGGAGAGGTGG + Intronic
1085388220 11:76169206-76169228 CTCTGGGGCTGGGCTGGAGAGGG + Intergenic
1086067038 11:82756558-82756580 CTGTGTGGCTGGGGCAGGGTTGG + Intergenic
1086153513 11:83639611-83639633 GTGGGGGGATGGGGGAGGGATGG + Intronic
1086315702 11:85589545-85589567 CTGTGGGGGTGTGGGAGGGGTGG + Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086942281 11:92810646-92810668 GAGTGGGGGTGGGGGAGATAAGG + Intronic
1087117104 11:94537259-94537281 GTCTTGGGCTGGGGGAGGGAGGG - Intergenic
1087935947 11:104035056-104035078 AAGTGGGGGTGGGGGAGAGTAGG + Intronic
1088497687 11:110447690-110447712 TTTTGGGGATGGGAGAGAGAGGG - Intronic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1088878155 11:113952709-113952731 GAATGGGGCTGGGGTAGAGAAGG - Intergenic
1088978003 11:114832981-114833003 CTGGGGGGCAGGGGAAGAGGGGG + Intergenic
1089198991 11:116711959-116711981 TTTTGGGGCTTGGGGAGAGAGGG - Intergenic
1089298234 11:117482163-117482185 CTGGGGGGCGGAGGCAGAGAAGG + Intronic
1089305762 11:117525132-117525154 AAGTGGCGCTGGGGGAGGGAAGG + Intronic
1089378997 11:118014367-118014389 CTGTCTGCTTGGGGGAGAGATGG + Intergenic
1089466844 11:118691005-118691027 CTGTGTGACTGGGGCAGAGTGGG - Intergenic
1089619830 11:119715783-119715805 CTGGGTGGATGGTGGAGAGATGG - Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089678314 11:120105385-120105407 CTGTGGGGCAGGGGGCTGGAAGG + Intergenic
1090172696 11:124618649-124618671 GTGGGGGGGTGGGGGAGACAGGG + Intronic
1090437202 11:126696707-126696729 CGGTGTGGCTTTGGGAGAGAGGG - Intronic
1090878488 11:130812788-130812810 CTGGAGGGCAGGAGGAGAGAAGG - Intergenic
1090962225 11:131567146-131567168 GTGGGGGACTGGGGAAGAGAGGG + Intronic
1091336058 11:134767222-134767244 GCCTGGGGCTGGGGGAGGGATGG - Intergenic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091635334 12:2192756-2192778 CTGTGGAGGAGGGGGAGAGTGGG - Intronic
1091766091 12:3120713-3120735 CTGTGGGGCTGGGAGGGCTAGGG + Intronic
1091903404 12:4163981-4164003 CTGTGGAGCTGAAGGAGACAAGG + Intergenic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092963826 12:13622440-13622462 CTTTGGGGGTGGGGAAGTGAGGG - Intronic
1093446675 12:19267653-19267675 TTGGGGGGTTGGGGGAGGGAGGG - Intronic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1094797296 12:33990375-33990397 CGGTGGGGAGCGGGGAGAGAAGG - Intergenic
1094843299 12:34350842-34350864 ATGTGCGGCAGGGGGAGCGAGGG + Intergenic
1095110035 12:38284374-38284396 CGGTGGGGAGGGGGGAGAGGAGG - Intergenic
1095133979 12:38575572-38575594 TTGTGGGGTTGGGGGAGGGGGGG - Intergenic
1095169745 12:39020097-39020119 CTGTGGGCCTGGGGTGGTGATGG + Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1095916631 12:47486598-47486620 GAGTGGGGGTGGGAGAGAGATGG - Intergenic
1095953875 12:47795760-47795782 CTGTCAGCCTGGGGGAGAGGCGG + Exonic
1096161512 12:49382046-49382068 CTGTGGAGCACAGGGAGAGAGGG - Intronic
1096280552 12:50249180-50249202 CTGCAGAGCTTGGGGAGAGAGGG - Intronic
1096344017 12:50829155-50829177 GCCTGGGGCTGGGGGAGGGATGG + Intergenic
1096543750 12:52323009-52323031 CTGTGGGCCTGAGGGAGGGCAGG + Intergenic
1096558904 12:52422062-52422084 CAATGGGGTTGGGGGACAGATGG + Intergenic
1096567452 12:52493220-52493242 GTGAGAGGCTGGAGGAGAGAGGG + Exonic
1096792339 12:54053067-54053089 CTCTGGGGCTGGGGCAGGGAGGG + Intronic
1096840467 12:54376676-54376698 CTGTGGGGCTGGGCGGGATTAGG + Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096976161 12:55700307-55700329 CTACGAGGCGGGGGGAGAGAAGG - Exonic
1097100790 12:56587637-56587659 CTGTGCTGCTGAGGGAGAGATGG - Exonic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097350845 12:58547051-58547073 CTGGAGGGCTGGGATAGAGAGGG + Intronic
1097386987 12:58962021-58962043 CTGGGGGGAGTGGGGAGAGAGGG - Intergenic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1097627595 12:62019667-62019689 TTGTGGGGTGGGGGGAGGGAGGG + Intronic
1097917928 12:65039663-65039685 CTTTGGGGCTGGGATAGAGAAGG - Intergenic
1098051751 12:66461726-66461748 GTCTGGGGCGGGGGGAAAGAGGG - Intronic
1098241573 12:68472640-68472662 CTATTGTGCTGGGGGAGAGTTGG - Intergenic
1099276978 12:80589313-80589335 CTGGAGGGCTGGGGCAGAAATGG - Intronic
1099808688 12:87553034-87553056 CTGTGGTGCTTGGGGAAAGGAGG - Intergenic
1099959584 12:89383883-89383905 CAGTAGGGCTGGGGGCGGGAGGG + Intergenic
1100420027 12:94423912-94423934 CTGTGCTGCTGAGGCAGAGATGG + Intronic
1100749251 12:97678937-97678959 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1100784542 12:98065067-98065089 CTGGGGACCTGGGGGAGAGTGGG + Intergenic
1100829386 12:98503908-98503930 CTGTTGGGGGAGGGGAGAGAGGG + Intergenic
1101302827 12:103498873-103498895 GGGTGGGGTTGGGGGAGGGAGGG + Intergenic
1101987267 12:109457261-109457283 CTGTGGGGTTGGGGAAGCAATGG + Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102497488 12:113329624-113329646 CTCTGCGTCTGGGGGAGGGAAGG + Intronic
1102503523 12:113369238-113369260 TTGTGGGGCTGGGGCAGGGTGGG - Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102577158 12:113863052-113863074 GTGTGTGGTGGGGGGAGAGAAGG + Intronic
1102677504 12:114668565-114668587 ATCGGGGGCGGGGGGAGAGAAGG + Intergenic
1102898855 12:116620494-116620516 ATGTGGGGTTGGCGGAGGGAAGG - Intergenic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103034648 12:117646818-117646840 CTGGGGGACTGCGGGAGGGAGGG - Intronic
1103048825 12:117761396-117761418 CCCTGGGGCTCTGGGAGAGATGG + Exonic
1103248742 12:119481393-119481415 GTCTGGGGGTGGGGGAGAGCAGG + Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1103673260 12:122635637-122635659 CTGTGGGGCAGGGTGAGAGGAGG + Intergenic
1103736220 12:123062408-123062430 CTGTGGGGCTGGGGGAATCCTGG + Intronic
1103936998 12:124482244-124482266 CTCTGGGGCCAGGGGAGGGAGGG - Intronic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1103987632 12:124778293-124778315 CTGTGGGCCACGTGGAGAGAAGG + Exonic
1104110676 12:125701092-125701114 CTGTGGGGTTGTGGGGGAGGTGG + Intergenic
1104198782 12:126567309-126567331 CTGTGGGGCAGGGGGTGGGTGGG - Intergenic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1104383787 12:128331084-128331106 CTGGGGGGCAGGGGGAAAGAGGG - Intronic
1104618641 12:130292592-130292614 CTGGGGAGCAGGGGAAGAGATGG + Intergenic
1104729180 12:131095552-131095574 CTGTGGGGCTGAGGGTGGGCCGG + Intronic
1104761504 12:131299777-131299799 CTGAGGGGCTGCGGGTGGGAAGG + Intergenic
1104818272 12:131661015-131661037 CTGAGGGGCTGCGGGTGGGAAGG - Intergenic
1104970936 12:132530415-132530437 CTGTGGGTCAGGGGGAGGGCCGG + Intronic
1104994331 12:132644679-132644701 CTGGGGGGCTCTGGGAGAGCTGG + Intronic
1105253253 13:18720383-18720405 GTGTCGGGCTGGGGGACAGTCGG - Intergenic
1105356971 13:19667523-19667545 GTCAGGGGCTGGGGGAGGGAGGG - Intronic
1105700895 13:22935223-22935245 CTGTGGGGCTTGGGGTGGGTGGG - Intergenic
1105853717 13:24358280-24358302 CTGTGGGGCTTGGGGTGGGTGGG - Intergenic
1105858451 13:24390679-24390701 CCGTGGCGCTGGGGGAGGGAGGG + Intergenic
1106074827 13:26448940-26448962 CTGTGGGCCTGGGGCAGTGGTGG + Intergenic
1107425992 13:40293344-40293366 CTGTGGGGCTGGGTGAGGCTAGG - Intergenic
1107651410 13:42549028-42549050 AAGTGGGGCTGGGGGAAACAGGG - Intergenic
1108152281 13:47548504-47548526 CTTTGGGGCTGGATGAGAGCAGG - Intergenic
1108268869 13:48738997-48739019 ATGTGGGCCTGAGGGAGAGAGGG - Intergenic
1108307353 13:49151712-49151734 TTGGGGGGATGGGGGAGGGATGG - Intronic
1109528346 13:63605993-63606015 CTCTGGGGCTGTGGAAAAGAGGG - Intergenic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1109920516 13:69052056-69052078 TTGTGGGGTGGGGGGAGGGAGGG - Intergenic
1110661641 13:78064597-78064619 CTGTAGGAGTGGGGGAGGGAGGG - Intergenic
1110735133 13:78927770-78927792 CTGTGGGTCTTGGGCAGATAGGG - Intergenic
1111994439 13:95150486-95150508 CAGTGGGGAAGGGGGAGGGAGGG - Intronic
1112037605 13:95511993-95512015 TTGTGGGGTGGGGGGAGAGGGGG - Intronic
1112087925 13:96051329-96051351 TTGTGGGGTTGGGGGAGCGGGGG + Intronic
1112262091 13:97886229-97886251 CTGTGAGGCAGGGAGGGAGAAGG + Intergenic
1112496783 13:99911532-99911554 ATGTGGTGGTGGGGGAGAGTAGG - Intergenic
1113614023 13:111668711-111668733 CTGTGAGGCTGGGGGAGCCGCGG - Intronic
1113631824 13:111893479-111893501 CTGGAGGGCTGTGGGAGGGACGG + Intergenic
1113653643 13:112055469-112055491 CTGTGGGGAGGAGGCAGAGAGGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113913546 13:113856299-113856321 CGCTGGGACTGGGGGAGAGCAGG - Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114674418 14:24430939-24430961 CTGGAGGGATGGGGGAGAGAAGG - Intronic
1114965799 14:27957601-27957623 CTGTGGCGCTACGGGAGATAAGG + Intergenic
1115059069 14:29168630-29168652 CTGAGGAGCTCAGGGAGAGAGGG + Intergenic
1115211742 14:30973332-30973354 GTGGGGGGGAGGGGGAGAGAAGG + Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1116233905 14:42253500-42253522 GTGGGGGGCTAGGGGAGGGATGG + Intergenic
1116269693 14:42745602-42745624 GTGAGGGGCTGGTGGAGAGGTGG + Intergenic
1116368899 14:44104952-44104974 CTGTGGGGCAGGGGCAGTGAAGG - Intergenic
1116481123 14:45392368-45392390 CTGTGGGCCTGGGGTAGTGGTGG + Intergenic
1116680094 14:47957417-47957439 TGATGGGGCTGGGAGAGAGAGGG - Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117535465 14:56698694-56698716 CCCTGGGGCTGGGAGTGAGATGG + Intronic
1118375249 14:65171151-65171173 CAGTGGGGCTGGGGGACATGAGG + Intergenic
1118882949 14:69843972-69843994 CAGTGGAGCTGGGGAAGAGAAGG + Intergenic
1118988888 14:70780262-70780284 TTGTTGGGCTGGAGGATAGAAGG + Intronic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1119485646 14:74984915-74984937 CTGTGGGACTTGGGGACTGAGGG + Intergenic
1119621377 14:76134392-76134414 CAGTGGTGCAGTGGGAGAGATGG - Intergenic
