ID: 1083267868

View in Genome Browser
Species Human (GRCh38)
Location 11:61555287-61555309
Sequence GGGGGGCGACGGTGGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083267868_1083267890 22 Left 1083267868 11:61555287-61555309 CCCCGGGCCCACCGTCGCCCCCC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 1083267890 11:61555332-61555354 TCCCACCACACTTCTGGGCCGGG 0: 1
1: 0
2: 3
3: 36
4: 204
1083267868_1083267887 16 Left 1083267868 11:61555287-61555309 CCCCGGGCCCACCGTCGCCCCCC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 1083267887 11:61555326-61555348 CCAAAGTCCCACCACACTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 148
1083267868_1083267893 25 Left 1083267868 11:61555287-61555309 CCCCGGGCCCACCGTCGCCCCCC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 1083267893 11:61555335-61555357 CACCACACTTCTGGGCCGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 167
1083267868_1083267888 17 Left 1083267868 11:61555287-61555309 CCCCGGGCCCACCGTCGCCCCCC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 1083267888 11:61555327-61555349 CAAAGTCCCACCACACTTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 126
1083267868_1083267889 21 Left 1083267868 11:61555287-61555309 CCCCGGGCCCACCGTCGCCCCCC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 1083267889 11:61555331-61555353 GTCCCACCACACTTCTGGGCCGG 0: 1
1: 0
2: 2
3: 10
4: 125
1083267868_1083267895 29 Left 1083267868 11:61555287-61555309 CCCCGGGCCCACCGTCGCCCCCC 0: 1
1: 0
2: 2
3: 31
4: 314
Right 1083267895 11:61555339-61555361 ACACTTCTGGGCCGGGCGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083267868 Original CRISPR GGGGGGCGACGGTGGGCCCG GGG (reversed) Intronic
900123476 1:1059375-1059397 GGGGGGCGGGGCGGGGCCCGCGG - Intergenic
900139837 1:1135058-1135080 GGGAGGGGACGGTGACCCCGGGG - Intergenic
900244228 1:1630202-1630224 GGGGGGCGAGGCTGGGGGCGGGG - Intronic
900245323 1:1633695-1633717 GGGCGGCGGGGCTGGGCCCGGGG + Intronic
900256554 1:1700854-1700876 GGGCGGCGGGGCTGGGCCCGGGG + Intronic
900265719 1:1756081-1756103 GGGGTGCGACGGTGGGGCCAGGG - Intronic
900417284 1:2540929-2540951 GGGCGGCGGCGGGGGGCGCGGGG - Intergenic
901016609 1:6235617-6235639 GGGAGGCCACTGCGGGCCCGGGG + Intronic
902391757 1:16111091-16111113 GGGGGGCCAGGGTTGGCCCCTGG - Intergenic
902856543 1:19210286-19210308 GGGAGGCGGCGCTGGGCCGGTGG - Intergenic
903413841 1:23168316-23168338 GGGGGGCGACGAGGCGGCCGTGG - Intronic
903603101 1:24556266-24556288 GCTGGGCGAAGGAGGGCCCGGGG + Intronic
905449617 1:38047779-38047801 GGGGGTGGACGTTGGGCCCAGGG + Intergenic
905796452 1:40819015-40819037 GCGGGGCTAGGGTGGGCCCCAGG + Intronic
906150132 1:43582801-43582823 GGAGGCCGAGGGTGGGGCCGGGG - Intronic
906805571 1:48776569-48776591 GGGGAGGGACGGTGGGACCCGGG - Intronic
908571894 1:65419995-65420017 GGGGAGAGACTCTGGGCCCGCGG + Intergenic
908622257 1:65997141-65997163 GGGGGGCGGGGGTGGGTCAGGGG - Intronic
908780544 1:67685960-67685982 GGGGGGCGGCGATGGCCCCGAGG + Intronic
910806114 1:91191222-91191244 ATGGGGCGAGGGTGGGCCTGGGG - Intergenic
913586291 1:120278393-120278415 GGGGGGAGAGGGTGGGGCTGGGG + Intergenic
913621895 1:120619976-120619998 GGGGGGAGAGGGTGGGGCTGGGG - Intergenic
914568300 1:148890251-148890273 GGGGGGAGAGGGTGGGGCTGGGG + Intronic
