ID: 1083269623

View in Genome Browser
Species Human (GRCh38)
Location 11:61565236-61565258
Sequence CATGCTGAGCAGATGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083269617_1083269623 0 Left 1083269617 11:61565213-61565235 CCATAGGAAGCACCCTCCATGCG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1083269623 11:61565236-61565258 CATGCTGAGCAGATGGAAATGGG 0: 1
1: 0
2: 1
3: 17
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083269623 Original CRISPR CATGCTGAGCAGATGGAAAT GGG Intronic
901705751 1:11071728-11071750 CATGCTGAGCAGCAGCAAGTGGG - Intronic
903613874 1:24637824-24637846 GATGCTGGGCAGATCAAAATAGG - Intronic
905684337 1:39898191-39898213 CTTGCTGTGCAAAAGGAAATTGG - Intronic
906771781 1:48491542-48491564 CAGGCTGAGCAGAAAGAGATAGG + Intergenic
907559282 1:55373978-55374000 CATGCTCAGCAGAAGGAGTTTGG + Intergenic
907709606 1:56866890-56866912 CATGATGAGGAGCAGGAAATGGG + Intronic
908216248 1:61956224-61956246 GATGCTAACCAGATGGGAATGGG + Intronic
912703525 1:111895670-111895692 CATTCTGAGCATATGGAGAAGGG - Intronic
912715953 1:111983670-111983692 GATGGTGGGCAGATGGAGATGGG - Intronic
913395553 1:118367332-118367354 AATGCTGAGCAGGAGGAAATTGG - Intergenic
913529679 1:119724837-119724859 CATGGTGAGCAGTTGACAATGGG - Intronic
914841040 1:151249012-151249034 CATGCAGGGAAGTTGGAAATGGG + Intronic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916134212 1:161637273-161637295 GGTCCTGAGGAGATGGAAATGGG + Intronic
920490815 1:206413420-206413442 CATCTGGAGCAGATGGAAAAGGG + Intronic
920599936 1:207313994-207314016 CTTGCTGAGCAGAGGAAACTAGG - Intergenic
924573448 1:245258606-245258628 CACGCAGAGCAGGTGGAATTTGG - Intronic
1063260029 10:4377642-4377664 CATGCAAAACAGATAGAAATGGG + Intergenic
1063679183 10:8170817-8170839 GATGCTGAGGAGATGGTGATGGG + Intergenic
1064970224 10:21058056-21058078 CATGCTGAGCTGATTGCAACTGG - Intronic
1065044321 10:21732388-21732410 CATGCTGAGCAGCTGGGATTAGG + Intronic
1065156296 10:22873398-22873420 CTTGGTGATCAAATGGAAATTGG - Intergenic
1065414338 10:25468095-25468117 CATGCTGAGAAGAGGGAAAGAGG - Intronic
1066320198 10:34295416-34295438 AGTTCTGAGAAGATGGAAATGGG - Intronic
1069881533 10:71596690-71596712 CATGAGAAGCAGATGGGAATGGG + Intronic
1072329063 10:94328088-94328110 CATGCTGAGGAGAAGCAAAATGG + Exonic
1073821208 10:107266407-107266429 AGTGCTGAGGAGATGAAAATTGG - Intergenic
1075572236 10:123554595-123554617 GAAGCTGAGGAGATGGCAATTGG + Intergenic
1075806306 10:125191332-125191354 CTTGCTGTGCAGATGGAAGGAGG + Intergenic
1077284525 11:1759779-1759801 CAGGCTGAGCAGGTGGGAGTGGG - Intronic
1077288870 11:1779698-1779720 CAAGCTGGGCAGACGGAAAGGGG + Intergenic
1078262182 11:9720277-9720299 AATGCTGAGCAGATCGAAGCTGG + Intronic
1080252643 11:30252009-30252031 CGGGCTGAGGAGATGGAAAGGGG + Intergenic
1081104156 11:39043998-39044020 CACGTGGAGCAGATGGAAACTGG - Intergenic
1081562049 11:44226688-44226710 CATGCTGCCCAGATGGGAAAGGG - Intronic
1081711818 11:45221733-45221755 CAGGCTGAGCAGTAAGAAATAGG + Intronic
1082973131 11:59044168-59044190 GATGCTCAGGAGATGGAGATGGG + Intergenic
1083269623 11:61565236-61565258 CATGCTGAGCAGATGGAAATGGG + Intronic