1119725785 14:76920970-76920992 CCGTGGGGGTGGGGGAGGGTAGG + Intergenic
1120515092 14:85461215-85461237 GAGAGGGGGTGGGGGAGAGAAGG - Intergenic
1121111195 14:91314217-91314239 CACTGGGGATGGGAGAGAGAAGG + Intronic
1121122574 14:91385269-91385291 CCCTGGGTCTGGGGTAGAGATGG - Intronic
1121253302 14:92514706-92514728 AGGTGGGGCTGGGGGCGACAAGG - Intronic
1121573133 14:94962360-94962382 ATGTGGGGATGGGGGAGGTAAGG - Intergenic
1121620653 14:95345854-95345876 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
1122072740 14:99215087-99215109 GTGGGGGGCTGGGGGAGATGGGG - Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122806355 14:104261603-104261625 CTGTGCTGCTGGGGGAGGCAGGG + Intergenic
1122811652 14:104292253-104292275 CGGTGTGGGTGGGGGAGGGAGGG + Intergenic
1122860271 14:104579420-104579442 CTGTGGGGCTGCGGGAGGTGAGG - Intronic
1123586483 15:21765047-21765069 CTGTGGGGGTGGGGGGGCGGGGG - Intergenic
1123623122 15:22207612-22207634 CTGTGGGGGTGGGGGGGCGGGGG - Intergenic
1123631196 15:22260833-22260855 CCTTGGGGCTGGGGGGGAGGGGG - Intergenic
1124153274 15:27201327-27201349 CAGTGGGGCATGGGGAGTGAGGG + Intronic
1124406397 15:29396263-29396285 GCCCGGGGCTGGGGGAGAGAGGG - Intronic
1124813553 15:32965968-32965990 CTGTGGTGCTGGGGGAGACGGGG + Intronic
1124959098 15:34381927-34381949 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1124975724 15:34528148-34528170 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1125460172 15:39898850-39898872 CTGTGTGGGTGGGGGAGAAGGGG + Intronic
1125482808 15:40092282-40092304 CTTTGGAGTCGGGGGAGAGAGGG - Intronic
1125499776 15:40232358-40232380 CTGGTGGGCTGGGGCTGAGATGG + Intergenic
1125599362 15:40906962-40906984 CAGTAGGGCTGGGGGAGTGGAGG - Intergenic
1125768503 15:42150367-42150389 CTGTGGCCCTGGGGGAGGTAAGG - Exonic
1125832653 15:42727770-42727792 CTGTGGGGCAGAGGGAGAATGGG + Intronic
1126034902 15:44536967-44536989 CTGCGGGGCTGAGGGAGAGGCGG - Intergenic
1126109538 15:45167422-45167444 CTTTGGGGGGTGGGGAGAGAAGG - Exonic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1126585032 15:50276743-50276765 ATGTGGTGCTGGAGCAGAGAAGG - Intronic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127034031 15:54895353-54895375 CTGTGGACCTGGGGCAGTGAAGG - Intergenic
1127234905 15:57038435-57038457 AGGTGGGGGTGGTGGAGAGAAGG + Intronic
1127582830 15:60353337-60353359 CTGTTGTGGTGGGGGAGAAAGGG - Intronic
1127993022 15:64134641-64134663 CTGTGGGGGTGGGGTTGAGGAGG - Intronic
1128451332 15:67807449-67807471 GGGTGGGGCTGGGGTGGAGAAGG - Intergenic
1128566073 15:68700986-68701008 CTGAGGAGCTGGGGGCGGGATGG + Intronic
1128717412 15:69918766-69918788 CTGTGGGGCAGGGGGAGTGGTGG + Intergenic
1129150445 15:73684681-73684703 CTGTGGGGCCCGCGGAGAGCTGG + Intronic
1129161850 15:73752058-73752080 AGGCGGGGCTGGGGGAGGGAGGG - Intronic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1129332032 15:74832644-74832666 CTGTGGGGCTCAGATAGAGATGG + Intergenic
1129465359 15:75721693-75721715 CCCTGGGGGTGGGGGAGAGGGGG + Intergenic
1129708394 15:77807603-77807625 CTGTGGTCCTGGGAGAGAAATGG - Intronic
1129846629 15:78770759-78770781 CTGAGGAGCATGGGGAGAGAGGG + Intronic
1130080018 15:80724691-80724713 CTGTGGGTCTGGGAGGGTGATGG + Intronic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130167598 15:81479520-81479542 ATATGGGGCCGGGGGAGGGAAGG + Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1131129956 15:89892224-89892246 CTCTGGGGCTGGGAGAGTCATGG + Intronic
1131421099 15:92306080-92306102 ATATGGGGTTTGGGGAGAGAGGG + Intergenic
1131421507 15:92309430-92309452 GTGGGGGGCTAGGGGAGGGATGG + Intergenic
1131435193 15:92416503-92416525 CTGAGGGGCTGGGAAAGAGAAGG + Intronic
1132116012 15:99137053-99137075 CTGTGGGACCAGGGGAGGGAGGG + Exonic
1132294751 15:100726762-100726784 CTCTGAGCCTGGGGGAGAGTAGG + Intergenic
1132483917 16:180615-180637 CCGGGGGGCTTGGGGAGGGAGGG - Intronic
1132598559 16:763945-763967 CTGTGGGGCTTGGGGAGCACTGG + Intronic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132676663 16:1123880-1123902 CTGTGGGGCTGGGGGAAGCCGGG + Intergenic
1132803141 16:1763852-1763874 CTGTGGGGCGGGGAGAGGGCGGG + Intronic
1132929329 16:2450977-2450999 CAGTGGGGCTGGGGCAGACAGGG - Intronic
1132984410 16:2756793-2756815 CTGTGTGTCTGGGGCATAGATGG + Intronic
1133042413 16:3067674-3067696 GTGTGGGGCTCAGGGTGAGAAGG + Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133464838 16:6019477-6019499 CTGGGGGGCTGGGGCGGAGGGGG - Intronic
1133769210 16:8858119-8858141 ATGTGAGGCTGGGGGCGACACGG - Intronic
1133933646 16:10252102-10252124 CTGTGGAGGTGGCAGAGAGAAGG - Intergenic
1134188821 16:12105714-12105736 TTCTGGGGCAGGAGGAGAGAAGG - Intronic
1134610856 16:15606842-15606864 CTGTGGGGCTGAGGGAGCAAGGG - Intronic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1135258990 16:20964949-20964971 CAGTGGTCTTGGGGGAGAGAAGG - Exonic
1135359202 16:21796893-21796915 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135457754 16:22613330-22613352 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135496604 16:22956912-22956934 CTGTGGCTCCTGGGGAGAGAGGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136091764 16:27925750-27925772 CCGAGGGGCTGGGGGTGACAAGG + Intronic
1136344630 16:29666767-29666789 CTGTGGGGCCTGGGTGGAGAGGG + Exonic
1136394947 16:29987578-29987600 CTGTGGGGCTGTGGGGGACCGGG + Exonic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1137248961 16:46729358-46729380 CTGTGGGGCCTGGGGCAAGAAGG - Intronic
1137252964 16:46753261-46753283 GTGTGGGGCAGGAGGAGGGATGG - Intronic
1137360047 16:47805983-47806005 CTGTGAGGCTGGGGTTGAGTTGG + Intergenic
1137471639 16:48764713-48764735 GTGGGGGGATGGGGGAGGGAGGG + Intergenic
1137479524 16:48840179-48840201 GTCTGGGGCTCTGGGAGAGAAGG - Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1137715678 16:50596961-50596983 CTGTGTGGCTGTGGGCGAGCGGG + Intronic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1137792794 16:51188981-51189003 CTGTGGGGCTGAGGTGTAGATGG - Intergenic
1138180038 16:54935037-54935059 CTGCGGGGCTGGGGTCGAGCGGG + Intergenic
1138264758 16:55652440-55652462 CGGTGAGTCTGGGCGAGAGATGG + Intergenic
1138469149 16:57218471-57218493 TAGTGGGGGTGGGGGAGAAATGG - Intronic
1138536730 16:57664164-57664186 CTGGGGGGCTGAGGGAGGGAGGG - Exonic
1138559080 16:57789239-57789261 CTGTGGGGCGGAGAGAGTGAAGG - Intronic
1138870897 16:60883224-60883246 CTGTTGATCAGGGGGAGAGAAGG + Intergenic
1139074662 16:63429383-63429405 TTGTGGGGTGGGGGGAGAGGGGG + Intergenic
1139340616 16:66265654-66265676 CTGTGCGGCTGGCAGAGAGCAGG - Intergenic
1139492011 16:67291242-67291264 TTGTGGGGCAGGGGAAGAGGTGG + Intronic
1139560326 16:67737745-67737767 CTGTGGGGCTGGGGCGGGTAGGG - Intronic
1139577077 16:67848219-67848241 CCTTGGGACTAGGGGAGAGATGG + Intronic
1139846244 16:69923892-69923914 TTGGGGGGTTGGGGGAGATAGGG - Intronic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1140548526 16:75836586-75836608 CTGTGGGGTGGGGGGAGGGTAGG + Intergenic
1140819599 16:78650764-78650786 TTGTGGGACAGGGGGAGACATGG - Intronic
1140832374 16:78763950-78763972 ATGTGGGGCAGAGGGAGAGTGGG - Intronic
1140887639 16:79258883-79258905 CTGTGCGACTAGGGGAGGGAGGG + Intergenic
1141089059 16:81117557-81117579 CTGTGGGGCGGGGGCAGTCACGG - Intergenic
1141173147 16:81703839-81703861 CTGTAGGGCGAGGGGAGAGGAGG + Intronic
1141173592 16:81705424-81705446 CTCTGAGGCTGGGGCAGAGGTGG - Intronic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141533222 16:84661089-84661111 CTGTGGGGAGAGGGGAGGGAGGG - Intronic
1141534326 16:84668673-84668695 CTGGGGGGGCGGGGAAGAGAAGG - Intergenic
1141555397 16:84833848-84833870 CTGCTGGGCTGGGGGAGTCAGGG - Intronic
1141721149 16:85756045-85756067 CTGTGGGGGGCGGGGATAGAGGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142034794 16:87856267-87856289 TGCTGGGGCTGGGGCAGAGATGG + Intronic
1142125887 16:88410091-88410113 ATGTGGGGGTGGGGGAAGGAAGG + Intergenic
1142184384 16:88687440-88687462 CTGTGGGCCGGGGGTGGAGAAGG + Intergenic
1142420238 16:89965631-89965653 CTGTGTGGTTGGGGGATAGCAGG + Intronic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1142555530 17:774168-774190 GTGTGGGACTCGTGGAGAGATGG - Intronic
1142596810 17:1033760-1033782 CTGAGGGGGAGGTGGAGAGACGG + Intronic
1142668480 17:1475822-1475844 CCGAAGGGCTGGGTGAGAGAGGG + Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1142715604 17:1745404-1745426 AGGTGGGGCTGGGGAAGAGTGGG + Intronic
1142904723 17:3034147-3034169 CTGTGGGGTGAGGGGAGGGAGGG + Exonic
1143164206 17:4889844-4889866 ATCTGGGGGTGGGGGAGAGAAGG - Intronic
1143625820 17:8109697-8109719 CTGCGGGGGCGGGGGAGACAGGG + Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1143875359 17:9986855-9986877 CTGTGAGCCTGGGGCAGGGATGG + Intronic
1144110168 17:12022716-12022738 CTGTGAAGATGGGGGAGGGAAGG + Intronic
1144232971 17:13227712-13227734 CTGAAGGGCATGGGGAGAGATGG + Intergenic
1144455001 17:15411695-15411717 CTTTGGAGCAGGAGGAGAGAAGG + Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1144695944 17:17303851-17303873 GTCTGGGGCTCGGGGCGAGAAGG - Intronic
1144728518 17:17513686-17513708 CTGAGGGGCTGGTGCAGGGAGGG + Intronic
1144954555 17:19012550-19012572 ATGTGGGGCAAGGGGACAGACGG + Intronic
1145266902 17:21384000-21384022 CTCTGGGGGTGGGGGAGGCAGGG - Intronic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145823112 17:27855575-27855597 CTCTGGGGCTGGGGCAGGCAAGG + Intronic
1145826559 17:27881283-27881305 GTGTGGGGCTGGGAGTGACAGGG - Intronic
1145994434 17:29097351-29097373 CTGTGGGGTTGAGGCAGACAAGG + Intronic
1146686161 17:34842918-34842940 CTGTGGGGCTAGGAGAGGGATGG - Intergenic