914604525 1:149239998-149240020 GGGGGGAGAGGGTGGGGCTGGGG - Intergenic
914901069 1:151711433-151711455 GGGGGGCGGGGGTGGGGCCCTGG - Intronic
915266269 1:154720180-154720202 AAGGGGCGAGGGTGGGCCCCCGG - Intronic
917418293 1:174834599-174834621 GGGGGGCGGCGGGGGGGGCGGGG - Intronic
1062901124 10:1147733-1147755 GGGGTGGGACGCTGGGCCTGTGG + Intergenic
1064167798 10:13001594-13001616 GGGCGGCGGCGGGGAGCCCGGGG + Exonic
1065483804 10:26217688-26217710 GGGCGGCCAAGGTCGGCCCGCGG + Intronic
1066126576 10:32347607-32347629 TGGGGGCGGCCGTGGCCCCGGGG - Intronic
1066464223 10:35639494-35639516 GGGGGGTGGCGGCGGGCCGGGGG - Exonic
1069651598 10:70053427-70053449 GGGGGGCTGCGCAGGGCCCGAGG + Intronic
1070112061 10:73495880-73495902 GGGCGGCCATGCTGGGCCCGGGG + Exonic
1070140289 10:73733299-73733321 GTCGGGCGACGGCGTGCCCGGGG - Intergenic
1076613750 10:131743112-131743134 GGAGGGCAAGGGTGGGGCCGTGG - Intergenic
1076673518 10:132136095-132136117 CGGGTGCGACCGTGGCCCCGTGG - Intronic
1076949161 10:133668903-133668925 GGCGGGCGACGGTGGCGCGGGGG - Intronic
1076950145 10:133672202-133672224 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076953108 10:133682121-133682143 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076954092 10:133685420-133685442 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076955076 10:133741772-133741794 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076957055 10:133748392-133748414 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076959027 10:133755000-133755022 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076960016 10:133758310-133758332 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076961000 10:133761609-133761631 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1077173487 11:1178650-1178672 AGGCGGCGAAGGTGGGGCCGTGG - Intronic
1077186369 11:1237131-1237153 AGGCGGCGAAGGTGGGGCCGTGG - Exonic
1077194370 11:1272056-1272078 GCGGGGCGCCGGAGGGGCCGCGG + Intergenic
1077478911 11:2803796-2803818 GGTGGGAGCTGGTGGGCCCGAGG - Intronic
1083267868 11:61555287-61555309 GGGGGGCGACGGTGGGCCCGGGG - Intronic
1083418294 11:62539432-62539454 GGGGCGGGAGGGTGGGGCCGAGG - Intronic
1083428734 11:62602715-62602737 GGGTGGGACCGGTGGGCCCGAGG - Intronic
1083595622 11:63917251-63917273 GGGGTGGGAGGGAGGGCCCGGGG + Intergenic
1085255279 11:75169218-75169240 GGGGGCCGAGGCTGGGGCCGAGG - Exonic
1089291942 11:117442949-117442971 GAGGGCCTACGGTGGGCCAGGGG - Intronic
1091236315 11:134024682-134024704 GGGGGGCGAGGGTCGGCCCGAGG - Intergenic
1094848010 12:34369876-34369898 GGTTGGCGCCTGTGGGCCCGAGG + Intergenic
1094850663 12:34380937-34380959 GGCTGGCCACCGTGGGCCCGAGG + Intergenic
1096159858 12:49367400-49367422 GGGAGGCGGCGGTGGGGGCGGGG + Intronic
1096461097 12:51821727-51821749 GGGGGCCGGGGGTGGGCCTGGGG + Intergenic
1101593069 12:106139748-106139770 GCGGTTCGACGGCGGGCCCGGGG - Exonic
1102962007 12:117099190-117099212 GGGGGGCGGCGCGGGGACCGGGG - Intronic
1103786393 12:123436342-123436364 GAGGGACGAGGTTGGGCCCGAGG - Exonic
1104845339 12:131844087-131844109 GGGTGGTGACCGTGGGCCCAGGG - Intronic
1104923391 12:132302969-132302991 GGGGGGCGAGGGTGGAACCCAGG + Intronic
1105964520 13:25372307-25372329 GGCGAGGGAGGGTGGGCCCGGGG + Intronic
1106099594 13:26682813-26682835 CGGGGGAGGTGGTGGGCCCGGGG - Exonic