1083861806 11:65423970-65423992 CATGGCGAGCAGATGGAACCGGG + Intergenic
1084670487 11:70603875-70603897 AATGCTGAGCAGATGGTGCTTGG + Intronic
1085798355 11:79564446-79564468 CTGGCTGAGCAGATGGCAGTAGG + Intergenic
1085910064 11:80813415-80813437 CATATTGGGAAGATGGAAATGGG - Intergenic
1086770593 11:90760219-90760241 CATGCAGAGTAGAAGGAGATGGG + Intergenic
1087850075 11:103018011-103018033 CATCCTGAGTAGCTGGAATTAGG + Intergenic
1089814305 11:121158729-121158751 CATGCTGAGGGGCAGGAAATGGG + Intronic
1091443207 12:527572-527594 CTAGATGAGCAGATGGATATGGG - Intronic
1092870041 12:12798127-12798149 CATGCTGGGGAGATGGAACATGG - Intronic
1092937712 12:13379467-13379489 CGTGCTGGAGAGATGGAAATGGG + Intronic
1096263704 12:50107989-50108011 CAGGATGAGTGGATGGAAATGGG - Intronic
1097957195 12:65497993-65498015 CATGTGGAGAAGAGGGAAATAGG - Intergenic
1097993588 12:65862999-65863021 CATGCTCAGCTCATGGTAATTGG + Intronic
1098285196 12:68899841-68899863 CATGCTTAGGAGATGCATATTGG + Intronic
1098843231 12:75503021-75503043 CATGCTGAGCAGAAGTAGAAAGG + Exonic
1099562833 12:84200323-84200345 CATGGTGAGAAGTTGGAGATGGG - Intergenic
1100688970 12:97018617-97018639 CAAGCTGAGGAGATTGAATTTGG - Intergenic
1102179150 12:110898897-110898919 CCTCCTGAGCAGGTGGGAATTGG + Intronic
1103162263 12:118739399-118739421 GATGCTGAGCAGAGGGACAAGGG + Intergenic
1103195675 12:119041881-119041903 CATGCTGAGAAGATTGAGCTCGG - Intronic
1104868679 12:131978051-131978073 GATGGTGACCAGATGGAAAAGGG + Intronic
1105580615 13:21692437-21692459 CATGCTGACCAGTTGCAACTTGG + Intronic
1106337568 13:28797553-28797575 CATGTTGAGAACTTGGAAATGGG - Intergenic
1107024730 13:35788282-35788304 CCAGCTGAGCAGAGAGAAATGGG + Exonic
1109485806 13:63017216-63017238 CATGGAGAGCAGAAGGAATTAGG + Intergenic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110395737 13:75027932-75027954 CATGCTGAGCAGATATAGCTAGG + Intergenic
1111898903 13:94176489-94176511 CATGCTTAGCACAGGGAAGTTGG - Intronic
1114164234 14:20202779-20202801 CTGGCTGAGGAGATAGAAATAGG + Intergenic
1118843485 14:69528976-69528998 CATGCTGTGCAGGAGGAAAGGGG + Exonic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1120508261 14:85380180-85380202 CATGCTGAGCATATGGGGAGGGG - Intergenic
1120829468 14:88985345-88985367 CAACCTGACCAGATAGAAATTGG + Intergenic
1121712720 14:96051511-96051533 CATGCTGAGGAGATGGATGAGGG - Intronic
1122516011 14:102309090-102309112 GATGCTCAGCAGAAGGAAATAGG - Intergenic
1124723514 15:32133949-32133971 CATGCTCTGCAGATGGTGATTGG + Intronic
1125795284 15:42399796-42399818 CATGCTGAGAAGTTTGCAATAGG + Intronic
1126108675 15:45163127-45163149 CTGCCTGAGCAGATGGGAATGGG - Intronic
1126200744 15:45983152-45983174 CATACTGAGCAGTTGGAAGAAGG - Intergenic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1127834413 15:62778891-62778913 CATGCTGAGCAAAGGGAGAATGG - Intronic
1130137890 15:81197074-81197096 CCTGCTGGGCAGATGGAGAGAGG + Intronic
1130866055 15:87934137-87934159 AATGCTGGCCAGATGGAAAATGG + Intronic
1132246958 15:100304853-100304875 CATGCTGAGTAGGTGGAAGAGGG - Intronic
1132417714 15:101635438-101635460 CATGCTGAGAAAGTGGAAAATGG - Intronic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1134259177 16:12637132-12637154 CATGCTGAGCATGTGGAATGTGG + Intergenic