1146769250 17:35553598-35553620 CCGTGGGGATGGGGGAGAGTTGG - Intronic
1147250833 17:39151666-39151688 CGGTGGGGGTGGGGGGGAGCTGG + Intronic
1147338108 17:39739001-39739023 CGGTGGGGCCTGGGGAGAGTGGG + Intronic
1147339598 17:39745705-39745727 CTGTGGAGCAGTGGGAGATACGG - Intronic
1147364891 17:39953080-39953102 GGGTGGGGCTGGGGCCGAGACGG + Intergenic
1147422339 17:40328117-40328139 GTGTGGAACTGAGGGAGAGAGGG - Intronic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147657489 17:42098944-42098966 CTGTGTGGCAGGGAGGGAGATGG - Intergenic
1147728589 17:42582314-42582336 ATGTGGGGCTGGGGCACAGGAGG - Intronic
1147811787 17:43175776-43175798 CTGTGAGGCTAGGGTTGAGAAGG - Exonic
1147871623 17:43591711-43591733 CTGGGGGGCTGGGGGAAACCTGG + Intergenic
1147983140 17:44287731-44287753 GGGTGGAGCTGGGGGAGGGAAGG - Intergenic
1148103226 17:45105368-45105390 CTGTGGCACTGGGGGAGGAAGGG - Intronic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148124067 17:45228032-45228054 ATGGGGGGCTGGGGGACACACGG - Intronic
1148189068 17:45666347-45666369 CTCAGGAGCTGGGGGAGAGGAGG - Intergenic
1148369844 17:47090175-47090197 ATGTGGGGCTGGGGTAGGGATGG - Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148841708 17:50502943-50502965 CTGTGGGGCAGGGAGAGAGCTGG - Intergenic
1148849788 17:50549028-50549050 CTGGTGGCCTGGCGGAGAGAGGG - Exonic
1148852014 17:50560150-50560172 CTGCGGGACTGGGGGAGGGAAGG - Intergenic
1148865149 17:50624428-50624450 CTGTGGGGCTGGAGCAGATGAGG - Exonic
1148990988 17:51667251-51667273 CTGGGGAGCAGGGGGAGAGCTGG - Intronic
1149330443 17:55576003-55576025 CTTTGGGGTAGGGGGAGTGAGGG - Intergenic
1149349775 17:55774873-55774895 AGGTGGGGCGGGGGGAGGGATGG + Intronic
1149659571 17:58327241-58327263 CTTAGGGGCTGGGGGATACAGGG - Intronic
1150027388 17:61691081-61691103 TTGTGGGGTGGGGGGAGAGGGGG + Intronic
1150227900 17:63533742-63533764 CAGAGGGGATGAGGGAGAGATGG - Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151156220 17:72124316-72124338 CTGTGGGTCTGCGGGATGGAAGG - Exonic
1151261088 17:72916593-72916615 TTGGGGGGCAGGGGAAGAGAGGG - Intronic
1151334536 17:73432140-73432162 GAGTGGGGGTGGGGTAGAGAGGG + Intronic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1151679165 17:75614750-75614772 CTGTGGGGCAGGGAGAGGGTTGG - Intergenic
1151679346 17:75615391-75615413 CTCTGGGACTGGAGGAGGGAGGG + Intergenic
1151793181 17:76322960-76322982 CTGCAGGTCTGGGTGAGAGAGGG + Intronic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1152098215 17:78285245-78285267 GTCAGGGGCTGGGGGAGGGAAGG + Intergenic
1152163802 17:78687593-78687615 CTGAGGCGCTGGGGCAAAGAAGG + Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152470024 17:80485963-80485985 CTGTGGGGCTCTGGGCAAGATGG + Intergenic
1152598916 17:81251665-81251687 TTGGGGGGTTGGGGGACAGAAGG + Intronic
1152653631 17:81509180-81509202 ATATGGGGATGGGGGAGAGGAGG - Intergenic
1152656854 17:81523838-81523860 GTGTGCAGCTGGGGGAGAGGTGG - Intronic
1152667731 17:81580931-81580953 CTGGGGGCCTGGGAGAGACATGG + Intronic
1152681835 17:81672480-81672502 CTGCCAGGCTGAGGGAGAGAGGG - Exonic
1152754166 17:82080190-82080212 CTGTGAGGCTGAGGCTGAGACGG - Exonic
1152795511 17:82304321-82304343 CCCTGGGGCTGGGGGTGGGAAGG + Intergenic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1152848562 17:82617653-82617675 CTGTGTGTCTGGGAGAGGGAAGG + Intronic
1152898875 17:82928713-82928735 AGCTGGGGCTGGGGAAGAGATGG - Intronic
1152992756 18:377872-377894 GAGTGGGGCTGGGGGAAATAGGG + Intronic
1153530273 18:6039042-6039064 GCATGGGGCTGGGGGAGAGAGGG - Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1153978881 18:10292509-10292531 CTGAGGGGTTGGGGGAGTGGAGG - Intergenic
1155124131 18:22854336-22854358 AGGAGGAGCTGGGGGAGAGAAGG + Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155443461 18:25885411-25885433 CTGTGGGCCTGGGTTAGTGATGG + Intergenic
1156028912 18:32690017-32690039 CTCAGGGGCAGGGGAAGAGAGGG + Intronic
1156458380 18:37307481-37307503 CTGTGGTGGTGGGGGAGCGGGGG - Intronic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157221360 18:45830324-45830346 GTGTGGGGCTTTGGGAGAGTAGG + Intronic
1157475251 18:48019872-48019894 ATGTGGTGATGGGGGAGAGATGG + Intergenic
1157496992 18:48163154-48163176 CTGTCAGGATGGGAGAGAGATGG - Intronic
1157543525 18:48530902-48530924 CTGTGGGGCAGTGGCAGAGGTGG - Intergenic
1157557692 18:48623360-48623382 CTGTGGGGATCGGGGAGGCAGGG - Intronic
1158514656 18:58120854-58120876 CAGTGGGGATGGGGGAGTGAGGG - Intronic
1158522867 18:58186231-58186253 CAGAGGGAGTGGGGGAGAGAAGG - Intronic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159105751 18:64000776-64000798 TTGTGGGGGCAGGGGAGAGAGGG - Intronic
1159770041 18:72538555-72538577 CTCTGAGGCTGAGGGAGACAGGG - Intronic
1160158264 18:76450354-76450376 CTGTGGGGCCTGGGGAGGGTGGG - Intronic
1160323225 18:77915551-77915573 CTGTGGGGCAGGGGCAAAAAAGG - Intergenic
1160373077 18:78390557-78390579 CTGCGGGCCTGGGGGTGACATGG + Intergenic
1160515925 18:79479229-79479251 ATGAGGGGCTGGGGTAGAGGTGG - Intronic
1160584557 18:79905111-79905133 CTGTGGGCTTGGGAGAGAGGAGG - Intronic
1160828894 19:1093626-1093648 ATGGGGGGCTGGGGGTGAGTGGG + Intronic
1160859198 19:1230616-1230638 GCGTGGGGCTGGGGCAGAGCAGG - Exonic
1160979539 19:1810676-1810698 TGGTGGGGCTGTGGGAGAGAAGG + Exonic
1161060129 19:2210623-2210645 CTCTGGTGCTGAGGAAGAGAAGG + Exonic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161378346 19:3951275-3951297 CAGGGGGACGGGGGGAGAGATGG + Intergenic
1161398787 19:4058680-4058702 CTGCTGGGCTGGGGGACAGGAGG - Intronic
1161407269 19:4097657-4097679 CTGGAGGGCAGGGGGAGGGACGG + Intronic
1161426919 19:4208750-4208772 CTGTGAGGGCTGGGGAGAGAGGG - Exonic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1162057670 19:8074382-8074404 CTGTGAGGCAGTGGGAGAGCAGG + Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162334550 19:10052474-10052496 CTCTGGGGCTGGGGAAGTCAGGG - Intergenic
1162402420 19:10454151-10454173 TTCTGGGGTTGGGGGAGAGTGGG + Intronic
1162430946 19:10628026-10628048 TGGTGGGGCTGGGGAAGAGGGGG + Intronic
1162550965 19:11357913-11357935 CAGTGTGGATGGGGCAGAGAGGG - Intronic
1162728137 19:12701952-12701974 CTGTGGGGGTGGGGCAGGGCAGG + Intronic
1162798082 19:13096756-13096778 CTGTGGGACTGTGGGAGCTAGGG + Intronic
1162934755 19:13976392-13976414 CTGTGGAGATGGGAGAGGGAAGG + Intronic
1162962466 19:14136205-14136227 CTGGCGGGCTGGGGGAGATCGGG + Intronic
1162992768 19:14314141-14314163 CTGTGGGGCTGTGTGAGGGTGGG - Intergenic
1162992778 19:14314179-14314201 CTGTGGGGCTGTGTGAGGGTGGG - Intergenic
1162992788 19:14314217-14314239 CTGTGGGGCTGTGTGAGGGTGGG - Intergenic
1162992805 19:14314291-14314313 CTGTGGGGCTGTGTGAGGGTGGG - Intergenic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163019509 19:14474904-14474926 CCATGGGGCAGGGGCAGAGATGG - Intronic
1163156278 19:15441304-15441326 GAGTGGGGCTGGGGGAGGCAAGG + Intronic
1163264110 19:16207996-16208018 CTGTGGCGGTTGGGGAGGGAGGG - Intronic
1163350000 19:16770607-16770629 CTGTGGGGCAGGGGGAGGGATGG - Intronic
1163475466 19:17523497-17523519 CTGTGGGGCTGGTTGAGGGCAGG + Intronic
1163571546 19:18085099-18085121 GTGTGGAACTGGGTGAGAGAAGG + Intronic
1163611256 19:18302953-18302975 CTGTGGGGAAGGGGCAGAGGGGG - Intergenic
1163797659 19:19346642-19346664 CAGTGGGGCTGGGCAAGAGGTGG - Intronic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1164125934 19:22317549-22317571 GTGGGGGGCTGCGGGAGGGATGG - Intergenic
1164618889 19:29682163-29682185 CTGTGCTGCTGCGGGAGACAGGG - Intergenic
1164863234 19:31580496-31580518 CTGTGGGGCTTGTGGAGTGCTGG + Intergenic
1165090996 19:33388375-33388397 CTGTGGGGCTGGCTGAGGGTTGG + Intronic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165335751 19:35168559-35168581 CTGAGGGGCTGGAGGAGGCAAGG + Intronic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165391809 19:35543324-35543346 CTGTGGTCTTGGGGAAGAGAAGG - Exonic
1165745572 19:38228386-38228408 GTGGGGGGTGGGGGGAGAGAGGG - Intronic
1165825448 19:38703116-38703138 GTCTGCGGCTGGGTGAGAGAAGG - Intronic
1166190697 19:41174789-41174811 GAATGGGGCAGGGGGAGAGAAGG - Intergenic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1167042071 19:47028285-47028307 CTGGGGGGCTGGGGGGTTGACGG - Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167105631 19:47428729-47428751 ATGATGAGCTGGGGGAGAGAAGG + Exonic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167175860 19:47863937-47863959 CTGGGGGCATGGGGGAGAGGTGG + Intergenic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167403169 19:49286525-49286547 ATGTGGGGATGGGAGAGAGAAGG - Intergenic
1167487708 19:49772862-49772884 CTGTGTGGCTGGTGCAGAGAGGG + Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1167671562 19:50856491-50856513 CCTTGGGACTGGGGGAGAGAGGG + Intronic
1167916240 19:52742293-52742315 GTGTTGGGCTGGGGGATATAAGG + Intergenic
1167950447 19:53022531-53022553 TTGTGGGGTGGGGGGAGGGAGGG + Intergenic
1168072079 19:53958984-53959006 CTGAGAGGATGGGGGAGAGAGGG - Intergenic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925194534 2:1912458-1912480 CTGATGGGCTAGGGGAGCGAGGG + Intronic
925401247 2:3575036-3575058 CCCTGGGCCTGGGAGAGAGAAGG - Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926321340 2:11750132-11750154 GTGTGTGGCTAGGGGACAGAGGG - Intronic
926927611 2:18003373-18003395 ATGGGGGGCTAGGGGAGAGATGG + Intronic
927334755 2:21908901-21908923 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
927471275 2:23379438-23379460 CTGTGGGGCGGGGGGGGGGGGGG + Intergenic
927475434 2:23410957-23410979 ATGAGGGGCTGGGGGAGGAAGGG - Intronic
927489193 2:23509431-23509453 CTGTGGATCTGGGAGAGTGAGGG + Intronic