1107468077 13:40666777-40666799 GGGAGGCGGCGGTGGGCTGGTGG + Intergenic
1112290972 13:98143605-98143627 TGCGGGCGAAGGTGGGCGCGTGG + Intronic
1112351076 13:98633744-98633766 GGGAGGCCAAGGTGGGCACGTGG - Intergenic
1113201067 13:107867600-107867622 GGCGGGCGGCGGCGGGGCCGCGG + Intergenic
1113742682 13:112722287-112722309 CGGGGAGGAGGGTGGGCCCGGGG + Intronic
1115851189 14:37591787-37591809 GGGGGCTGGCGGCGGGCCCGGGG + Exonic
1118992426 14:70809034-70809056 CGGCGGCGGCGGTGGGCCCCGGG - Exonic
1120167856 14:81220254-81220276 CGGGGGCGCCGGTGGGGCCTGGG - Intronic
1122156444 14:99753191-99753213 GGGGGGCGGCGGGGGGGCGGGGG - Intronic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122162418 14:99793748-99793770 GGGTGGCGGCGGGGAGCCCGGGG - Intronic
1122262644 14:100531926-100531948 GTGGGGCATCGGTGGGGCCGGGG - Intergenic
1122311075 14:100794750-100794772 GGGGGGCGGCGGGGGGCGGGGGG + Intergenic
1122666550 14:103334185-103334207 GGGGGCGGACGCTGGGGCCGAGG + Exonic
1122687788 14:103518261-103518283 GGGCGGGGACGAAGGGCCCGAGG - Intergenic
1122719611 14:103715103-103715125 GGGAGGCCGAGGTGGGCCCGCGG - Intronic
1122779710 14:104138528-104138550 GGGAGGCGAGGGCGGGGCCGGGG - Intergenic
1122917270 14:104865042-104865064 GGTGGGGGAAGGTGGGCCTGGGG + Intergenic
1202901908 14_GL000194v1_random:49213-49235 AGGGGGAGACTGTGGGCCTGTGG + Intergenic
1123898057 15:24848219-24848241 CGGGGGCGGCGGTGGGGGCGGGG + Intronic
1124227014 15:27903315-27903337 GGAGGGCAGCTGTGGGCCCGCGG - Intronic
1124500342 15:30223005-30223027 CGGGGGCGGCGGGCGGCCCGGGG + Intergenic
1124743231 15:32315661-32315683 CGGGGGCGGCGGGCGGCCCGGGG - Intergenic
1125684982 15:41558851-41558873 GCGGGGCGCCGGCGGGGCCGCGG + Intronic
1128078302 15:64841806-64841828 GGGAGGGGGCGGTGGGGCCGGGG - Intergenic
1128370050 15:67033842-67033864 GGCGGGGGACGGTGGGCGCGTGG - Intergenic
1129339052 15:74873139-74873161 GGGCGGCGGCCGTGGGCCCTAGG + Intronic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130952752 15:88605330-88605352 GAGGGGCGACGGCGGGCTTGGGG - Intergenic
1131270854 15:90946912-90946934 GTGGTGAGACGGTGGGCCTGGGG + Exonic
1131828749 15:96341151-96341173 GGGGGGCGAGGGCGGGGGCGGGG + Intergenic
1132460872 16:53917-53939 GGAGGCCGCGGGTGGGCCCGAGG + Exonic
1132498590 16:275090-275112 GGGGTGGGACGGTGAGCGCGGGG + Intronic
1132498842 16:275885-275907 GGGGGGCGGCGCGGGGCCGGCGG + Exonic
1132552776 16:560249-560271 AGGGGGCGGCGGGGGGCGCGCGG + Intergenic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1133442972 16:5836198-5836220 GGGGGGTGAGGCTGGGCCCAGGG + Intergenic
1134143578 16:11742646-11742668 AGGGGGCGGCGGCGGCCCCGCGG - Exonic
1134387318 16:13785815-13785837 GGGAGGCGAGGGTGTGCACGTGG + Intergenic
1134539929 16:15056027-15056049 CGGGGGCGGCGGGCGGCCCGGGG - Exonic
1138548781 16:57735881-57735903 GCGAGGGGACGGTGGGCCCTGGG + Intronic
1139446311 16:67000802-67000824 GGTGGGCGGCGGTGGGACCGCGG - Intronic
1141503992 16:84462809-84462831 GCGGGGAGGCGGTGGGCCCATGG - Intronic
1142221414 16:88856785-88856807 GGGGGGCTGCGGGGCGCCCGAGG + Exonic
1142744767 17:1950303-1950325 GGGAGGCGACGGGGGTCACGGGG + Intronic
1143719450 17:8799353-8799375 CGGGGGCGAAGGTGGGGGCGGGG + Intergenic
1144500855 17:15786250-15786272 GGGGGGCGGGGGGCGGCCCGGGG - Intergenic
