ID: 1083270730

View in Genome Browser
Species Human (GRCh38)
Location 11:61571201-61571223
Sequence GTGTCTGTGCAGAGGCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083270730_1083270735 2 Left 1083270730 11:61571201-61571223 CCCATGTGCCTCTGCACAGACAC 0: 1
1: 0
2: 4
3: 24
4: 249
Right 1083270735 11:61571226-61571248 CTACCATCGTGTTTCCACATGGG 0: 1
1: 0
2: 0
3: 1
4: 60
1083270730_1083270734 1 Left 1083270730 11:61571201-61571223 CCCATGTGCCTCTGCACAGACAC 0: 1
1: 0
2: 4
3: 24
4: 249
Right 1083270734 11:61571225-61571247 CCTACCATCGTGTTTCCACATGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083270730 Original CRISPR GTGTCTGTGCAGAGGCACAT GGG (reversed) Intronic
902401227 1:16158261-16158283 GGCTCTGTGGACAGGCACATGGG + Intergenic
902642135 1:17773896-17773918 CTGTCTGTGCAGGGCCACAGAGG + Intronic
902674018 1:17995864-17995886 ATATCTGTACAGAGACACATAGG - Intergenic
903668067 1:25019866-25019888 GTGTGTGTGCACAGGCATGTAGG - Intergenic
904354721 1:29931494-29931516 CTCTCTGTGCAGAGACACTTCGG - Intergenic
904651291 1:32007813-32007835 AAGACTGTGCAGAGACACATAGG - Intergenic
904920470 1:34003951-34003973 GAGTCTGCACAGAGCCACATGGG - Intronic
904945677 1:34197152-34197174 GTGGCTTTGCAGAAGGACATAGG - Intronic
905201372 1:36319363-36319385 GTGGCTGTGCGGAGGGACAGAGG + Intronic
905471818 1:38198041-38198063 GTGTCTGTCCTGATGCACAATGG - Intergenic
905538610 1:38742757-38742779 GTGACTGTGCTGAGGCCCATGGG - Intergenic
906366324 1:45213111-45213133 GTGTCTGTTCACAGTTACATTGG + Intronic
907313242 1:53551829-53551851 GGGTTTGTGCAGAGGCCCAGAGG - Intronic
907381588 1:54095337-54095359 GTGCTGGTGCAGAGGCACAGAGG + Intronic
910723617 1:90314665-90314687 CAGGCTGTGCAGAGGAACATGGG + Intergenic
911063108 1:93764593-93764615 GGGCCTGAGCAGAGGCACATAGG - Intronic
912237814 1:107870985-107871007 TTGACAGTGCAGAAGCACATGGG - Intronic
912304896 1:108557454-108557476 GTGTCTGTGCAGAGGCTCAAAGG - Intergenic
915109520 1:153554191-153554213 ATCTCTGTGCAGAGGCACAGAGG - Intergenic
915524375 1:156467037-156467059 GTGTGTGTGCAGGGGCATTTGGG + Exonic
917179013 1:172273478-172273500 GTGTCTGTACATAGGCCCAAGGG + Intronic
917589348 1:176460577-176460599 CTGTCTGTGGAAAGGCCCATTGG + Intergenic
920203563 1:204275549-204275571 GGGTAGGTGCAGAGGCAGATGGG + Intronic
922097511 1:222454962-222454984 GTGTCAGTACAGAGGAACGTCGG + Intergenic
922223076 1:223623540-223623562 GTGTGTGTGCAGGGGCCCAAGGG - Intronic
923114264 1:230919816-230919838 GTGTATGTGCTGAGAGACATTGG - Intronic
923210312 1:231797896-231797918 GTGTGTGTGCAGAGGTGGATAGG + Intronic
923665174 1:235993001-235993023 GTGTCTGTCCAGAGTCACACAGG + Intronic
923788891 1:237094106-237094128 GTATCTGTGCAAAGGCACAGAGG - Intronic
924421368 1:243913209-243913231 CTGTCTGTGCAGTGGCTCACTGG - Intergenic
924784735 1:247184446-247184468 CTGTCACTGCAGAGGCTCATTGG + Intergenic
1064366626 10:14714348-14714370 GTGCCCATGCAGAGGCACAGGGG - Intronic