927574983 2:24193568-24193590 TTGTGGGGTTGGGGGAGCGGGGG - Intronic
927906715 2:26863725-26863747 CTGGAGGGTTGGGGAAGAGATGG - Intronic
928488733 2:31758767-31758789 GTGGGGGCCTGGGGGAGAGGTGG + Intergenic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
928628730 2:33168777-33168799 CTGTGTAGCTGTGGGAGAGATGG - Intronic
928716827 2:34071013-34071035 TTGTGGGGCAGGGGAAGGGATGG + Intergenic
928768800 2:34679970-34679992 GTGGGGGGATTGGGGAGAGATGG - Intergenic
928902206 2:36331756-36331778 GTGTAGTGCTGGGGGTGAGAGGG - Intergenic
929052450 2:37849646-37849668 GTGTGGGGATGGGGGTGAGGTGG - Intergenic
929060062 2:37914561-37914583 CTGTGGGGCTTGTGAAGAGTTGG - Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929558256 2:42938785-42938807 TTGTGGGGCTGGGGATGACATGG - Intergenic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929667988 2:43848660-43848682 ATGTTGGGCAGGGGGAGAGGGGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930164838 2:48194808-48194830 CAGTGGGGATGGGGAAGAGCAGG - Intergenic
930981750 2:57534331-57534353 TTGAGGGGCTGGGGGAGTGAGGG - Intergenic
931251633 2:60536235-60536257 GTCTGAGGCTGGGGGAGAGAGGG - Intronic
931458007 2:62427053-62427075 CGATGGGGCTGGGGGAGACATGG + Intergenic
931515691 2:63049647-63049669 CTGTCGGGGTGGGGGAGTGGGGG + Intergenic
931528396 2:63185394-63185416 ATTTGGGGGTGGGGGAGAGGGGG - Intronic
931717036 2:65037447-65037469 TTGTGGTGATGGGGGAGGGATGG - Intergenic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932330370 2:70895252-70895274 CTGTGGGCCTAGGCCAGAGAAGG + Intergenic
932595019 2:73088267-73088289 CTCTGAGGCTGTGGCAGAGAAGG - Exonic
932645641 2:73498546-73498568 GTGAGGGGTTTGGGGAGAGATGG - Intronic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933708131 2:85306437-85306459 TTGTGCCACTGGGGGAGAGAGGG - Exonic
933709235 2:85313689-85313711 CTGAGGGGGTGAGGTAGAGACGG + Intergenic
933722832 2:85409303-85409325 CCATGGGGCTGGGGGAGGGGAGG + Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934187922 2:89763129-89763151 CTGCAGGTCTTGGGGAGAGATGG - Intergenic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
934747386 2:96768455-96768477 CCGTGGGGCTGAGGGAGGGCAGG + Intronic
934778091 2:96951466-96951488 CTGTTGGGCTGGCGGGGAGCTGG + Exonic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935422778 2:102887035-102887057 CTGAGGGGAGGGGGGAGGGAGGG - Intergenic
935549846 2:104441338-104441360 CCGTGCGGCCTGGGGAGAGAGGG + Intergenic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
935738215 2:106123579-106123601 CTGTAGGGCAGGTGGAGGGACGG + Intronic
936627480 2:114163848-114163870 CTGTGACTATGGGGGAGAGAAGG + Intergenic
936846414 2:116840401-116840423 ATGTGGGGCTTGGACAGAGATGG + Intergenic
936981463 2:118269105-118269127 CTGTGGGGTAGGGGAAGGGAAGG + Intergenic
937046541 2:118854937-118854959 TAGTGGGGCTGAGGGCGAGAGGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937707977 2:124943113-124943135 GTGTGGGGCTCAGGTAGAGATGG - Intergenic
938181633 2:129189886-129189908 GTGTGAGGCAGGGGGACAGAGGG + Intergenic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938583595 2:132669407-132669429 ATGTGGGGCTGCGGGAGCGTGGG - Intronic
938947594 2:136227202-136227224 CTGTGCAGCTGGGTGACAGATGG + Intergenic
940030976 2:149260869-149260891 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
940104015 2:150077399-150077421 GTGGGGGGCTGAGGGAGGGATGG - Intergenic
940813003 2:158266628-158266650 CTTTGGGGCTCAGGGAGAAAGGG - Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941024239 2:160440555-160440577 TGGTGAGGGTGGGGGAGAGATGG - Intronic
941042828 2:160642599-160642621 GTGGGGGGCAGGGGGAGGGATGG - Intergenic
941347467 2:164388208-164388230 GAGTGAGGCTGGTGGAGAGAAGG - Intergenic
941725799 2:168858781-168858803 CTGGAGGTGTGGGGGAGAGAGGG + Intronic
941946019 2:171097952-171097974 GGGTGGGGCGGGGAGAGAGAGGG + Intronic
942364959 2:175215757-175215779 TTGTGGGTTTGGGGGAGAGGCGG - Intergenic
942744664 2:179217984-179218006 TTGCGGGGCTGGGGGAGGGATGG + Intronic
942774099 2:179559928-179559950 CTGTCAGACTGTGGGAGAGAGGG - Intronic
943347654 2:186758934-186758956 GTGTGGGGTTGGGGGAGAGTAGG - Intronic
943361384 2:186923185-186923207 TTGTGGGGTGGGGGGAGAGGGGG + Intergenic
943584770 2:189725437-189725459 TTCTGGGGCAGGGGCAGAGAAGG + Intronic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
944222604 2:197317420-197317442 GGGTGGGGCTGGGAGGGAGAAGG + Intergenic
944223518 2:197325996-197326018 CTGGGGTGGTGAGGGAGAGATGG - Intergenic
944236435 2:197445426-197445448 TTGTGGTGCTTGGGGATAGAGGG + Intergenic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
944550157 2:200838316-200838338 CTGTGAACTTGGGGGAGAGAGGG + Intergenic
944921660 2:204420562-204420584 TTGTGGGGTTGGGGCAGGGAAGG - Intergenic
945627865 2:212234119-212234141 TTGAGGGGCTAGGGGAGGGATGG - Intronic
946180371 2:217945437-217945459 CCTTGGGGATAGGGGAGAGAAGG + Intronic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
947067110 2:226240149-226240171 CTGGGGAGCTGGGGGAGAATGGG - Intergenic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947400321 2:229725168-229725190 CTATGGGGCTGAGAGAAAGAAGG + Intergenic
947439874 2:230109809-230109831 CTATGGGGATGGGTGAGGGATGG + Intergenic
947731707 2:232434976-232434998 CTGTGGTGTTGGGGGAGATGAGG - Intergenic
947752648 2:232540826-232540848 CTGTGGGGCTAGGGAAGAACTGG + Intronic
947902290 2:233731422-233731444 GTGGGGGACTGGGGGAGGGATGG - Intronic
948055563 2:235007380-235007402 CTGGGGGGCTGGGAGAGGCAAGG - Intronic
948058338 2:235026097-235026119 CAGAGGGGATGGGGGAGGGATGG + Intronic
948065506 2:235075687-235075709 CTGAGGGCCTGAGAGAGAGAGGG + Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948313417 2:237007789-237007811 GTGTGTGGCTGGGGTGGAGAGGG + Intergenic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948900313 2:240953476-240953498 CTGTGGGTCCAGGGGAGGGAGGG - Intronic
1168797266 20:619916-619938 CTGCGGGGTTTGTGGAGAGAAGG + Intergenic
1168856293 20:1011605-1011627 CTGGTGGGCTGGGGGACAGCAGG + Intergenic
1169204125 20:3730596-3730618 ATGTGGGGGTGGGGGAAGGAGGG + Intergenic
1169258173 20:4114803-4114825 CTGTGGTGTTGGGGGTGGGAGGG - Intergenic
1169318709 20:4613475-4613497 GGGTGGGGCAGAGGGAGAGAAGG + Intergenic
1169664956 20:8023153-8023175 CTGTGGGGCAGGGAAAGAGAGGG - Intergenic
1171145181 20:22775044-22775066 ATGTGGGGCTGAGGGAGAAGGGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1172181854 20:33008416-33008438 CTGTGGGCCTGGGGCAGGGCTGG + Intronic
1172617319 20:36297942-36297964 AAGTGGGGATGGGGGAGAGGAGG - Intergenic
1172664160 20:36587532-36587554 CTGTGGGAGGGAGGGAGAGAAGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1172835771 20:37872161-37872183 CTGTGGGGAGGGGGCAGGGAGGG - Intergenic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1172877366 20:38173436-38173458 ATGTGGGGCTGCTGGAGACACGG + Intergenic
1173309863 20:41887833-41887855 CTGTCAGGGTGAGGGAGAGAAGG + Intergenic
1173528257 20:43749378-43749400 ATGGTGGGCTGGGGGAGAGGAGG - Intergenic
1173672110 20:44805991-44806013 CTGTTGGGCTGGGGGCGGGGTGG - Intronic
1173753161 20:45492526-45492548 GTCTGGGGGTGGGGTAGAGATGG + Intergenic
1173794163 20:45847332-45847354 CCAGGGGCCTGGGGGAGAGAGGG + Intronic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1174080992 20:47970675-47970697 CAGTGGGGCAGAGAGAGAGATGG - Intergenic
1174123840 20:48288191-48288213 CTGTGCTGCTGAGAGAGAGAGGG - Intergenic
1174274436 20:49393440-49393462 CTCTGAGGCTGGGTCAGAGATGG + Intronic
1174295608 20:49543174-49543196 CGGTGGGGATGGGGGAGCGTGGG - Intronic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1174402396 20:50283038-50283060 GTGAGGGGCTGAGGGAGAAAAGG - Intergenic
1174455015 20:50642706-50642728 ATGTGGGGCAGAGGGTGAGAGGG - Intronic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1174899050 20:54479374-54479396 TTGAGGGGCTGGGGGAAGGAGGG + Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175070836 20:56332477-56332499 CTGAGGGGCTGGGGTGGATAGGG + Intergenic
1175451837 20:59076024-59076046 CTTTGGGGAAGGGGGAGACAAGG - Intergenic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175910175 20:62401507-62401529 CTGTGGGGCCCGGGGCGAGCAGG - Intronic
1175966059 20:62660818-62660840 AAGTGGGGCTGGGGGAAGGAGGG - Intronic
1175987730 20:62772272-62772294 CAGTGGAGCTGGGGCAGGGATGG - Intergenic
1175998539 20:62821905-62821927 AGGTGGGGTTGGGGGAGAAAGGG - Intronic
1176111557 20:63413241-63413263 CGGTGTGGATGGGGGAGAGATGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176170012 20:63692478-63692500 CTGTGGGGCAGGGGGCTTGAGGG + Intronic
1176210019 20:63915058-63915080 CTGTGGGTCCCAGGGAGAGACGG + Intronic
1176285189 21:5015700-5015722 CTGTGGGGCTGGGTGAGCGGGGG + Intergenic
1176289820 21:5037971-5037993 CAGTGGGGAGGGGGGAGAGCGGG - Intronic
1176289841 21:5038023-5038045 CAGTGGGGAGGGGGGAGAGCGGG - Intronic
1177123946 21:17172544-17172566 TTGTGGGGAGGGGGGAGGGATGG - Intergenic
1178334346 21:31731200-31731222 TCGTGGGGCTGGCGGAGAGGTGG - Intronic
1178592819 21:33925752-33925774 CTGTGGGGTGGGGGGAGGGGGGG - Intergenic
1178694136 21:34778654-34778676 CAGTAGGGCTGGGGCAGAAATGG + Intergenic
1178711507 21:34921292-34921314 CTGTGGGGGAGGGGGAAACAGGG - Intronic
1179220396 21:39401943-39401965 CCCTGGGGAAGGGGGAGAGACGG - Intronic
1179372960 21:40824123-40824145 GTGGGAGGCTGGGGGACAGAGGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179867410 21:44225616-44225638 CAGTGGGGAGGGGGGAGAGCGGG + Intronic
1179871992 21:44247775-44247797 CTGTGGGGCTGGGTGAGCGGGGG - Intronic
1180081189 21:45488501-45488523 TCTTGGGGCTGGGGGAGACAGGG + Intronic