1145163016 17:20588912-20588934 GGGGGGCGGGGGGCGGCCCGGGG - Intergenic
1147183962 17:38703964-38703986 GGGGGGCCGCGGCGGGCCCCAGG + Intergenic
1148061286 17:44838348-44838370 GGGGGGCAGCGGTGGGGCAGGGG - Intergenic
1151156036 17:72123549-72123571 GGGTGGGGTCGGTGGGCCCTGGG - Exonic
1151608142 17:75153585-75153607 GGGGGGCGGGGGCGGGCGCGGGG - Intronic
1151675310 17:75594578-75594600 GGAGGGTCACGGTGAGCCCGAGG + Intergenic
1152087987 17:78231957-78231979 CGGGGGCGGCGGGGGGCGCGCGG - Exonic
1152208869 17:78992274-78992296 GGGGTGCCACGGTGGGCCGGAGG - Exonic
1152636517 17:81432677-81432699 TGCGGGGGAGGGTGGGCCCGGGG - Intronic
1152636564 17:81432773-81432795 GTGGGGGGAGGGTGGGCCTGGGG - Intronic
1152636589 17:81432822-81432844 GGGGGGGGAGGGTGGGCCTGGGG - Intronic
1152636617 17:81432871-81432893 GGGGGGGGAGGTTGGGCCTGGGG - Intronic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1152760674 17:82105637-82105659 GGGGGGTCACCGTGGCCCCGGGG + Intronic
1152794181 17:82298767-82298789 GGGGGGCGGCAGGGGGCCCAGGG + Intergenic
1152848106 17:82614955-82614977 GAGGGGAGACGGTGGACCTGGGG + Exonic
1152912409 17:83012911-83012933 CGGGTGGGACGGGGGGCCCGGGG - Intronic
1152924533 17:83081017-83081039 GGGGGGCGACTGTGGCTTCGCGG - Intronic
1152932241 17:83115827-83115849 GGGAGGCGACGCGGGGCCCATGG + Intergenic
1152938312 17:83153074-83153096 GGGGGGGGACAGTCGGCCCCGGG + Intergenic
1153290676 18:3499009-3499031 GGGGGGCTGAGGGGGGCCCGGGG + Exonic
1153712999 18:7819148-7819170 GGGAGGAGAAGGTGGGCCCCTGG + Intronic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1157846298 18:51006989-51007011 GGGGGGGGGCGGTGGTCCCTGGG - Intronic
1158954193 18:62523670-62523692 GGGCGGCGGCGGGGGGCCCTCGG + Exonic
1160526968 18:79543996-79544018 GTGGGGCGAGGGGGTGCCCGGGG - Intergenic
1160719151 19:589957-589979 CGGGGGCGGCGGGCGGCCCGGGG + Exonic
1160769091 19:822248-822270 GGGTGGCTGCGGTCGGCCCGGGG + Intergenic
1160787686 19:908889-908911 GGGGGGCGGCGGTGGGCGGGGGG - Intronic
1160951045 19:1667586-1667608 GGGCGGCCAGGCTGGGCCCGGGG - Intergenic
1160991838 19:1863312-1863334 GGGCGGCGGGGGTGGCCCCGGGG + Exonic
1161013116 19:1969641-1969663 GGTGGGCGGGCGTGGGCCCGTGG - Exonic
1161029404 19:2050876-2050898 GGGAGGGGACCGAGGGCCCGGGG + Exonic
1161215824 19:3094606-3094628 GGGGGGCGGCGGCGGGCAGGCGG + Exonic
1161450715 19:4343880-4343902 GGGGGGCTGCGGCGGGCCCGGGG + Exonic
1161482105 19:4516469-4516491 GGGGGGCTGCTGTGGGCCTGAGG - Intronic
1161683604 19:5692581-5692603 GGGGGGTGACGCAGGGCCTGGGG - Intronic
1161779175 19:6279804-6279826 GGCGAGCGACGCGGGGCCCGGGG - Exonic
1161988397 19:7670108-7670130 GGGGGGCGGGGGTGGGGACGGGG - Intronic
1162021362 19:7869926-7869948 GGGCGGCGGCGGCGGGCCGGGGG + Exonic
1162032761 19:7924618-7924640 GGGGGGCAGCGGTGGGCACCGGG + Exonic
1163035471 19:14566676-14566698 GGGGGGCTTGGGTGGGCCAGGGG + Intronic
1163637716 19:18445152-18445174 GAGGGAGGAGGGTGGGCCCGGGG - Intronic
1163824541 19:19515655-19515677 GGGAGGCTAGGGTGGCCCCGGGG - Exonic
1164834554 19:31349281-31349303 GGGAGGGGGCGGCGGGCCCGCGG + Exonic
1164918439 19:32070458-32070480 GGGTGGCGACTGTGTCCCCGAGG - Intergenic
1165080295 19:33302772-33302794 CGGGGGCGACGGCCGGGCCGGGG - Intergenic
1166375315 19:42324306-42324328 TGGCGGCGGCGGTGGCCCCGAGG + Intronic