1064435300 10:15305868-15305890 GTGTTCGTGCACAGGCACATAGG - Intronic
1065328641 10:24571508-24571530 GTGGCTGTGCAGAAGCTCAGGGG + Intergenic
1067735176 10:48845107-48845129 GTGTCTGTGCCCAGCCACATGGG - Intronic
1068903512 10:62297309-62297331 GTGGATTTGCAGGGGCACATGGG + Intergenic
1070943803 10:80371603-80371625 GGGCATGTGCAGAGGCACAGAGG + Intergenic
1071078949 10:81786404-81786426 GTGTTAGAGCACAGGCACATGGG + Intergenic
1071351834 10:84754366-84754388 GTGTGTGTGCATATGCACACAGG + Intergenic
1071571594 10:86700262-86700284 GAATCTGTGCTGAGGCCCATTGG + Intronic
1072115499 10:92366736-92366758 CTGTGTGTGCAGAGACACCTGGG + Intergenic
1076746723 10:132518252-132518274 GTGCCTGTCCAGGGGCACAAGGG - Intergenic
1077017739 11:404385-404407 GGGTCAGTGAAGAGGCCCATGGG + Intronic
1077062542 11:624212-624234 GTGTCAGAGCGGAGGCACATTGG - Exonic
1077104671 11:836991-837013 AGGTCTCTGCAGGGGCACATGGG + Intronic
1078693252 11:13603014-13603036 GTGTCAGTGAAGAGGCAGAAAGG - Intergenic
1080821476 11:35810819-35810841 GTGACTGTGCACAGGAAAATAGG - Exonic
1082592122 11:55024877-55024899 GTGTCTGTGAAGAGATACTTGGG - Intergenic
1082844215 11:57714172-57714194 GTGTCTGTGGAGAGAGAAATCGG + Intronic
1083270730 11:61571201-61571223 GTGTCTGTGCAGAGGCACATGGG - Intronic
1083296962 11:61720128-61720150 GTGGCTCTGCAGAGGCTCAGTGG - Exonic
1083612728 11:64011829-64011851 GTGTCTGGGCAGAGTCAGATGGG + Intronic
1084287025 11:68138643-68138665 TTGTCTGAGAAGAGGCACTTGGG + Intergenic
1084622424 11:70282092-70282114 GTGACTGGGCAGGGGCAAATGGG - Intronic
1084651519 11:70492157-70492179 GGGTCTGTGCAGACTCACAGTGG - Intronic
1085366219 11:75947582-75947604 GTGTCTGTGAAAAAGCACTTTGG + Intronic
1085556467 11:77427185-77427207 CTGTCTCTGCAGAGACACTTAGG - Intronic
1087815603 11:102655010-102655032 GTGTCTTTGCTGAGGCCCAGTGG + Intergenic
1090201674 11:124862075-124862097 GTGGATTTGCAGAGGAACATGGG - Intergenic
1090610215 11:128464530-128464552 GTGTCGGTGGAGAGACAAATAGG + Intronic
1090727755 11:129543007-129543029 GTGTGGGGGCAGAGGTACATGGG + Intergenic
1092945997 12:13454523-13454545 GTGTAGGGGCAGAGGCAGATGGG + Intergenic
1094523334 12:31215718-31215740 GTGCGTGTGCACATGCACATTGG - Intergenic
1095628576 12:44347062-44347084 GTGTGTGTGTAAAGGCAGATTGG - Intronic
1097267282 12:57753523-57753545 GTGTCTGGGCAGAGGCCATTTGG - Intronic
1098817151 12:75182066-75182088 GTGCATGTCCAGAGGCACATAGG + Intronic
1100467612 12:94861184-94861206 TTTTCTGTGAAGAGGCAGATAGG - Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1104066560 12:125311695-125311717 GGTTCTGTGCAGAGGCATAGTGG - Intronic
1105387429 13:19944567-19944589 TTGTCTCTGGAGAGGCAGATAGG + Intergenic
1106595520 13:31132163-31132185 GTGTCTGTGCAGAGGATGTTGGG + Intergenic
1106888306 13:34214835-34214857 GTGACTTTGCAGAAGCTCATAGG - Intergenic
1108505484 13:51108863-51108885 ATGGCTGTGCAGAGGCACATGGG - Intergenic
1108800911 13:54093155-54093177 GTGTCAGTGCAGAGGCCCAAGGG + Intergenic
1110551261 13:76813648-76813670 CTTTGTGTGCAGAGCCACATGGG + Intergenic