1180185438 21:46136933-46136955 CTCTGGGGATGGGCGAGGGAGGG + Intronic
1180216291 21:46325242-46325264 CTGGGGTGCTGGGGAAGAGCGGG + Intronic
1180535770 22:16391906-16391928 CTGCGGGTCTTAGGGAGAGATGG + Intergenic
1181034084 22:20161613-20161635 GTTGGGGGCTGGGGGAGGGAAGG + Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181419891 22:22790421-22790443 CTCTGGGTCTGAGGGAGAGTTGG + Intronic
1181532841 22:23526781-23526803 CTGTGAGGCTGGGGCAGGTATGG + Intergenic
1181725359 22:24807048-24807070 GAGTGGGGCGGGGGGAGTGAAGG - Intronic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181944938 22:26509198-26509220 CTTGGGGGCTGGAGCAGAGAGGG - Intronic
1182120331 22:27782246-27782268 GTGTGGGGCCGGGGAAGGGAGGG - Intronic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182162700 22:28139049-28139071 TTTTGGGGGTTGGGGAGAGATGG + Intronic
1182333716 22:29569288-29569310 CTGTGGGGGAGGTGCAGAGAGGG + Intronic
1182352018 22:29704502-29704524 GTGGGGAGCTGGGGCAGAGAAGG + Intergenic
1182434914 22:30324446-30324468 CTGTAGGGCTGGGGCTGAGGTGG - Intronic
1182541683 22:31046541-31046563 CTCTGGGGCCGGGGGAGGGGGGG - Intergenic
1182623875 22:31632091-31632113 CTGTAGGGCTTGCGGAGAAATGG + Intronic
1182713293 22:32335801-32335823 CAGAGGTGCTGGGGGAGAGGGGG - Intergenic
1182773142 22:32810425-32810447 TTGTGGGGGTGGGGAAGGGAAGG + Intronic
1182774851 22:32823472-32823494 CTTTGGGGCTGGGACACAGACGG - Intronic
1183077284 22:35435179-35435201 CTGGGAGGCAGGGAGAGAGATGG + Intergenic
1183140114 22:35929822-35929844 GTGGTTGGCTGGGGGAGAGAGGG + Intronic
1183241241 22:36659634-36659656 TTCTGGGGCCGGGGGAGGGAGGG + Intronic
1183254444 22:36753393-36753415 TTGTAGGGTTTGGGGAGAGACGG - Intergenic
1183345888 22:37307484-37307506 CTATGGGGGTGGGGAAGAGCAGG - Intronic
1183486285 22:38089224-38089246 CTCGGGGGCTGCGGGGGAGATGG + Exonic
1183544091 22:38446458-38446480 CTGGGGGCCTGGGTGAGGGAGGG + Intronic
1183664881 22:39241573-39241595 CCGTGGAGCTGTGGGAAAGAAGG + Intronic
1183665103 22:39242465-39242487 CCGGGGGGCTGCGGGAGAGGCGG + Intronic
1183745237 22:39688088-39688110 CTTTTGGGCTGAGGGAGAGGGGG + Exonic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184329688 22:43819452-43819474 CAGTGTGGCTGGGCCAGAGAGGG + Intergenic
1184414586 22:44344880-44344902 CTGTTGGCCTGGGGGAGGGAGGG - Intergenic
1184473460 22:44708514-44708536 CGGTGTTGCTGGGGGAGACACGG - Intronic
1184615169 22:45633038-45633060 CTGTGGGGGCGGGGGAGACAGGG + Intergenic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
1184681968 22:46077184-46077206 CTGTGGTGCTCGGGGAGCGTTGG + Intronic
1184769669 22:46589861-46589883 CTGAGGGGCTGAGGGAGGGGAGG - Intronic
1184826809 22:46958012-46958034 CTCGGGGGTTGGGGGAGTGATGG + Intronic
1184977139 22:48070290-48070312 GTCTGGGTCTGGGGGAGAGTAGG - Intergenic
1184978166 22:48077781-48077803 CAGGGGGGCTGGGGAAGAGAGGG + Intergenic
1184981283 22:48097429-48097451 CGTTGGTGCTGGGGGAGTGAAGG + Intergenic
1185346791 22:50313925-50313947 CTGTGGGGCTGCAGGAGTGTGGG - Intronic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
949523584 3:4880030-4880052 TGGGGGGGCGGGGGGAGAGATGG + Intronic
950076474 3:10190912-10190934 CACTGTGGCTGGGGAAGAGAGGG + Intronic
950090308 3:10290202-10290224 AGGTGGGCCTGGGGGAGAGAGGG + Exonic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950189882 3:10969382-10969404 CTCTGTGCCTGGGGGAGTGATGG + Intergenic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950405120 3:12799430-12799452 GTGTAGGGATGGGAGAGAGAAGG - Intronic
950408322 3:12818064-12818086 CTATGGGACTGTGGGATAGAAGG + Intronic
950627511 3:14259079-14259101 CTGCGGGGCTGGTGGAGGCAAGG - Intergenic
950659645 3:14459276-14459298 CTGTGTGGCTGGGGCAGCTAAGG - Intronic
951259971 3:20495872-20495894 GCCTGGGGTTGGGGGAGAGATGG + Intergenic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
952089125 3:29863214-29863236 TTGTGGGGTGGGGGGAGAGGGGG + Intronic
952963293 3:38606141-38606163 CTGAGGGTCTGGGGGAGCAAGGG + Exonic
953018884 3:39101264-39101286 CTGTAGACCTGGGGGAGATAGGG - Intronic
953186594 3:40643400-40643422 CTCTGAGGCTGGGGGAGAGATGG + Intergenic
953372445 3:42400771-42400793 ATGTGGGACGGGGGGAGAAAAGG + Intronic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953408148 3:42670349-42670371 CTCTGAGGGTGGGGCAGAGAGGG - Intergenic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
953854220 3:46488671-46488693 AGTGGGGGCTGGGGGAGAGAAGG - Intergenic
954217694 3:49133530-49133552 GAATGGGGCTGGGGGAGAGATGG + Intergenic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954331789 3:49895133-49895155 AGGTGGGGCTGGGGCAGAGATGG - Intronic
954413124 3:50379926-50379948 AAGTGGGGCTGGGGCAGGGACGG - Intronic
954611325 3:51945955-51945977 CAGTGGTGATGGGGGAGAGGTGG - Intronic
954631689 3:52051187-52051209 AGGTGGGGCTGGGGCACAGAGGG + Intronic
954685826 3:52369687-52369709 CTGTGGGGCAGGGGCAGTGCTGG - Intronic
954871963 3:53774226-53774248 CTGGGGGGCTGGGTCAGGGAAGG - Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955333246 3:58064838-58064860 GTGTGTGGCGGGGGGAGACAAGG - Intronic
955736090 3:62039832-62039854 CTCTGTGGCTGGGGGAAAAAAGG - Intronic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956172342 3:66442863-66442885 CTGTGGGGTTGGGGGAGCCGAGG - Intronic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
957008386 3:74976501-74976523 GTGGGGGGCGGGGGGAGGGATGG + Intergenic
957328161 3:78723649-78723671 GTGTGGGGTTGGGGGATTGAAGG + Intronic
957587045 3:82146122-82146144 CTGAGGGGCTGGGGTACAGCTGG - Intergenic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
958060697 3:88476247-88476269 CTGTGGGGGCGGGGGTGGGATGG - Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
959488674 3:106959341-106959363 TTGTGGGGTGGGGGGAGGGAGGG + Intergenic
959899897 3:111649055-111649077 CTGCGGGGATAGGGTAGAGATGG - Intronic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960038362 3:113124352-113124374 CTGCTGGGCTGGGAGAGGGAGGG + Intergenic
960096698 3:113696506-113696528 CTCCGGGGCTGGGGGAGCGCGGG + Exonic
960221749 3:115120011-115120033 GCCAGGGGCTGGGGGAGAGAGGG + Intronic
961113460 3:124305680-124305702 CTGTGGAGCTGTGGGGGAGTGGG + Intronic
961260143 3:125595514-125595536 CTGTGGGGCTGTGGGTGGGGCGG - Intergenic
961473444 3:127132687-127132709 CGGTGGGCCTGGGCCAGAGAGGG - Intergenic
961657719 3:128452572-128452594 TTGTGAGGCATGGGGAGAGAGGG + Intergenic
961774963 3:129278334-129278356 CTGAGGGGCTGGGGCAGGAAAGG + Intergenic
961808065 3:129503351-129503373 TTGTGGGGTGGGGGCAGAGAAGG - Intronic
961867749 3:129966395-129966417 CTGTGGGGCTGGCGTGGAGCTGG - Intergenic
961869534 3:129977473-129977495 CTGTGGTGGGGGGGGTGAGAGGG - Exonic
962375077 3:134852374-134852396 ATATGGGGCTGCAGGAGAGAAGG + Intronic
962457983 3:135582871-135582893 TTGTGAGGCTCGGGGAGAAAGGG - Intergenic
962689195 3:137876710-137876732 ATGGGTGGCTTGGGGAGAGATGG + Intergenic
963047013 3:141109996-141110018 CTGTTGGCCTGAGGGAGAAATGG + Intronic
963101090 3:141604760-141604782 GTGTGGGGAGGGGGGAGGGATGG + Intronic
963768856 3:149368066-149368088 CTGGGGGGCAAGGGGAGGGAGGG + Intergenic
964037888 3:152220830-152220852 GTGGGGGTTTGGGGGAGAGAGGG - Intergenic
964951363 3:162298345-162298367 CTATGGAGCTGGGGAAGAGAAGG + Intergenic
965727530 3:171734685-171734707 CTGTATGGCTTGGGGAAAGAAGG + Intronic
967097203 3:186186838-186186860 TTTTGGGGCTGGGGTAGAGGTGG + Intronic
967113629 3:186317638-186317660 CTGTAGGGCAGGGAGGGAGAAGG - Intronic
967351289 3:188516587-188516609 GTGTGGGGCAGGGGGAGTAAGGG - Intronic
967569879 3:191016149-191016171 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
968284977 3:197503200-197503222 CTGTGGGGCTGAGGGCGTGAGGG - Intergenic
968539152 4:1154251-1154273 CTGGGTGGGTGGGGGAGAGCTGG + Intergenic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
968701890 4:2061324-2061346 CAGCGGGGCTGGGGGAGGCACGG + Intronic
968726746 4:2251389-2251411 CTGTGGGGCTGGCAGAGACTGGG - Intronic
968898620 4:3419974-3419996 CTCTGGGGCCTGAGGAGAGAGGG - Intronic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969402146 4:6962707-6962729 GTGGGGGGCTGGGAGAGAGCAGG - Intronic
969483299 4:7458196-7458218 CTGTGGGGCGGGGGGAGGCGGGG + Intronic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
969737218 4:8999934-8999956 CTGTGGGGCTGGAGCATGGAGGG - Intergenic
969845450 4:9916872-9916894 CTGAGTGTCTGGGGGAGAAAAGG - Intronic
969931958 4:10639408-10639430 CTGCTGGGCTGGGTGAGAGGGGG + Intronic
969944004 4:10764276-10764298 GTGTGGGGCTTAGGTAGAGATGG + Intergenic
970005601 4:11407938-11407960 CTCTTGGCCTGGGGCAGAGATGG + Intronic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970226570 4:13864544-13864566 GTGTGGGGGTGGGGGATACATGG - Intergenic
970243606 4:14035204-14035226 CTGAGTGGCATGGGGAGAGAGGG - Intergenic
970537220 4:17041936-17041958 CTCTGGGCCTGGGGGAGCAAGGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972301661 4:37790869-37790891 TTCAGAGGCTGGGGGAGAGATGG - Intergenic
974271367 4:59655670-59655692 ATGTGGGGGTGGGGCCGAGATGG + Intergenic
974312240 4:60227592-60227614 CCCTGCGGCTGGGGGAGAGATGG + Intergenic
975162776 4:71143085-71143107 GTGGGGGGATGGGGGAGAGATGG - Intergenic
975288807 4:72651965-72651987 GTGAGGGGCTAGGGGAGGGATGG + Intergenic
975714786 4:77195235-77195257 CTGGGGTGCTGGGGCAGGGAAGG + Intronic
976400999 4:84607428-84607450 CTGAGGGGCGGGGGGAGTGGGGG - Intronic
976464247 4:85349558-85349580 CTTTGGGGCCTGGGGAGAAATGG - Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977823679 4:101504914-101504936 CTTTGGGTTTAGGGGAGAGATGG + Intronic
977889383 4:102290784-102290806 CTGTGGGGTTGGGGAAAAGTGGG - Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979518789 4:121642273-121642295 CTGTGGGACTTGGGGAGCAAAGG - Intergenic