1166871149 19:45872092-45872114 GGGGGGCCATGGTGGGCACTGGG - Exonic
1166995333 19:46717197-46717219 GGAAGGGGAGGGTGGGCCCGGGG + Intergenic
1167114335 19:47480138-47480160 GTGGGGCTAGGGTGGGGCCGAGG - Intronic
1167350204 19:48969561-48969583 CGAGGGCGACGGTGGCACCGAGG + Exonic
1167622737 19:50568302-50568324 GAGCGGCGCCGGCGGGCCCGAGG - Intergenic
1168146244 19:54421210-54421232 GGGAGGGGACGGTGGCCCCCGGG + Intronic
1168151046 19:54449029-54449051 GGGTGGGGACGGTGGCCCCGAGG - Exonic
1168287522 19:55342058-55342080 TGGGGGCGAGGGTGGGCCCGAGG + Intronic
1168290509 19:55354952-55354974 GGGGGGCGGGGGCGAGCCCGTGG - Exonic
1168293008 19:55366127-55366149 CGGGGGCGCCGGCGGGTCCGGGG + Exonic
1168297280 19:55383678-55383700 GCGGGGAGACGGAGGGACCGAGG - Intronic
1168408068 19:56121013-56121035 GGGGGGCGTGAGTGGGCGCGCGG - Intronic
926402068 2:12507465-12507487 GAGAGGCGGCTGTGGGCCCGGGG - Intergenic
927881503 2:26692837-26692859 CGGGGGCGCCGGGGGGCCGGCGG + Exonic
929966850 2:46542868-46542890 GGGAGGGGGCGGCGGGCCCGGGG - Exonic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932036434 2:68251856-68251878 GTGGGGCGACGGCGGGGCGGCGG + Intronic
933728003 2:85437408-85437430 GAGGGGAGACAGTGGGCCCCGGG + Intergenic
935710369 2:105893182-105893204 GGGAGGCGAGTGTGGGGCCGGGG - Exonic
936079854 2:109424743-109424765 TGGGGGAAACGGTGGGTCCGTGG - Intronic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
938301111 2:130213650-130213672 GGGAGGGGGCGGCGGGCCCGGGG + Intergenic
938796029 2:134718878-134718900 GCGGCGGGACGGTGGGCCCCTGG + Exonic
942182947 2:173397576-173397598 GGGGGGCGAGGGTGGGAGTGGGG + Intergenic
943669781 2:190648837-190648859 GGGGGCGGCCGCTGGGCCCGGGG - Intronic
945080889 2:206085571-206085593 GGGGGGCGCCGGTAGGCCTCGGG - Intronic
947109053 2:226699022-226699044 GGGTGGGGAGGGTGGGCCCAAGG + Intergenic
948487238 2:238288710-238288732 GGGCGGCGGCGGCGGGCGCGGGG - Intronic
949014594 2:241702222-241702244 CGGGCGCGACGGGGGGCGCGCGG + Intronic
1168804431 20:664168-664190 GGGGGGCGCCGGGGGGCGCGCGG - Exonic
1170524776 20:17226865-17226887 GGTGGGCGGGGGCGGGCCCGGGG + Intronic
1170570529 20:17629796-17629818 GGGCGGCGGCAGTGGGGCCGGGG - Intronic
1171035410 20:21709325-21709347 AGGCGGCCACGGCGGGCCCGGGG - Exonic
1171388605 20:24786748-24786770 GCGGGAGGACGGTGGGCCCAGGG - Intergenic
1172083279 20:32358850-32358872 GGGGGGCTCCGTGGGGCCCGGGG + Intronic
1172474426 20:35226618-35226640 GGGGGGCGGCCGGGGGCGCGGGG - Intergenic
1173453535 20:43186334-43186356 GGGGGGCGAGGGTGGGCGCAGGG - Intronic
1174287742 20:49484116-49484138 GGGGGGCGCCGGCGGGCGCCGGG + Intergenic
1175215870 20:57391509-57391531 GGGGGGCGGCGGGGAGCGCGCGG - Exonic
1175785620 20:61710041-61710063 GGGCGGCCAGGGTGGGCCTGGGG + Intronic
1175924528 20:62465342-62465364 GGGGGGCCATGCTGGGCCCAGGG + Exonic
1176042325 20:63072232-63072254 GGGAGGGGTCGGTGGGCGCGCGG - Intergenic
1176110833 20:63409974-63409996 GAGGGGGGAGGGTGGGCCAGGGG + Intronic
1176548561 21:8212139-8212161 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1176550171 21:8217375-8217397 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
1176556455 21:8256347-8256369 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1176567492 21:8395174-8395196 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1176575394 21:8439389-8439411 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1176577013 21:8444645-8444667 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