1112146986 13:96710747-96710769 GTGCCTGTGCAGGGGCATCTTGG - Intronic
1113589201 13:111486441-111486463 GGGCCTGGGCAGAGGCACAGCGG - Intergenic
1113903019 13:113806885-113806907 GTGTCTGTGTAGAGCCGCTTGGG - Intronic
1114219953 14:20687476-20687498 GTGTGTGTGCAGGCGCATATGGG + Intronic
1114670146 14:24406636-24406658 GGGACTGAGCAGAGGCACCTGGG + Intronic
1116951191 14:50880243-50880265 GTCTCTGTGCATGGGGACATGGG + Intronic
1119286791 14:73461689-73461711 GTATCTGTTCAGAGCCACTTGGG + Intronic
1121505206 14:94472006-94472028 GTCTCTGTGCAGAGTCAAATTGG - Intronic
1121627641 14:95398304-95398326 GTGTGTGTGCATAGGCACTCAGG + Intergenic
1121649255 14:95545073-95545095 GGGGCTGTGCAGAGGCCCATGGG + Intergenic
1122356224 14:101124489-101124511 GGAGCTGTGCAGAGGCCCATAGG - Intergenic
1122553425 14:102562776-102562798 GTGTGGGGGCAGAGGTACATGGG - Intergenic
1123682990 15:22775872-22775894 GTGTCACTCCAGAGGCACACAGG - Intronic
1124045886 15:26149447-26149469 GTGTCTCTGGGGAGCCACATGGG + Intergenic
1124254111 15:28127223-28127245 GTGTCTCTGCAGACGCAGCTGGG + Intronic
1126755216 15:51919276-51919298 GTGTCTGTGGGGACACACATTGG - Intronic
1128848532 15:70926162-70926184 TTTTCTGTTCACAGGCACATTGG + Intronic
1129376854 15:75138971-75138993 CTGTTTGTGCAAAGGGACATGGG - Intergenic
1129749086 15:78047844-78047866 GTGTCAGTCTACAGGCACATGGG + Intronic
1130430803 15:83845039-83845061 GGGTCGGTGCAAAGGCCCATCGG - Intronic
1133392011 16:5418355-5418377 GTGTCTGAGAAGATGCACAGGGG + Intergenic
1134196646 16:12164090-12164112 GTGTGTGTGTAGGGGCACAAAGG + Intronic
1134908279 16:18000858-18000880 GTGACTTGGCAGAAGCACATTGG - Intergenic
1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG + Intergenic
1135233360 16:20730546-20730568 GTGTCACTGCAGAGGCTCACTGG - Intronic
1135667339 16:24346941-24346963 GTCTCTGTGTACTGGCACATGGG - Intronic
1136849297 16:33601119-33601141 GTGTCTGAGCACAGGAACAGAGG + Intergenic
1137564729 16:49525799-49525821 GTCACTGTGCAGAGGCACCCAGG + Intronic
1137876196 16:51998889-51998911 GTGTCTGTGCATATGCATGTGGG + Intergenic
1141205270 16:81928581-81928603 GTCTCTTTGCAGAGGAATATTGG + Exonic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1203111004 16_KI270728v1_random:1449769-1449791 GTGTCTGAGCACAGGAACAGAGG + Intergenic
1143252811 17:5535548-5535570 GTGTCTGCGCAAATGCACCTGGG - Intronic
1143763897 17:9124815-9124837 GTGTCATAGCAGAGGCAGATCGG - Intronic
1144065878 17:11623557-11623579 GAGTCTGTGCAGTGGAACACAGG + Intronic
1145046219 17:19618923-19618945 GTGGCTGGTCAGTGGCACATTGG - Intergenic
1146009333 17:29180814-29180836 GTGCCTCTGCAGAGCCACCTTGG - Intergenic
1146315268 17:31801983-31802005 TTCTCTGTTGAGAGGCACATTGG - Intergenic
1146950367 17:36901185-36901207 GTGTCTGTGTACATGCACACGGG + Intergenic
1147138223 17:38447073-38447095 GTGTCTGTGGCCAGGCACAGTGG - Intronic
1149144971 17:53479368-53479390 GTGTCTCTGCAAAGCCACATAGG - Intergenic