979868510 4:125786359-125786381 ATGTGAGGTTGGGGGAAAGAAGG - Intergenic
980032495 4:127846328-127846350 CTGTGTGGCTGGGGTGGAGGAGG - Intergenic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
980482542 4:133405551-133405573 ATTTGGGGCTGGGGGAGGGGTGG - Intergenic
980850754 4:138378482-138378504 CTGTTGGGTGGGGGGACAGAAGG + Intergenic
981011977 4:139934534-139934556 CTGAGGGGGTGATGGAGAGAAGG - Intronic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981672291 4:147300718-147300740 CTTTTGAGATGGGGGAGAGATGG + Intergenic
981750459 4:148088718-148088740 GTGGGGGGCTAGGGGAGGGATGG + Intronic
982033532 4:151324762-151324784 CTCGGCGGCTGGGGGAGGGAGGG + Intronic
982132475 4:152243038-152243060 CTGTGCTGCTGGTGGAGATACGG - Intergenic
982206478 4:153000795-153000817 ATGAGGGGATGGGGGAGAGTGGG + Intergenic
982777385 4:159455753-159455775 CTGGGGGGCGGGGGGAGGGGGGG - Intergenic
982955708 4:161763528-161763550 CTATGGGTGTAGGGGAGAGAAGG + Intronic
983099344 4:163605910-163605932 TTGGGGGGCTAGGGGAGGGATGG + Intronic
983595112 4:169457646-169457668 GTGCGGGGCAGGGGGAGAGAAGG + Intronic
983618093 4:169730123-169730145 TGTTGGGGATGGGGGAGAGAAGG - Intronic
983904300 4:173168725-173168747 CGGTAGGGGTGGGGGAAAGAGGG + Intergenic
983971281 4:173877581-173877603 GTCTGGTGGTGGGGGAGAGAAGG - Intergenic
984920366 4:184758893-184758915 TTGTGGGGTGGGGGGAGGGAGGG - Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985485611 5:146603-146625 CTGCAGGGTTGGGGGAGAGGAGG - Intronic
985558662 5:570510-570532 CTGTGTGGATGGGGGAGCCATGG + Intergenic
985640794 5:1062681-1062703 CTGGGGGGCTGGGGGACTGAGGG + Intronic
986232214 5:5876708-5876730 CTGAGGGGTAGGGGCAGAGAGGG + Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
986321374 5:6634412-6634434 CTGTGGGGGCGGGGGGGAGGGGG + Intronic
986551653 5:8962758-8962780 CTGTGGGGTTTGGGGGGATAGGG - Intergenic
986572736 5:9181873-9181895 CTCTGCGGCTGGGAGTGAGATGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987170684 5:15254369-15254391 CTGTTGGGTTGAGGGATAGAAGG + Intergenic
987230514 5:15889086-15889108 AAGTGGGGCGGGGGGAAAGAAGG + Intronic
987301372 5:16600582-16600604 CTGTGGGGGCGGGGCAGGGAGGG - Intronic
987595155 5:19988369-19988391 GTGGGGGGTTGGGGGGGAGAAGG - Intronic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
987797090 5:22641590-22641612 CTGTGTGGCTTGGGCAGAGCAGG - Intronic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988081986 5:26426462-26426484 TTGTGGGGGTGGGGGGGAGGGGG + Intergenic
988197721 5:28027446-28027468 GCTTGGGGATGGGGGAGAGATGG - Intergenic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
989460746 5:41696055-41696077 CTGTGGGGCTGGGAGGGTGGTGG + Intergenic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
990742093 5:58922673-58922695 CGGTGGGGCTGGGGAGGAAATGG - Intergenic
991169493 5:63604364-63604386 CTGCTGGGCTGGGGGTGAGCTGG + Intergenic
991743655 5:69709535-69709557 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991795228 5:70289267-70289289 CTACGGGGGTGGGGGAAAGAGGG + Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991833370 5:70720820-70720842 CTACGGGGGTGGGGGAAAGAGGG - Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
992022370 5:72637158-72637180 TTGGGGGGCAGGGGAAGAGAAGG + Intergenic
992367274 5:76105560-76105582 CTCTAGGGCTGGGGGAGCAAAGG - Intronic
992421534 5:76611223-76611245 CTGGGTGGCAGAGGGAGAGAAGG + Intronic
992750477 5:79856608-79856630 GTGTGGGGCAGGGGCAGTGAAGG + Intergenic
993763104 5:91821401-91821423 GTGGGGGGCTAGGGGAGAGGTGG - Intergenic
994159725 5:96543376-96543398 CTGTGGGGCTTGGGGGGCAAGGG + Intronic
995387766 5:111607151-111607173 CTACTGGGCTGGGGAAGAGAAGG - Intergenic
995606439 5:113860541-113860563 TTCTGGGGTTGGGGGAGAGGAGG + Intergenic
995628989 5:114112332-114112354 GTGGGGGGCTGGGGAAGGGATGG + Intergenic
995784250 5:115811800-115811822 TTGGGGAGCTGTGGGAGAGAAGG + Intronic
995799510 5:115978809-115978831 CCATGGGGCTGGGGGTGACAGGG + Intronic
996379754 5:122850917-122850939 GTGTGAGGCTGGAAGAGAGAGGG + Intronic
996532865 5:124544490-124544512 CTGAGGGGCTGAGGGTGAGTAGG - Intergenic
996800636 5:127398813-127398835 CTTTGGGGCAGGGGCAGAGGAGG - Intronic
996837069 5:127805078-127805100 GTGTGGGACTGGGAGAGGGAGGG - Intergenic
996896251 5:128486759-128486781 GTGGGGGGATGGGGGAGGGATGG - Intronic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997284323 5:132667590-132667612 ATGTGGGGGTGAGGGAGAGCAGG - Intergenic
997321816 5:132983941-132983963 CCGTGGGGGGGGGGGGGAGAGGG + Intergenic
997389002 5:133498030-133498052 CTGAGGGGCAGCTGGAGAGAGGG + Intronic
997460841 5:134051224-134051246 CTGGAGGGCTGTGGGAGAGTTGG - Intergenic
997466778 5:134093532-134093554 CTGTTGGGCTTGGCCAGAGATGG - Intergenic
997566135 5:134887930-134887952 CTGTGGTGCTGGAGGAGCGGAGG + Exonic
997819950 5:137056259-137056281 ATGTGGGGGTGGGGGACAGGGGG + Intronic
997834887 5:137184363-137184385 GTGTGGGCCCAGGGGAGAGAAGG - Intronic
997865657 5:137460479-137460501 CTGTAGGGTTGGGGCAGAGGAGG - Intronic
997979334 5:138459273-138459295 CTGAGGGGGTGGGTGAGAGGGGG - Intergenic
998369868 5:141654030-141654052 CAGTGGGGCTGGGGGATTGGGGG + Exonic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999394332 5:151217400-151217422 ACTTGGGGCTGGGGGTGAGAGGG + Intronic
999435416 5:151559673-151559695 AAATGGGGTTGGGGGAGAGAGGG - Intronic
999460923 5:151757326-151757348 CCCTGGGGCTTGGGGAGTGAAGG - Intronic
999484918 5:151985637-151985659 GTGTGGGGCAGGGGGTGAGGGGG - Intergenic
999550383 5:152680158-152680180 CTGTGGTGCTGGGGAGGGGAGGG - Intergenic
999684126 5:154087246-154087268 CTCTGGGTTTGGGAGAGAGATGG - Intronic
999696651 5:154192995-154193017 CTTTTGGGCAGGGAGAGAGAGGG + Intronic
1000094313 5:157957784-157957806 GTGTGTGGCGGGGGGAGACAGGG + Intergenic
1000753573 5:165128438-165128460 CAGTGGGGCTGAGAGAGAGCAGG + Intergenic
1001440571 5:171739727-171739749 TTGTGGGGCTGGGGTGGAGTGGG - Intergenic
1001579819 5:172790952-172790974 CAGTGGGGGTGGGGGATGGAGGG - Intergenic
1001827944 5:174761352-174761374 GTGGGGGGCTGGGGGAGGAATGG - Intergenic
1001837590 5:174845052-174845074 CTGTGGGGTGGAGGCAGAGAAGG - Intergenic
1001928652 5:175657737-175657759 CTGCGGGGCGGGGAGAGGGAAGG + Intergenic
1002209973 5:177592692-177592714 CTGAGAGGCTGGCGGAGAGGAGG - Intronic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002436966 5:179237601-179237623 CTGGGAGGCTGGGGGAGATGAGG + Intronic
1002780283 6:359834-359856 CCATGGGGCTGGTGGAGAGGAGG - Intergenic
1002825576 6:770356-770378 CTTTGGGGCTTGGGGAGAAAGGG + Intergenic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003141273 6:3473410-3473432 CTGTGGGGCTGAGTGAAGGAAGG + Intergenic
1003501968 6:6710418-6710440 GGGTGGGGCAGGGGGAGAAAGGG + Intergenic
1003793379 6:9572779-9572801 GTGGGGGGATGGGGGAGGGATGG + Intergenic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1004843352 6:19612728-19612750 CTCTGGGGTTGGGGGAGGGGTGG - Intergenic
1005215946 6:23528074-23528096 GTGAGGGGCTGGGTGAGAGGTGG + Intergenic
1005273406 6:24190375-24190397 TTGTGGGGTTGGGGGAGAGGGGG + Intronic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1005826116 6:29632735-29632757 AAGCGGGGCTGGGGGAGAGGAGG - Intronic
1006167564 6:32073945-32073967 TTGTGGGGCTGGGACAGAGATGG + Intronic
1006313760 6:33278592-33278614 CGTTGGGCCTGGGAGAGAGAAGG - Exonic
1006439232 6:34042888-34042910 ATGTGGGGATGGGGGATAGCTGG + Intronic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006453737 6:34120357-34120379 CTGTGGGGGTGAGGGAGGCAAGG + Intronic
1006554190 6:34851896-34851918 CTGTGGGCCTGGGGCAGTGGTGG - Intronic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006915271 6:37589870-37589892 CTGTGGGGGGTGGGAAGAGAAGG - Intergenic
1007100377 6:39241977-39241999 CTGTGGGGCGGGAGCAGAGGCGG - Intergenic
1007363446 6:41374115-41374137 CCGTGTGGCTGGGGGAGGGGTGG + Intergenic
1007397739 6:41587177-41587199 CTGTGGGGTTGGGGCTGGGAGGG - Intronic
1007400221 6:41598992-41599014 CTGTGGAGTTGGGGGAGATGGGG - Exonic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007412888 6:41674973-41674995 TTGTGGGGTTGGGGGACAGGAGG + Intergenic
1007418025 6:41703377-41703399 CTTTGGGCCTGGGGCAGGGAGGG - Intronic
1007493245 6:42240754-42240776 CTGTGTGGTCGGGGGAGAGGAGG + Intronic
1007521245 6:42452884-42452906 CGGTGGGGCTGGGAGAGGGCTGG + Intergenic
1007661781 6:43491098-43491120 CCCTTGGGCTGGGTGAGAGAAGG + Intronic
1007723132 6:43897798-43897820 TTGTGGGGGCTGGGGAGAGAGGG + Intergenic
1007741252 6:44010897-44010919 CAGTGGGGCTGCTGGAGACAGGG - Intergenic
1007742555 6:44021752-44021774 TGGTGGTGCTGGGGGAGGGAAGG - Intergenic
1007743126 6:44024971-44024993 TGGTGGTGCTGGGGGAGGGAAGG - Intergenic
1007745930 6:44042902-44042924 CGCTGGGGCTGGGGGAGTGCAGG - Intergenic
1007769338 6:44180511-44180533 CTGTAGGGCTGGGGGTTGGAAGG + Intronic
1007835664 6:44671825-44671847 GTGGGGGGCTGAGGGAGAGGAGG - Intergenic
1007926744 6:45655872-45655894 CTTTGGGGTTTGGGGAGGGAGGG - Intronic
1008103028 6:47413184-47413206 CTGTGGGGATGGGAGAGAACGGG - Intergenic
1008206425 6:48664687-48664709 CTGTGGGGGTGGGGAAAAGCTGG + Intergenic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008727880 6:54442981-54443003 CTGTGGGGGTGGGGGAGCGGTGG + Intergenic
1009183054 6:60541361-60541383 GTGGGGTGCTAGGGGAGAGATGG + Intergenic
1010101870 6:72119797-72119819 TTGTGGGGTTGGGGGAGTGGGGG - Intronic
1010123482 6:72406716-72406738 CTGTTGGGCTGGGTCAGAGAGGG - Intergenic
1010376999 6:75182347-75182369 TGGGGGGGCTGGGGGAGGGATGG - Intronic
1010840462 6:80643752-80643774 GTGTGGGAGTGGGGGAGAGGGGG - Intergenic