1176621277 21:9063980-9064002 AGGGGGAGACTGTGGGCCTGTGG + Intergenic
1178587560 21:33882794-33882816 TGGAGGCGACGGTGGGCCCTGGG - Intronic
1178824676 21:36005048-36005070 GGGGGGAGTCGGGGGGGCCGGGG + Intergenic
1178900807 21:36597000-36597022 GGGGGTGGAGGGTGGGCACGCGG + Intergenic
1179175488 21:39005070-39005092 GGGGGGAGGCGGGGGGCCCGGGG + Intergenic
1179424141 21:41260076-41260098 GGGAGGCCACGGCGGGGCCGGGG - Intronic
1179905083 21:44418559-44418581 TGGGGGCTCCGGTGGGCCTGGGG + Intronic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1181162028 22:20965072-20965094 GCGGGGCGGTGCTGGGCCCGCGG + Intergenic
1181387636 22:22557640-22557662 GGGGGGCGGCGGTGGGGACCGGG + Intronic
1182296254 22:29312399-29312421 GAGGGGCGGCGGGGGCCCCGAGG - Exonic
1183581773 22:38730710-38730732 GGGTGGTGAGGGTGGGCCAGGGG - Exonic
1183720176 22:39557880-39557902 GGCGGGGGGCGGCGGGCCCGGGG - Intergenic
1183744598 22:39685458-39685480 GGGGGAGGGCGGTGGGCCCAGGG + Intronic
1184066730 22:42125642-42125664 GGTGGGGAAGGGTGGGCCCGGGG + Intergenic
1184069198 22:42137794-42137816 GGTGGGGAAGGGTGGGCCCGGGG + Intergenic
1184857920 22:47156606-47156628 GGGAGGTGAGGGTGGGCCTGAGG + Intronic
1185067909 22:48641147-48641169 GGGGGGCCACGGTGCCCCCACGG - Intronic
1185337420 22:50276791-50276813 GGGGGTCGAGGGTGGGCATGGGG + Intronic
1203253445 22_KI270733v1_random:128444-128466 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1203255066 22_KI270733v1_random:133713-133735 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
1203261499 22_KI270733v1_random:173522-173544 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1203263122 22_KI270733v1_random:178792-178814 GGCGGGCGGCGGAGGGGCCGCGG + Intergenic
949993782 3:9600849-9600871 GTGGCGCCACGGCGGGCCCGGGG + Intergenic
950153844 3:10708046-10708068 GGCGGGCGGCGGCGGGGCCGCGG - Intergenic
950821880 3:15768654-15768676 GGGGGGCGGCGGTGGGGCAGGGG + Intronic
951080505 3:18445373-18445395 GAGGGGCGAGGGCGGGCCAGGGG + Intronic
951558777 3:23945753-23945775 GGCGGGCGCCGGGCGGCCCGGGG - Intronic
953705156 3:45225538-45225560 TGGGGGCGGCGGCGGGCCGGAGG + Exonic
954686584 3:52373319-52373341 GGGGCGCGACGGCGGGGCGGGGG + Intronic
954796096 3:53161916-53161938 GGGCGGCGAGCGTGGGCCGGGGG - Intronic
961522821 3:127477141-127477163 GGGGGCAGCTGGTGGGCCCGAGG + Intergenic
961612626 3:128152996-128153018 GGGGGGCGAAGGGGGGCGGGGGG - Intronic
963091393 3:141486919-141486941 GGGGGGCGGGGGCGGGGCCGCGG + Intergenic
965701112 3:171460174-171460196 GGCGGGGGAGGCTGGGCCCGGGG - Exonic
966684952 3:182683199-182683221 CGTGGGTGACGGTGGGACCGCGG - Intergenic
967491772 3:190100234-190100256 GGGGGGCGGCGGGGGGGGCGGGG - Intronic
967762441 3:193241135-193241157 GGCGGGCGAAGCTGGGCTCGGGG + Exonic
968148304 3:196318101-196318123 GGTGGGCGACGGGGTGCCTGAGG - Exonic
968434070 4:576089-576111 GGCGGGCGGCGGCGGGCGCGCGG - Intergenic
968479178 4:826245-826267 CGGGGGCGGGGGTGGACCCGGGG + Intergenic
968479277 4:826404-826426 CGGGGGCGGGGGTGGACCCGGGG + Intergenic
968479320 4:826471-826493 CGGGGGCGGGGGTGGACCCGGGG + Intergenic
968556775 4:1249609-1249631 TGGGGGCGATGGGGGGCCCGCGG - Intronic