1135100939 16:19604998-19605020 AATGCTGAGAAGATGGTGATGGG - Intronic
1135418162 16:22284984-22285006 CATGCTTAAAAGATGGAATTCGG - Exonic
1137517992 16:49166532-49166554 CCTCCTGAGCAGCTGGAATTAGG - Intergenic
1138582832 16:57952807-57952829 CCTGCTGCGGAGATGGAAAGAGG - Intronic
1140444301 16:75012434-75012456 CAAGCTGACCATATGGAAAAGGG - Intronic
1141907777 16:87038893-87038915 CCTGCTGAGTACCTGGAAATAGG - Intergenic
1143010992 17:3866118-3866140 CATGCTGTGCTGATTGAGATGGG - Intronic
1144409763 17:14989405-14989427 CAGGCTGAACATGTGGAAATTGG - Intergenic
1145327966 17:21847753-21847775 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1145328115 17:21848723-21848745 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1145348652 17:22058135-22058157 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1145694772 17:26779137-26779159 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1148131751 17:45266507-45266529 ACTGCTGAGCAGGTGGGAATTGG + Intronic
1148497817 17:48064463-48064485 CATGTTAAGGAGATGGAAATAGG + Intergenic
1148511784 17:48177150-48177172 AATCCTGAGCAGATGGAATGTGG - Intronic
1149391459 17:56195647-56195669 CTTGATGAGGAGAAGGAAATGGG - Intronic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1150879848 17:69012100-69012122 CATGGTGAGCTGATGGCGATTGG + Intronic
1151785486 17:76272975-76272997 CATGCTGGGGAGATGGGAACTGG + Intergenic
1152601737 17:81265791-81265813 CATGCTGAGCGGATGGCACACGG + Intronic
1203192596 17_KI270729v1_random:203974-203996 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1203201961 17_KI270730v1_random:3409-3431 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1153557177 18:6327165-6327187 CCTGCTGAGGAGGTGAAAATTGG + Intronic
1156493748 18:37512261-37512283 CACGCTCAGCACATGGACATTGG - Intronic
1157058368 18:44257005-44257027 CCAACTGAACAGATGGAAATAGG - Intergenic
1157339677 18:46768231-46768253 CATGCTGAGCAGCAGGCACTCGG - Intergenic
1159785049 18:72703952-72703974 CATGCTTAGCAGAAGGAAAACGG - Intergenic
1163009173 19:14413935-14413957 AAAGCTGAGAAGATGGAAAATGG + Intronic
1166632142 19:44416126-44416148 CATGGTGAGGAAAGGGAAATGGG - Intergenic
1167219817 19:48191570-48191592 CATTCTGATCACATGGAAAAGGG + Intronic
1167278489 19:48552869-48552891 CACGCTGAGCTCATGGAAGTGGG - Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
928099910 2:28430932-28430954 CCTGCTGAGAAGGTGGAAGTAGG - Intergenic
928662759 2:33520282-33520304 CATGGTGAGTAGATGGGAATGGG - Intronic
928839119 2:35584334-35584356 CTTGCTGAGCTTATGGACATAGG + Intergenic
929603182 2:43217717-43217739 CATGTTATGCAGATGGAAGTCGG - Intergenic
929606726 2:43239712-43239734 AATGCTGTGCAAATGGCAATGGG + Intronic
931140172 2:59448829-59448851 AATGCTGATAAGATGGCAATGGG + Intergenic
931314840 2:61119072-61119094 CATGCAGAGTTGATGAAAATTGG - Intronic
934512486 2:94956967-94956989 CAGGGGGAGCAGAAGGAAATGGG - Intergenic
934991401 2:98924513-98924535 AAAGCTGAGCAGAGGGAGATGGG - Intronic
937195784 2:120155326-120155348 CATGCAGACCAGAAGGCAATGGG - Intronic
937393575 2:121514767-121514789 CATACTGGGCATCTGGAAATGGG - Intronic
938214621 2:129500681-129500703 CCTGCAGTGCAGATGGAGATAGG - Intergenic