1010890244 6:81298948-81298970 CTAAGGGGATGAGGGAGAGAAGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011666801 6:89642128-89642150 CTGGGGGGTTGGGGGAGGGGGGG + Intergenic
1011765192 6:90611962-90611984 CTGTGAGGCTGTGACAGAGAGGG - Intergenic
1012056645 6:94420623-94420645 GTGAGGGGCTGGGGGAGGGATGG + Intergenic
1012207299 6:96477604-96477626 CAGTGGGGTGGGGGAAGAGAGGG - Intergenic
1012447758 6:99323955-99323977 CTGTGGGGTTGTGTGAGAGAAGG - Intronic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013497206 6:110709360-110709382 GTGGAGGGCTGGGGGAGGGATGG + Intronic
1013536297 6:111066151-111066173 GGGTGGGGCTTGGGGAGAGCAGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013865067 6:114686570-114686592 ATGTGGGGCTGGGGAAGACAGGG + Intergenic
1013896348 6:115093165-115093187 GTTAGGGGGTGGGGGAGAGAGGG - Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014633091 6:123811421-123811443 GTGGGGGGGTGGGGGAGAGAGGG + Intronic
1014692328 6:124577385-124577407 CTGTGTGCTTGGGGGACAGAAGG + Intronic
1015035885 6:128653753-128653775 TTGTGGGGTTGGGGGAGGGGAGG - Intergenic
1015823667 6:137289788-137289810 CTGTGAGACTGGGAGAGAGAGGG + Intergenic
1016201968 6:141421389-141421411 TTGTGGGGTTGGGGGAGGGGGGG - Intergenic
1016779953 6:147946137-147946159 CTCAAGGGTTGGGGGAGAGAAGG - Intergenic
1016985995 6:149896326-149896348 CTCTGGGGCTGGGGGATAAGGGG + Intronic
1017151895 6:151288068-151288090 GTGGGGGGCTAGGGGAGGGATGG + Intronic
1017687683 6:156929449-156929471 ATGTGAGGGTGGGGGAGAGGTGG - Intronic
1018225554 6:161625417-161625439 ATGGGGGCCTGGGGGAGGGATGG + Intronic
1018269880 6:162065707-162065729 GTGGAGGGCTGGGGGAGGGATGG - Intronic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1018610334 6:165642175-165642197 ATGTGGGGCTGTGGGAGAGCAGG - Intronic
1018640049 6:165897415-165897437 ATTTGGGGGTGGGGGAGATAGGG + Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019164340 6:170088241-170088263 CTGTGGGGCTGGGAGTGAGCGGG + Intergenic
1019345123 7:526010-526032 CTGTGGGCACGGTGGAGAGACGG - Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019562367 7:1665263-1665285 TTGCGGGGCGGGGGGAGAGCGGG - Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019807201 7:3136714-3136736 GTGTGGGGATGAGGGAGGGAGGG - Intergenic
1020767514 7:12342819-12342841 GTGGGGGGATGGGGGAGGGATGG - Intronic
1021108346 7:16665577-16665599 CAGTGAGGCTGGGGGAAACAGGG - Intronic
1021264173 7:18498437-18498459 CTGTAGGGCTAGGGAACAGATGG + Intronic
1021432908 7:20581920-20581942 GTGAGGGGGTGGGGGAGGGAGGG + Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021636374 7:22698119-22698141 CTATTGGCCTGAGGGAGAGATGG - Intergenic
1022090006 7:27102020-27102042 CTGTGGGGGGAGGGGAGAGTGGG - Intronic
1022195142 7:28058104-28058126 GTGAGGGGCTGGGGAAGTGAAGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022221965 7:28322583-28322605 GTGGGGGGCTGGGGGAGGGAGGG - Intronic
1022230220 7:28406863-28406885 ATGTGGGGCTGGGGGAATTATGG + Intronic
1022444377 7:30457730-30457752 CTGTGGGGTTTGGTGGGAGACGG + Intronic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1023265847 7:38404414-38404436 CTGTGGGGCTGGGAGTGTGGAGG - Intronic
1023346028 7:39271987-39272009 GTGTGGGGGTGGGGGAGAGGGGG + Intronic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1024005204 7:45220129-45220151 TGGTGGGGCTGGGGAAGAGGGGG - Intergenic
1024096270 7:45985284-45985306 TTGTGTGGCTGAGGGAGACAGGG - Intergenic
1024144269 7:46496201-46496223 TTGTCGGGTTGGGAGAGAGAGGG + Intergenic
1024263654 7:47590231-47590253 GTGAGGGGCAGGGGGAGAGAAGG - Intergenic
1025022037 7:55487877-55487899 CTGTAGGCCTGGGGGAAGGAAGG - Intronic
1025284991 7:57653775-57653797 GTTTGGGGCTGCGTGAGAGAGGG + Intergenic
1026775794 7:73230281-73230303 CTGTAGGGGTGTGGGAGAAAGGG + Intergenic
1026853374 7:73738280-73738302 CTTTGGGGCTGGGCGGGAGTGGG - Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1026930330 7:74220086-74220108 CTCTGGGACTCGGGGAGGGAGGG - Intronic
1026930523 7:74220782-74220804 AGGTGGGGCAGGGGGAGAGGTGG - Intronic
1026930531 7:74220799-74220821 AGGTGGGGCAGGGGGAGAGGTGG - Intronic
1026936591 7:74260048-74260070 GAGTGGGGGTGGGAGAGAGATGG + Intergenic
1027016651 7:74783653-74783675 CTGTAGGGGTGTGGGAGAAAGGG + Intronic
1027071377 7:75162283-75162305 CTGTAGGGGTGTGGGAGAAAGGG - Intergenic
1027226727 7:76248304-76248326 GTGTGGGGATGAGGGAGAGGGGG + Intronic
1027232472 7:76280751-76280773 GGGTGGGGTGGGGGGAGAGAAGG - Intronic
1027430850 7:78111059-78111081 CTTTAGGTCTGGGGGAGAGATGG + Intronic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028002987 7:85524699-85524721 CTGTGGGGCTGGGGGAGTGGAGG + Intergenic
1028169646 7:87581034-87581056 CTGTAGGGATGGGGGAGGGGGGG + Intronic
1029277904 7:99418477-99418499 GTGTGGAGCTGGGGAAAAGAAGG - Exonic
1029502431 7:100940745-100940767 CTGGCGGGCTGGGGGAGGGATGG - Intergenic
1029587738 7:101486318-101486340 CTGTGGGGTTGGGGGGGACGTGG - Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030297517 7:107943829-107943851 CTGTGTGTCTGTGTGAGAGATGG + Intronic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1033322457 7:140352228-140352250 AGGTGGGGGTGGGGGAGAGGTGG + Intronic
1033361423 7:140640974-140640996 CTCTCGGGGTGGGGGAGAGGTGG + Intronic
1033551232 7:142450248-142450270 GTGAGGGACTCGGGGAGAGAGGG - Intergenic
1033682413 7:143607779-143607801 CAGTGGGGCCTGGGGAGGGAGGG - Intergenic
1033702476 7:143854134-143854156 CAGTGGGGCCTGGGGAGGGAGGG + Exonic
1033901647 7:146149035-146149057 GTGGGGGGATGGGGGAGGGAAGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034435481 7:151061024-151061046 CTGTGTGGTGGGGGCAGAGAAGG - Intronic
1034437400 7:151069738-151069760 CTGGGGGTCTGGGGGAGGGGAGG + Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034630580 7:152527432-152527454 TTTTGGGGCGTGGGGAGAGATGG - Intergenic
1034677562 7:152902787-152902809 CTGTGGGGGTCAGGGAGCGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034971642 7:155423283-155423305 CGGTGGGGGTGGTGGAGATAAGG - Intergenic
1035232826 7:157476611-157476633 ACGGTGGGCTGGGGGAGAGAGGG + Intergenic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035534244 8:378982-379004 CTGTAGGGCTGGGACAGGGAAGG - Intergenic
1035727223 8:1832056-1832078 CTGTGGGGCTGGAGGAGCAGCGG + Intronic
1035860812 8:3026191-3026213 CTGGTGGGGTGGGGGACAGAGGG + Intronic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036803081 8:11807511-11807533 CTGTGGGGTGAGGGGAGGGAAGG + Intronic
1036935932 8:13002928-13002950 CTGAGGAGCTGGGGAAGGGAGGG - Intronic
1037118423 8:15253933-15253955 GTGAAGGGATGGGGGAGAGAGGG - Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037605454 8:20434222-20434244 CAGAGGGGCGGGGGGAGAGAAGG - Intergenic
1037656535 8:20888575-20888597 CTGTGGGGCGGTGGGGGAGTGGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037711085 8:21355932-21355954 CTGGAGGGCAGGGGCAGAGAAGG - Intergenic
1037760343 8:21737752-21737774 CTGTGAGGCTGGGAGAGCCAGGG - Intronic
1037802918 8:22044808-22044830 CTTTGAGGCAGGGGGAGTGAGGG - Intronic
1037809779 8:22080603-22080625 CTGCAGGCCTGCGGGAGAGAAGG - Exonic
1037884681 8:22589750-22589772 CTGGGGGGCTGGGGAGGGGAAGG + Intronic
1037891537 8:22626467-22626489 ATTTGGGGCTGAGGGAGAGGTGG - Intronic
1037908287 8:22728162-22728184 CTGGGAGGATGGGGGAGAGGTGG + Intronic
1037966121 8:23135210-23135232 CTGTGGGCCAGAGGGAGAGCAGG + Intergenic
1038135988 8:24786319-24786341 CTGTGTGGGTGGGGGAGAAGAGG + Intergenic
1038150969 8:24942170-24942192 CGGTGGGGATGGGGAAGACAGGG - Intergenic
1038202028 8:25421767-25421789 ATGTGGGGCTGGGGGAGATTGGG + Intronic
1038206561 8:25472149-25472171 CTCTGGGGCAGGTGCAGAGAAGG - Intronic
1038399855 8:27275361-27275383 GTGGGGGGATGGGGGAGGGATGG - Intergenic
1038436356 8:27539529-27539551 ATGTGGGTGTGGGGGAGGGAAGG - Intronic
1038605777 8:29002293-29002315 GGGTGGGGCAGTGGGAGAGAGGG + Intronic
1038876623 8:31558152-31558174 CTGTCAGGCTGGGAGAGAGGAGG + Intergenic
1039439205 8:37583284-37583306 GTGTGGGTCGGGGGGAGAGATGG - Intergenic
1039750868 8:40477404-40477426 TGATGGGGCTGGGGGAGGGAAGG - Intergenic
1040399071 8:47029965-47029987 AGGTGGGGTGGGGGGAGAGAGGG + Intergenic
1040614300 8:49018975-49018997 AGATGGGGCTGGGGCAGAGATGG - Intergenic
1040928941 8:52714301-52714323 GTCTGGGGCCGGGGGACAGAAGG + Exonic
1040998759 8:53428569-53428591 CTATGGGGGTGGGCCAGAGATGG - Intergenic
1041079461 8:54202592-54202614 CTGAGGGGCTGGGGAGGAGTAGG + Intergenic
1041281085 8:56211551-56211573 CGGTGGGGCGGGGGAAGAGGGGG + Intergenic
1041790805 8:61694268-61694290 CAGTGAGGCTGGGGGAGAAGGGG - Intronic
1042518241 8:69682320-69682342 CTATGGGGCATGGTGAGAGAAGG + Exonic
1042634051 8:70853671-70853693 TTGTGGGGTGGGGGGAGTGAGGG - Intergenic
1043214981 8:77574355-77574377 CTGTGGGCCTGGGGTGGAGGTGG + Intergenic
1043428360 8:80171172-80171194 GTGTGGGGGAGAGGGAGAGAAGG - Intronic
1043567384 8:81562641-81562663 CTGTGGGCCTGGGGCAGTGGTGG + Intergenic
1045277912 8:100722899-100722921 TTGGGGGGCAGGGAGAGAGAGGG + Intergenic
1045304833 8:100950654-100950676 CCGTGGGGGGGGGGGAGAGATGG + Intronic
1045358541 8:101411310-101411332 CAGCAGGGCTGTGGGAGAGATGG + Intergenic
1045485923 8:102631144-102631166 CTGTGAGGATGGGGGAGGGGTGG + Intergenic
1045789044 8:105959287-105959309 TTGTGGGGCAGGGGGAGGGGGGG + Intergenic
1045922219 8:107544771-107544793 CTCTGGTGCCGTGGGAGAGAAGG + Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046768746 8:118098041-118098063 CCCTGGGGCTGGGGATGAGAAGG + Intronic
1047138309 8:122106825-122106847 CTGTGGGCCTGGGGCAGTGGTGG - Intergenic
1047413907 8:124648468-124648490 CTGAGGAGTTAGGGGAGAGAGGG - Intronic