1149783274 17:59415078-59415100 GTGTGTGTGCATATGCACAGGGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151816805 17:76475138-76475160 GGGCCTGTGCAGAGACACCTCGG + Exonic
1152033076 17:77855653-77855675 GTGTCTCTAGAGAGGCCCATGGG - Intergenic
1152703572 17:81831850-81831872 GTCTCTGAGCAAAGCCACATGGG - Intronic
1153091999 18:1357789-1357811 GTGACTGTGGAAAGGCAGATGGG - Intergenic
1153847824 18:9065674-9065696 ATGACGGTGCAGAGGCACCTAGG - Intergenic
1154355871 18:13622901-13622923 GTCTCTGTGCGCAGGCACACAGG + Intronic
1155261152 18:24043748-24043770 GTCCCTGAGCAAAGGCACATGGG + Intronic
1155393890 18:25366350-25366372 GTGTCTGTGGAACAGCACATAGG - Intergenic
1159436877 18:68429617-68429639 GTGTGTGTGCTCATGCACATGGG + Intergenic
1159913330 18:74166697-74166719 GTCACTGTGCAGTGGCACCTGGG + Intergenic
1162666967 19:12221728-12221750 TTTACTGTGCACAGGCACATGGG + Intergenic
1166229146 19:41415445-41415467 GTGTCTGGGCAGCTGCAAATGGG + Intronic
925088923 2:1137289-1137311 GTGTGTGTGCAGGTGCAGATGGG - Intronic
925222497 2:2153431-2153453 GTGTGTGTGCAGAGGGACTCTGG - Intronic
925407270 2:3613805-3613827 GGGACTGTGCCGAGGCTCATGGG + Intronic
927031995 2:19130455-19130477 GAGTCTCTGCAGAGGGACATGGG - Intergenic
929054555 2:37864593-37864615 GTCTCTGTGCTGAGGCACCCAGG + Intergenic
930188065 2:48429687-48429709 GGGTGTGTGCAAAGACACATGGG + Intergenic
932579202 2:72982711-72982733 GTGTTTGAGCAGAGTCACAAAGG + Intronic
932817894 2:74876328-74876350 GTGTCTTAGAGGAGGCACATGGG - Intronic
933993028 2:87647259-87647281 CTGTCTCTGCAGAGGCCCCTTGG - Intergenic
936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG + Intergenic
937072361 2:119073762-119073784 GTCACAGTGCAGAGGCACCTTGG - Intergenic
937259416 2:120576135-120576157 GTGTCTCTGCAGAGGCTTAATGG - Intergenic
938208464 2:129443686-129443708 GTGTCTGTAAAGAGGCACAAGGG - Intergenic
938301778 2:130219793-130219815 GAGGCTGTGCAGAGGCAGTTTGG - Intergenic
938454923 2:131454658-131454680 GAGGCTGTGCAGAGGCACTTTGG + Intergenic
942832244 2:180250961-180250983 GAGTCTGTGCAGAGGCACAAAGG - Intergenic
943898241 2:193396787-193396809 GAGTCTATGCAGAGGAAAATGGG + Intergenic
946143794 2:217713680-217713702 GTGTCTGTGAGAAGGCACCTCGG + Intronic
946182565 2:217957334-217957356 GTGTGTATGCAGAGACACAGTGG - Intronic
947152067 2:227125798-227125820 GTGTTACTGCAGAGGCACCTTGG - Intronic
948121936 2:235537234-235537256 GTGTGGGTGCAGGGGCACCTCGG + Intronic
1169084080 20:2816221-2816243 GGGTCCGTGCAGAGGGACTTGGG + Intergenic
1169119152 20:3084881-3084903 CTGTCTGTGCAGGGGATCATAGG + Intergenic
1169783088 20:9330037-9330059 GTGTTTGTGCAGAATCACAAAGG + Intronic
1171097628 20:22347027-22347049 TTGTCTGTCCAGAGGGAAATAGG - Intergenic
1171255316 20:23685773-23685795 GTCTCTTGGCACAGGCACATGGG + Exonic
1174112001 20:48203577-48203599 GTGTTTGTGCAGATGCACCTCGG - Intergenic
1174164913 20:48577763-48577785 GGGCATGTGCACAGGCACATTGG + Intergenic
1175456093 20:59115610-59115632 GTTTCTCTGCAGATGGACATGGG + Intergenic