939173283 2:138720916-138720938 AATGCAAAACAGATGGAAATAGG + Intronic
939569872 2:143828594-143828616 CATACTGAGCACATGAAAAATGG - Intergenic
940986685 2:160058245-160058267 CATGCTGCGCCGACGGAAAGAGG - Intronic
941211914 2:162650688-162650710 CATGCTGATGGGATGAAAATTGG - Intronic
941800931 2:169658995-169659017 CATTCTGAGTAGATGGGACTAGG - Intronic
942792631 2:179778208-179778230 CATGCAGGGCAGATGGAGAATGG - Intronic
943000723 2:182325143-182325165 CATGCTGAGCAATTAAAAATAGG + Intronic
944231305 2:197395720-197395742 CATGATGAGCAGAAGCTAATGGG - Intronic
946522055 2:220476632-220476654 GATGCTGAACAGATGAAAACTGG - Intergenic
946949378 2:224856337-224856359 AATGCTGAGCAGAGGAGAATAGG - Intronic
947061357 2:226170151-226170173 CATGCTGAGCCAATGGAATTAGG + Intergenic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
1169210935 20:3765976-3765998 CATGCTGACCAGAGGTGAATGGG - Intronic
1170095733 20:12643896-12643918 CATGTTGAGATGGTGGAAATGGG + Intergenic
1171518239 20:25756575-25756597 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1171558620 20:26099629-26099651 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1172320268 20:33991128-33991150 CATGCTGATGACATGGCAATGGG + Intergenic
1173466339 20:43284974-43284996 CATCCTCAGCATATGGAAGTTGG + Intergenic
1174035250 20:47664798-47664820 CATTCTGTGCTGACGGAAATGGG - Intronic
1175512847 20:59545687-59545709 ATTGTTGAGCAGATGGAAAAGGG + Intergenic
1176306230 21:5124700-5124722 CATGTGGAGCAGATGGGAAGGGG - Intronic
1176652396 21:9562986-9563008 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1178501774 21:33131575-33131597 AATGGTGTGCAGATGGAAACTGG - Intergenic
1178678470 21:34651488-34651510 CATTCTGACCATATGGAACTTGG - Intergenic
1179850828 21:44137330-44137352 CATGTGGAGCAGATGGGAAGGGG + Intronic
1182196309 22:28521834-28521856 AATGCTGAGGAGACGGGAATTGG + Intronic
1184502766 22:44883762-44883784 CACCCAGAGCAGATGGATATGGG - Intronic
1185168861 22:49279739-49279761 CATGGAGAGCAGAAGGCAATGGG - Intergenic
949133936 3:539440-539462 CATGTTGATCAGAAGGAAAAAGG + Intergenic
949419246 3:3848307-3848329 CATTTAGAGCAGATGGAACTAGG + Intronic
949440813 3:4078231-4078253 CAAACTATGCAGATGGAAATGGG + Intronic
952957168 3:38564635-38564657 AAGGCTGAGCAGAAGGAAGTGGG - Intronic
953905287 3:46865512-46865534 CATGATGAACACAAGGAAATTGG - Intronic
955668119 3:61371741-61371763 TAGCCTGAGCAGATGGAAGTGGG - Intergenic
955887587 3:63617621-63617643 CATCCTGAGGATAAGGAAATAGG + Intergenic
958946527 3:100368695-100368717 CCTGCTGAGTAGCTGGGAATCGG + Intronic
959028451 3:101270050-101270072 CCTCCTGAGCAGCTGGAATTAGG + Intronic
960916062 3:122696276-122696298 AAGGCTGAGCAGAAGGAATTAGG + Intronic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
962829281 3:139125810-139125832 CCTGCTGAGCAGACAGAAGTGGG + Intronic
963290416 3:143481480-143481502 TATGCTGATCAGATGGCAAATGG + Intronic
963680882 3:148375019-148375041 CCTTCTGAGTAGTTGGAAATAGG + Intergenic
965493797 3:169372924-169372946 CATGCGGAGCAGTGGGAAACAGG - Intronic
966560489 3:181314602-181314624 CATGTTAAGAAAATGGAAATAGG + Intergenic
968147809 3:196314203-196314225 TAAGAAGAGCAGATGGAAATAGG + Intronic