968908055 4:3463564-3463586 GGCGGGGGACGGGGGGCGCGGGG + Intronic
969113353 4:4857052-4857074 GGGGGGGGGCGGGGGGCCCGGGG - Intergenic
969344833 4:6563932-6563954 GGGCGCCGAGGGTGGGCGCGGGG + Intergenic
973826157 4:54709140-54709162 GGCGGGAGGCGGTGGGCCAGTGG + Intronic
975472990 4:74792464-74792486 GGGGGGCGCCTGTGGGCCAGAGG - Intronic
977255860 4:94739333-94739355 GGGAGGCCAGGGTGGGCACGAGG - Intergenic
981807057 4:148728777-148728799 GGAGGGCCATTGTGGGCCCGGGG + Intergenic
982117973 4:152113543-152113565 GGGAGGCGACAGTGGGGCAGGGG + Intergenic
985451631 4:190066403-190066425 GGCGGGCGACGGTGGCCCGGGGG - Intergenic
985452616 4:190069693-190069715 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985453603 4:190072990-190073012 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985454593 4:190076283-190076305 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985455581 4:190079576-190079598 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985456565 4:190082870-190082892 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985457553 4:190086170-190086192 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985458540 4:190089463-190089485 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985459529 4:190092763-190092785 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985463780 4:190175532-190175554 GGCGGGCGACGGTGGCGCGGGGG - Intronic
985539705 5:482245-482267 GGAGGGCGCCTGTGGGCCCCGGG - Intronic
988369286 5:30346021-30346043 GGGGGGCGGGGGGGGGGCCGGGG - Intergenic
999044021 5:148448316-148448338 GGGGGGCGGGGGTGGGCATGGGG - Intergenic
1001529834 5:172454210-172454232 CGGGGGCGACCGAGGGCCCCCGG - Intronic
1002296141 5:178232455-178232477 GGCGGGCGGCGGGGGGCGCGGGG - Intronic
1002524261 5:179806702-179806724 GGGGAGGGGCGGGGGGCCCGGGG + Intronic
1002898153 6:1390829-1390851 CGGGGGCGTCGGTGCGGCCGGGG + Exonic
1002926970 6:1610405-1610427 GGGGGGCGGCGGGCGGCGCGGGG + Exonic
1003942568 6:11044019-11044041 GGGGCGCGCGGGTCGGCCCGAGG - Intronic
1003995801 6:11538190-11538212 GGGGGGCGGCGGCGGGTGCGCGG - Intergenic
1006319936 6:33314287-33314309 GGGGGGCGGGGGAGGGCCTGGGG - Intronic
1006415846 6:33903459-33903481 GGGGGGCAATGGTGGGTCAGTGG + Intergenic
1006547600 6:34792452-34792474 GGTGGGCGCCGGCGGGCGCGGGG - Intronic
1008449670 6:51635859-51635881 GGGGGGGGGCGGGGGGCCGGGGG + Intronic
1010001516 6:70954916-70954938 GGGGGGGGGCGGTGCGCGCGTGG + Intronic
1016936643 6:149452830-149452852 GCTGGGTGATGGTGGGCCCGGGG - Intronic
1017084413 6:150700557-150700579 TGGGGGTGAAGGGGGGCCCGAGG - Intronic
1018653255 6:166008582-166008604 TGGGCGCGAGGGTGGGCCGGTGG - Intergenic
1019478223 7:1254367-1254389 GGGGGGCCACCGTGGGAACGCGG + Intergenic
1020080512 7:5283587-5283609 CGGGGAGGGCGGTGGGCCCGGGG + Intronic
1020094647 7:5361629-5361651 GGGGGGCGACAGGGCGCTCGGGG + Exonic
1020204744 7:6105459-6105481 GGGGGGCGGCGGGCGGGCCGGGG - Intronic
1022396234 7:29989852-29989874 GGAGGCGGAGGGTGGGCCCGCGG - Intronic
1023000309 7:35801399-35801421 TGGGGGCCACTGCGGGCCCGGGG + Intronic
1023810388 7:43906707-43906729 GGTGGGGTAAGGTGGGCCCGGGG + Exonic
1025149769 7:56539232-56539254 GGGTGGCGGGGGTGGGCCGGGGG + Intergenic
1026025373 7:66740408-66740430 GGAGGGCGACGCTGGCTCCGCGG - Intronic