1175734637 20:61376713-61376735 GGGTCTGTGCTGAGACAGATGGG - Intronic
1176024373 20:62978350-62978372 GTGTCTCAGCAGAGGGAGATGGG - Intergenic
1176220382 20:63966814-63966836 GTGTTTGGGCAGAGGCCCTTGGG - Intronic
1177557425 21:22710433-22710455 GTGTCTGAGGTCAGGCACATAGG + Intergenic
1180833297 22:18917294-18917316 GTGTCTGTCATGAGGCTCATGGG - Intronic
1180918447 22:19505816-19505838 GTGTCTTTTGAGAAGCACATGGG + Intronic
1182096032 22:27626628-27626650 GTGACTGTTCATTGGCACATTGG - Intergenic
1182505336 22:30778290-30778312 GTGTGTGTGCACATGCACACGGG - Intronic
1185138900 22:49089418-49089440 GGGCCTGGGCAGAGGCACAGGGG - Intergenic
1185362053 22:50414295-50414317 CTGTCGGTGCAGAGCCACAGGGG + Intronic
949563012 3:5220365-5220387 GTGTGGGTGCAGAGGCCCATGGG + Intergenic
950234508 3:11307117-11307139 GTGTTTGTGATCAGGCACATGGG + Intronic
950854287 3:16091099-16091121 GGCTATGTGAAGAGGCACATGGG - Intergenic
952924125 3:38308935-38308957 GTGGCTGTGCAGAGGCCAAGAGG - Exonic
953838300 3:46366766-46366788 GTGTCATTGTTGAGGCACATGGG + Intergenic
954115284 3:48463770-48463792 GTCTCTGGGCTGAGGCACTTTGG - Exonic
955835637 3:63051840-63051862 GTGTCTGTGAAAAGGCAAAGAGG + Intergenic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
956790558 3:72676953-72676975 GTTTCTGTGGACAGGGACATGGG + Intergenic
958794647 3:98693854-98693876 GTGTCTTAGCAGAGTGACATTGG + Intergenic
962012461 3:131405683-131405705 GTGTCTGTACATAGCCACAGAGG - Intergenic
967421110 3:189273884-189273906 GTGAATGTACACAGGCACATTGG + Intronic
968434743 4:578632-578654 GTGACTGTGCAGAGGCCCGGTGG - Intergenic
968702275 4:2062732-2062754 GTGGCTGTGCAGAGGGGCAATGG + Intronic
968943595 4:3652139-3652161 GTGCCAGTGCAGAAGCACAAGGG - Intergenic
971499058 4:27299372-27299394 TTGTCTGTGCACAATCACATGGG + Intergenic
971943557 4:33245676-33245698 GGGTCTGTACAGAGCCACAGGGG - Intergenic
974180998 4:58384839-58384861 GTCTCAGTGCAAAGACACATAGG - Intergenic
974425444 4:61737134-61737156 GTTTCTGTACATAGACACATAGG - Intronic
974932852 4:68379339-68379361 GTGGCTCTGAAGAGGCATATTGG - Intergenic
977502777 4:97862197-97862219 GTGTCTCTGCACACACACATAGG - Intronic
977886628 4:102259060-102259082 GTGTCTGTAGAGAGGCTCAGAGG - Intronic
978798475 4:112731842-112731864 GTGCCTGTGAACAGCCACATAGG - Intergenic
978824377 4:113002897-113002919 GAGTCTGTACAGAGCCACAGAGG - Intronic
980098787 4:128520643-128520665 ATGTGTGTGCAAAGGCACAGAGG + Intergenic
981019821 4:140013826-140013848 GGGACTGTGGAGAGGCACCTAGG - Intronic
981028019 4:140095706-140095728 GTGACAGTGGAGAGGAACATGGG - Intronic
981873525 4:149515100-149515122 GTGTGTGTGCAGGCGCCCATAGG + Intergenic
984950121 4:185001860-185001882 CTGCCTGTGCGGAGGCAGATAGG + Intergenic
985683824 5:1271361-1271383 GAGTCTCTGCAGACACACATGGG + Intronic
987380628 5:17282505-17282527 ATGTCTGTGCTGAGGCAGAGTGG - Intergenic
989801964 5:45553683-45553705 GTATATGGGCAGATGCACATAGG - Intronic