968262723 3:197338164-197338186 CAAGCTCATCAGATGGAAACAGG + Intergenic
973377018 4:49293606-49293628 CATGGTGAGGACAGGGAAATGGG + Intergenic
974503319 4:62733534-62733556 CATTCTGAGCAGAATAAAATAGG - Intergenic
975510635 4:75190897-75190919 CGTGCTTTCCAGATGGAAATGGG + Intergenic
975958859 4:79876265-79876287 TATGCTGAACAGATGAAAATAGG - Intergenic
980338303 4:131503923-131503945 TATGTTCTGCAGATGGAAATAGG - Intergenic
981024092 4:140058481-140058503 CCTGCTGAGTAGATAGATATTGG + Intronic
982765953 4:159348435-159348457 CTTGCTGATCAGATGGAATGAGG - Intronic
983525453 4:168755988-168756010 AATGCTGAGAAGATGGGAATTGG + Intronic
983796942 4:171875633-171875655 CATGCTGAGAAGAAGGGAAACGG - Intronic
985041264 4:185893848-185893870 CAGGAAGAGCAGATGGGAATGGG + Intronic
985618368 5:938227-938249 CATGCCGAGAACATGGACATGGG - Intergenic
986184215 5:5421643-5421665 CATACTGAGGAGCTAGAAATTGG + Intronic
987231174 5:15895387-15895409 CATGCTTAGCACATGGAACAGGG + Intronic
989415950 5:41175751-41175773 AATGCTGAGCAGAAGTAATTAGG - Intronic
990689355 5:58346330-58346352 CATGCAAGGCAGAAGGAAATGGG + Intergenic
991208042 5:64072616-64072638 AATACTGAGTAGATGAAAATAGG + Intergenic
991931406 5:71756437-71756459 CATGATGAGCAGATGGAAAAAGG - Intergenic
993575336 5:89592534-89592556 CTTGCTCTGCAGAGGGAAATAGG - Intergenic
995195613 5:109364019-109364041 CTTCCTGAGTAGATGGAATTAGG - Intronic
998065661 5:139156188-139156210 CCTGCTAAGCACTTGGAAATGGG - Intronic
998822654 5:146070671-146070693 CCTGCAGAGGAGATGGAAGTGGG - Intronic
999726758 5:154444945-154444967 CATGCTGCGCAGTTGGAGAGTGG + Intergenic
1001307161 5:170583723-170583745 GCTGCTGAGCTGATGGAAAAAGG + Intronic
1002057384 5:176606265-176606287 CAGGCTGAGCAGATAAAAACAGG - Intronic
1003119349 6:3307099-3307121 CATGCTGAGCAGACGGCATACGG + Intronic
1003654087 6:7989341-7989363 CATGCAGAGAAGTTGGAAATGGG + Intronic
1004628900 6:17402995-17403017 CATAATGAGGAGATGGAAATGGG - Intronic
1004824904 6:19408830-19408852 AATGCTGAGCAAATGGCAATGGG - Intergenic
1005410563 6:25541002-25541024 CATCCTGAGCAGAGACAAATGGG + Intronic
1008379854 6:50828832-50828854 CATGTTGGGAAGATGGAAGTTGG + Intronic
1009807841 6:68625437-68625459 CATGCTGAGCAGCTGAAATCTGG + Intergenic
1009922862 6:70084574-70084596 CGGGCTGAGCAGAGGAAAATAGG - Intronic
1010945055 6:81964209-81964231 CATGCTGAACACATTGAAATTGG - Intergenic
1012347963 6:98215051-98215073 CATCCTGAGCAGACAGACATGGG - Intergenic
1013707609 6:112857131-112857153 CATGCTGAGAGGATGTAAAGTGG - Intergenic
1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG + Intergenic
1018083625 6:160279814-160279836 CATGCTGAGCAAATGAAGCTAGG - Intergenic
1018372877 6:163184918-163184940 CCTGGTGGGCAAATGGAAATGGG + Intronic
1018424548 6:163668599-163668621 CATACTGCCCAGATGGAAAGGGG - Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1025189616 7:56886678-56886700 ACTGCTGAGCAGATACAAATGGG - Intergenic
1025279063 7:57613913-57613935 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1025305668 7:57851587-57851609 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1025682322 7:63690239-63690261 ACTGCTGAGCAGATACAAATGGG + Intergenic