1047436961 8:124842825-124842847 CTTTGGGGGTGGGGTTGAGAAGG + Intergenic
1048223856 8:132566433-132566455 CTGCGGGGTTGGGGGAGAATTGG + Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048867809 8:138773562-138773584 CTGTCGAGCTGGGGCAGAGGTGG - Intronic
1048969780 8:139639013-139639035 GTGTGGGCCTGGGGGAGGGTGGG - Intronic
1048972960 8:139655453-139655475 AGGTGGGGCTGGGGGAGGAAGGG + Intronic
1049133609 8:140872648-140872670 CTGTGGGGATTGGGAAGAGCTGG + Intronic
1049175983 8:141193011-141193033 ATGAGCGGGTGGGGGAGAGAAGG - Intronic
1049199785 8:141334434-141334456 CAGTGGGGCTGGGACAGAGAGGG - Intergenic
1049201040 8:141340804-141340826 CAATGGGAGTGGGGGAGAGATGG + Intergenic
1049254965 8:141608854-141608876 CTGCGGGGGTCGGGGAGTGATGG + Intergenic
1049342813 8:142122569-142122591 CTGTGGGTCTGGGGCAGGCAAGG - Intergenic
1049361330 8:142213743-142213765 CTGTGGGCCTGGGCCAGTGAGGG + Intronic
1049407270 8:142457375-142457397 CTGTGGGGCTGAGGCAGAAGGGG - Intronic
1049432467 8:142571676-142571698 CTGTGGGCCTGTGGGGGAGCGGG - Intergenic
1049435123 8:142583035-142583057 GTGTGAGGCTGGGGGACAGAAGG + Intergenic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049564432 8:143330928-143330950 CAGTGGTGCGGGGGGAGGGAGGG + Intronic
1049674075 8:143882122-143882144 GTGTTGGGGTGGGGCAGAGAGGG - Intergenic
1049732295 8:144184912-144184934 CTATGGGGCTGGGGCAGAGCAGG + Intronic
1049859758 8:144890396-144890418 CTATGGGGCTGAGGAAGAGGAGG + Exonic
1050124358 9:2341244-2341266 ATGTTGGGCTGAGAGAGAGACGG + Intergenic
1050544898 9:6701427-6701449 CTGGGAGGCTGGGGCAGGGAGGG + Intergenic
1050670638 9:7992761-7992783 CAGTGGGGATGGGGTAGTGAAGG + Intergenic
1050781205 9:9338829-9338851 GTGAGGGGGTAGGGGAGAGATGG - Intronic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1051237683 9:15019047-15019069 TGTTGGGGATGGGGGAGAGAAGG + Intergenic
1051561589 9:18447459-18447481 CTGTGGGGAAGAGGGAGGGAGGG + Intergenic
1051604590 9:18907370-18907392 CTGTGGGGTTGGGAGGGAGGGGG - Intronic
1051780580 9:20684400-20684422 CTGCGGGGCTGGGGCTGAGCTGG + Intronic
1052358324 9:27528631-27528653 TGGCGGGGCTTGGGGAGAGAAGG - Intronic
1052835020 9:33244042-33244064 TCCTGGGGCTGAGGGAGAGATGG - Intronic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1053311837 9:37025413-37025435 CTGTTGGGATGGGGGGGAGCGGG + Intronic
1053313239 9:37032631-37032653 ATTTGAGGCTGGAGGAGAGATGG + Intronic
1053443810 9:38136366-38136388 CCCAGGGGCAGGGGGAGAGAGGG - Intergenic
1053465201 9:38301918-38301940 CTGGGGGCCTGCGGGAGCGAAGG + Intergenic
1053467714 9:38322623-38322645 GTGGGGGGCTAGGGGAGGGAGGG - Intergenic
1053494916 9:38542918-38542940 CTGTGGGGCTGGAGGATCCAAGG - Exonic
1053564628 9:39235981-39236003 GTGGGGGGCTGGGGAGGAGATGG + Intronic
1053575822 9:39357016-39357038 CGGCTGGGCTGGGGCAGAGAGGG + Intronic
1054097390 9:60915707-60915729 CGGCTGGGCTGGGGCAGAGAGGG + Intergenic
1054118796 9:61191337-61191359 CGGCTGGGCTGGGGCAGAGAGGG + Intronic
1054132524 9:61383053-61383075 GTGGGGGGCTGGGGAGGAGATGG - Intergenic
1054588959 9:66991225-66991247 CGGCTGGGCTGGGGCAGAGAGGG - Intergenic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1055044611 9:71911231-71911253 CTAGCGGGCGGGGGGAGAGACGG + Intergenic
1055424525 9:76180594-76180616 GGGTGGGGCTGTGGGAGACAAGG - Intronic
1055776116 9:79768718-79768740 ATTTGGGGAAGGGGGAGAGAGGG + Intergenic
1056331375 9:85523742-85523764 TTGTGGGGCTGGGGTAGGGGTGG - Intergenic
1056631352 9:88295649-88295671 CTGTGGATCTGGGGAAGAGGGGG - Intergenic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057055407 9:91956727-91956749 CTATGGGGCTGGGGGAGCTCTGG - Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1058533081 9:105926131-105926153 CTGTGGGAATAGGGGAGCGAAGG + Intergenic
1059454290 9:114389930-114389952 ATGTGGGGCTGGGGGCTACAGGG - Intronic
1059827219 9:118044636-118044658 TTGTGGAGCAGGGGGAGAAATGG - Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060045289 9:120335601-120335623 ATGTGGGGCTGGGGGATATATGG + Intergenic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060749636 9:126160616-126160638 ATGTGGGCCTGGGGGACCGAGGG - Intergenic
1060774132 9:126357030-126357052 AAGTGGGGTTGGGGGAGTGATGG - Intronic
1061306573 9:129736131-129736153 GAGTGGGGATGGGGGAGGGATGG - Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061397174 9:130349522-130349544 AGGAGGGGCTGGGGGTGAGAAGG - Intronic
1061446355 9:130640416-130640438 AAGTGGGGCTGGGAGAGAGTGGG - Intergenic
1061671033 9:132188269-132188291 CTGAGGGGCTGAGGATGAGAAGG + Intronic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1061856699 9:133445454-133445476 CTGTGGGCCTGGCCGAGAGCTGG - Intronic
1061947430 9:133916536-133916558 ATGTGGGGCTGGGTGAGTGGGGG + Intronic
1062086922 9:134653808-134653830 CTGTAGGGCTGGGGGTGTGCAGG + Intronic
1062132705 9:134908568-134908590 CCATGGGGCTTGGGGGGAGAGGG + Intronic
1062335903 9:136067310-136067332 CAGTGGGGGTGGGGGAGGGATGG + Intronic
1062379615 9:136280906-136280928 ATGTCTGGCTGGGGGAGAGATGG - Intergenic
1062434994 9:136543115-136543137 GGCTGGGGCTGGGGAAGAGAAGG - Intronic
1062448289 9:136604874-136604896 GGGTGGGGCTGGGGGAGGGCAGG - Intergenic
1062464267 9:136674239-136674261 GCGAGGGGCTGTGGGAGAGATGG + Intronic
1062574455 9:137199921-137199943 CTGGGGGGCGGGTGGAGGGAGGG + Exonic
1062619255 9:137412039-137412061 CTGTGGGGGTGGGGGAGCCTGGG - Intronic
1185791069 X:2928671-2928693 CTGGGGGGTTGGGGGCGGGACGG + Intronic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1185871538 X:3668811-3668833 CTCAGGGGCTGGGGCAGAAAAGG + Intronic
1186613213 X:11159132-11159154 CTGTGAGGCTGGAAGAGAGTAGG + Intronic
1186800751 X:13090253-13090275 GTGTGGATCTGGGGGATAGAAGG - Intergenic
1187088503 X:16067728-16067750 GTGGGGGCCTGGGGGAGGGATGG + Intergenic
1187228137 X:17394010-17394032 CTGTGGGGCTGAGGGTGCGGTGG - Intronic
1187283844 X:17883837-17883859 GTGCGAGGCAGGGGGAGAGATGG + Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187770396 X:22689529-22689551 CTGAAGGGGTGGGGGAGGGAGGG - Intergenic
1188078648 X:25808629-25808651 CCATGGGGCTGGGGGAGGGGTGG + Intergenic
1189295616 X:39915417-39915439 CCTTATGGCTGGGGGAGAGATGG + Intergenic
1190065525 X:47239328-47239350 CTGTGGGGCGGGGGTGGAGGTGG - Intronic
1190340620 X:49292639-49292661 CTGGTGGTCTGGGGGAGACACGG + Intronic
1190441101 X:50475063-50475085 CTGGGGGGCTGGGGGTGGGTGGG + Intergenic
1190512268 X:51185412-51185434 CTCTGAGGCTGTGGCAGAGAGGG - Intergenic
1190627071 X:52346466-52346488 CTGGTGGTCTGGGGGAGATACGG + Intergenic
1191116697 X:56860334-56860356 CTGTAGGCCTGGGGCAGTGATGG - Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1191908544 X:66122400-66122422 CTCTGGGGGTGGGGGTGAGGGGG + Intergenic
1192153436 X:68726053-68726075 GTGGGGGGGTGGGGCAGAGAAGG + Intergenic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1193096698 X:77556406-77556428 AGGTGGGGGTGGGGGAGAGAGGG + Intronic
1193297813 X:79852943-79852965 CTGGCAGGCTGGGGGAGAGAAGG - Intergenic
1193336894 X:80300488-80300510 ATGTGGGGCTGGGGCAGATGTGG - Intergenic
1193344344 X:80388005-80388027 CTGTGGGCCTGGGGAAGTGGTGG - Intronic
1194038455 X:88910379-88910401 TTGTGGGGTTGGGGGAGGGAGGG + Intergenic
1194921516 X:99772109-99772131 GTGGGGGCCTGGGGGAGAGAGGG - Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195168558 X:102244580-102244602 CTTGGGGGGTGGGGGAGATAAGG - Intergenic
1195190299 X:102442507-102442529 CTTGGGGGGTGGGGGAGATAAGG + Intronic
1195643744 X:107206114-107206136 CAGTGGGCCGGGGGTAGAGAAGG - Intronic
1195716684 X:107825578-107825600 TTGTGGGGTTGGGGGACAGGGGG + Intergenic
1195756135 X:108200602-108200624 GTGTGGGGTGGGGGGAGAGATGG + Intronic
1195803677 X:108737989-108738011 CTGGGGTGGTGGGGGAGAGAGGG - Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1195988889 X:110662892-110662914 GTGGGGGGCTGGGGGAGGGATGG + Intergenic
1196093756 X:111776210-111776232 CTGGGGGGCAGGGGCAGTGAGGG + Exonic
1196107264 X:111910389-111910411 CAGCAGGGCTGTGGGAGAGAGGG + Intronic
1196231738 X:113232158-113232180 CTAGGGGGCTGGGGGAGAAGTGG - Intergenic
1196233768 X:113255527-113255549 CTGTGGGCCTGGGGAAGTAATGG - Intergenic
1196756146 X:119159163-119159185 GTGAGGAGCTGGGGGAGAGGTGG - Intergenic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1197204852 X:123781027-123781049 TTATGGGGCTGGGGGACAAAAGG + Intergenic
1197487853 X:127075476-127075498 CTGTGTGCTTGGGGGAGGGAGGG - Intergenic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1198397672 X:136237862-136237884 GTGTGGGGAGGGGGGAGGGATGG - Intronic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198708009 X:139470262-139470284 GTGTGTGGGTGGGCGAGAGAGGG - Intergenic
1199029154 X:142975772-142975794 GTGGGGGGCTAGGGGAGGGATGG + Intergenic
1199243638 X:145576905-145576927 CTATGTGGCTAGAGGAGAGAAGG + Intergenic
1199272224 X:145898065-145898087 CTGTGGGGCTGGGAGTGTGGAGG + Intergenic
1199828797 X:151528253-151528275 CAGTGTGTCTGGGGCAGAGAGGG + Intergenic
1199852555 X:151736119-151736141 CTGAGGGGCTGGGTGAGTGAAGG - Intergenic
1199941606 X:152633078-152633100 CTGCAGGCTTGGGGGAGAGAGGG + Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200098049 X:153673395-153673417 ATGTGTGGATGGGGGAGGGACGG - Intronic
1200110211 X:153737120-153737142 CAGCGGGGCTGGGGTGGAGAGGG - Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200319439 X:155171296-155171318 CTGTGAGGCCTGGGGAGAAAAGG - Intergenic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic
1200841711 Y:7788225-7788247 TGCTAGGGCTGGGGGAGAGAGGG - Intergenic
1201277645 Y:12313729-12313751 CTCTGGGGTTGGGGGAGACTGGG - Intergenic
1202024597 Y:20507309-20507331 CTCTGAGGCTGTGGCAGAGAGGG + Intergenic