1026846166 7:73700244-73700266 GGGCGGGGACGGAGGGCCCATGG + Exonic
1027467658 7:78535875-78535897 GGGGGGAGGCGGTGGGCGGGGGG - Intronic
1029640192 7:101815724-101815746 GGGGGTCGCCGGTCGGCCCGCGG + Intergenic
1032237936 7:130140930-130140952 GGTGAGCGACGGTGGCCTCGAGG - Intergenic
1034342807 7:150368961-150368983 GCGGGGCCACCGCGGGCCCGCGG + Intronic
1035553423 8:545791-545813 GGGGGGCGGGGATGGGGCCGTGG + Intergenic
1036390299 8:8318870-8318892 CGGGGGCGGGGGCGGGCCCGGGG + Exonic
1038632903 8:29262847-29262869 GGGGCGCGAGGAGGGGCCCGGGG - Intronic
1040286581 8:46103601-46103623 GGGTGGCGTGGGTGGGCCCCAGG - Intergenic
1041340809 8:56843787-56843809 GGGGGTCGAAGGTGTGCCCGTGG - Intergenic
1042399632 8:68330975-68330997 GAGCGGCGAGGGTGGGCGCGAGG + Exonic
1044313776 8:90726551-90726573 GGGGGGCTGCTGTGGGCCTGAGG - Intronic
1044761157 8:95519047-95519069 GGGGGGCGGCGGTGGGGGCGCGG + Intergenic
1047024592 8:120811908-120811930 GGGGGAGGACGCGGGGCCCGGGG + Exonic
1049419495 8:142510627-142510649 GGGGGGCGAGAGCTGGCCCGGGG - Intronic
1049615024 8:143572322-143572344 GGGGGGCGGTGCTGGCCCCGGGG - Intronic
1049620670 8:143597146-143597168 GCGGGGCGACGGAGGCCACGTGG - Intronic
1049761369 8:144333223-144333245 GGGCGGCGCCGGAGGCCCCGCGG - Exonic
1050151520 9:2622674-2622696 GGGGTTCGAGGGTGCGCCCGAGG - Intronic
1052956128 9:34254400-34254422 CAGGGGCTGCGGTGGGCCCGTGG + Exonic
1053105839 9:35406817-35406839 GGGCGGCGACGGTGAGCAAGAGG + Intergenic
1056799486 9:89681391-89681413 GGGGGGTGCCGGGGGGCCGGGGG - Intergenic
1057225185 9:93289308-93289330 GTGGGGGGACGGTGGGCCCCAGG - Exonic
1057694767 9:97315308-97315330 GGGGGGCTACGGTGGTCTCAGGG + Intronic
1058058771 9:100473986-100474008 GTGGGGAGGCGGTGGGGCCGGGG + Intronic
1059237616 9:112775385-112775407 GGGAGGCCAAGGTGGGCCTGAGG - Intronic
1059769993 9:117415334-117415356 GGGGGGCTTGGGGGGGCCCGAGG - Intergenic
1061129847 9:128702745-128702767 GGGAGGCGGCGCTGGTCCCGCGG + Exonic
1061231612 9:129319040-129319062 CGGGGGCGACGGGGGGCAGGAGG - Intergenic
1061610039 9:131740024-131740046 GGGGAGCGGCGGCGGGCGCGCGG - Intronic
1061726015 9:132582475-132582497 AGGGGGAGACGGACGGCCCGAGG - Exonic
1062084400 9:134641487-134641509 GGGGGACCAGGGTGGGCCCCTGG + Intergenic
1062084683 9:134642478-134642500 AGGGGGCGGCGGCGCGCCCGCGG - Intronic
1062435529 9:136545193-136545215 GCGGGGCGACCGGGAGCCCGGGG + Intronic
1062578934 9:137221313-137221335 GGGGGGCCCCGGACGGCCCGTGG + Intronic
1203469845 Un_GL000220v1:111591-111613 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1203477666 Un_GL000220v1:155563-155585 CGGGGGCGGTGGTGGGCCCGCGG + Intergenic
1185432381 X:18096-18118 GGGGGTCGGGGGTGGTCCCGAGG - Intergenic
1186821339 X:13291167-13291189 GGGGGGCGCGGGGGGGCGCGGGG - Intergenic
1189717616 X:43882163-43882185 GGGGGGCGGCCGTGGGGCAGGGG - Intronic
1190265727 X:48826478-48826500 GGGGGGCGACGCTGCTCCCCGGG - Intergenic
1194383618 X:93225057-93225079 GGGAGGCGAAGGTGGGGGCGGGG + Intergenic
1196909229 X:120468964-120468986 GGGCGGCGGCGGTTGGCCCGGGG - Intronic
1199658571 X:150023091-150023113 GGGAGGGGATGGTGGGCCCATGG + Intergenic
1199846427 X:151695344-151695366 GGCGGGCGACAGGGTGCCCGGGG + Intronic
1200000315 X:153056656-153056678 GGAGGGAGACGCTGGGCCCCGGG + Intronic
1202101266 Y:21310224-21310246 GGGGGGCAGCGGTGGGGCAGCGG + Intergenic