1028700919 7:93778366-93778388 TAGGCTGAGAAGGTGGAAATTGG - Intronic
1031079406 7:117243618-117243640 GATGCTGAGCAGAAGGAAAATGG + Intergenic
1031107441 7:117562519-117562541 CATGCTCAGGAAATGGCAATGGG + Intronic
1033380094 7:140808122-140808144 CATGCTGAAGATATGAAAATTGG + Intronic
1035353480 7:158263520-158263542 CAAGCTGAGCAGATGCTGATGGG - Intronic
1036051798 8:5206841-5206863 AATGCTGAGCAAATTGAAAATGG - Intergenic
1037478445 8:19280228-19280250 CCTGCTGACCAGAAGGAATTTGG - Intergenic
1038815351 8:30897516-30897538 CACTCTCAGCAGATGGGAATTGG - Intergenic
1039678842 8:39706005-39706027 CATCTTTAGCAGTTGGAAATGGG + Intronic
1041980755 8:63856257-63856279 CATTCTGAGCAAATGGATAATGG + Intergenic
1044475618 8:92621836-92621858 CATCCTCAGCAGTTAGAAATGGG - Intergenic
1048273421 8:133047506-133047528 CATGCTGTGCAGATAGAATGTGG - Intronic
1052624354 9:30956142-30956164 CATCCTAAGCAGATGAAAATAGG + Intergenic
1054870221 9:70042503-70042525 AATCCTGAGCTGATAGAAATTGG + Intergenic
1055371448 9:75604158-75604180 CATGCTTTGCAGTTGGAAACGGG + Intergenic
1058568404 9:106312406-106312428 CTTGCTGAGCATCTGGAACTAGG + Intergenic
1058826402 9:108779122-108779144 CATAGAGAACAGATGGAAATAGG + Intergenic
1059682169 9:116596781-116596803 CTTTCTGTGCAGATGAAAATGGG + Intronic
1059880338 9:118682079-118682101 CATTTTCAGCTGATGGAAATGGG - Intergenic
1061911461 9:133727417-133727439 CTTCCTGAGCAGACAGAAATGGG + Intronic
1061911843 9:133729177-133729199 CATGATGAACGGATGGAAAGAGG + Intronic
1061932779 9:133841873-133841895 CAGGCTGAGCTGGTGGAAAGCGG - Intronic
1062203682 9:135322796-135322818 GATGCTGAGCAGATGCATGTCGG + Intergenic
1062232647 9:135490681-135490703 CATGCAGAGCAGTTGCCAATTGG + Intergenic
1062297272 9:135839234-135839256 CTTGCTGAGTAGCTAGAAATAGG - Intronic
1203630124 Un_KI270750v1:66527-66549 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1188887737 X:35570966-35570988 CATTAGGAGCAGATGCAAATTGG - Intergenic
1191093058 X:56644488-56644510 CAAGATGAACAGAAGGAAATTGG - Intergenic
1192554699 X:72080292-72080314 CATGCTCAGCAGAGGGGAAAAGG + Intergenic
1194138908 X:90182966-90182988 CATTCTGAGCAGATTGGAAAGGG - Intergenic
1194653092 X:96538714-96538736 AACGCTGACCAGATGCAAATTGG + Intergenic
1195431568 X:104795240-104795262 TATTCTGAGCTGATGGAATTGGG + Intronic
1195758918 X:108225460-108225482 AATCCTGAGCAGATGGAAGCAGG - Intronic
1197639124 X:128948736-128948758 CATGTGGAGCTGCTGGAAATAGG - Intergenic
1197901020 X:131372102-131372124 CAGGCTGAGGAAATGGCAATAGG + Intronic
1198322781 X:135535693-135535715 TATGGAGAGCAGATGGAAAAAGG + Intronic
1198326595 X:135579811-135579833 CATGAGGAGAAGATGGAAAATGG + Exonic
1198329973 X:135613375-135613397 CATGAAGAGAAGATGGAAAATGG + Intergenic
1198332930 X:135638480-135638502 CATGAAGAGAAGATGGAAAACGG - Intergenic
1198333263 X:135641973-135641995 CATGAAGAGCAGATGGAGAATGG - Intergenic
1198637557 X:138716032-138716054 CATTCTGAGCAGAAAGGAATTGG + Intronic
1199049927 X:143225203-143225225 CATAGTCAGCAAATGGAAATGGG + Intergenic
1200484710 Y:3753199-3753221 CATTCTGAGCAGATTGGAAAGGG - Intergenic
1201333760 Y:12856867-12856889 AATGGACAGCAGATGGAAATGGG + Intronic
1201406870 Y:13658594-13658616 TATGGTGAGCAGCTGGAAAGGGG + Intergenic