990859458 5:60310650-60310672 GAGCATGTGCAGATGCACATGGG - Intronic
994383132 5:99095475-99095497 GTTTCTGTACAGAGGTAAATTGG + Intergenic
997198113 5:131993105-131993127 AGGTGTGTGCTGAGGCACATGGG - Intronic
997391998 5:133524764-133524786 TTTTGTGTGCAGAGGCCCATGGG - Intronic
997552278 5:134763730-134763752 GTGTCTGTGCTGAAGCAGAAGGG + Intronic
998053102 5:139052812-139052834 GTGTCAGTGCATTTGCACATGGG - Intronic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
999383692 5:151139583-151139605 GTGTCAGGGCAGAGGGTCATGGG + Intronic
1000526558 5:162365966-162365988 GTGGCTGTGCAGAAGCTCTTTGG - Intergenic
1001027313 5:168235045-168235067 GTGTGTGTTCACATGCACATAGG - Intronic
1001170093 5:169410997-169411019 GTATCTGTCCAGAGGCTCCTGGG + Intergenic
1002069088 5:176668212-176668234 TTGGCTGTGGAGAGGCACAAAGG + Intergenic
1002931835 6:1640280-1640302 GTGCCCGTGGAGAAGCACATGGG + Intronic
1003019017 6:2493880-2493902 GACTCTGTGCTGAGGCATATGGG - Intergenic
1004032948 6:11889715-11889737 GTGTGTGTGCACACGCCCATGGG - Intergenic
1005684772 6:28243631-28243653 GTGTCTGTTCAGAAGCACATTGG - Intergenic
1006388973 6:33747632-33747654 GAGGCTGTGCAGAGGCCCAGAGG + Intergenic
1007693271 6:43716373-43716395 GAATCTGTGCACATGCACATAGG + Intergenic
1011033316 6:82945241-82945263 GTCTCTGTGCTGAGCCACCTGGG - Intronic
1011992682 6:93542848-93542870 TTGTATGTACAGAGGCACATTGG + Intergenic
1012235585 6:96810720-96810742 GTGTTTGTGCATATGTACATAGG + Intronic
1012703154 6:102488854-102488876 GTGTACATGCAGAGCCACATTGG + Intergenic
1013009598 6:106107328-106107350 GTGTCTTTGCAAAGAAACATGGG + Exonic
1013089791 6:106889925-106889947 GTGTTTGTGCAGACTCACCTTGG - Intergenic
1013413743 6:109905807-109905829 CAGTCTGTGCAGATGCATATTGG - Intergenic
1013591618 6:111623598-111623620 GTGCCTTTGCACAGGCACACAGG - Intergenic
1016052099 6:139540363-139540385 GTGTGTGTGCAAAGCAACATTGG + Intergenic
1017906441 6:158760178-158760200 GTCTCTGTCCAGAGCCACAGGGG - Intronic
1017965854 6:159265414-159265436 GAGTCTATGCAGAGGGACCTGGG + Intronic
1018055428 6:160048147-160048169 CTGTCAGTGCAGAGGCACGGGGG + Intronic
1018470591 6:164093837-164093859 GTGTGTGTGAAATGGCACATGGG + Intergenic
1018885336 6:167930581-167930603 GGGTGTGTGGAGAGGCAGATAGG + Intronic
1019222007 6:170480308-170480330 GAGTCTCTGCATAGGGACATTGG + Intergenic
1019353156 7:564583-564605 ATTTGTGTGCAGAGGCACAGAGG - Intronic
1020559703 7:9715706-9715728 GGCTCTGTGGAGAGGCACACTGG - Intergenic
1022205055 7:28155783-28155805 GTGTGTGTGCACGCGCACATGGG + Intronic
1022658640 7:32345233-32345255 GTGTCTGCGAAGGGGCTCATGGG - Intergenic
1023735542 7:43232865-43232887 ATTTCTGAGCAAAGGCACATGGG - Intronic
1024590902 7:50882059-50882081 GTGTTGGTGCAGAGACAGATGGG + Intergenic
1026445390 7:70480214-70480236 GTGTGTGTGCACATGCACTTAGG + Intronic
1028740918 7:94274071-94274093 GTCTCCCTGCAGAGGAACATTGG + Intergenic
1029418087 7:100456177-100456199 GTGCGTCTGCAGACGCACATGGG - Intergenic
1029459669 7:100687567-100687589 GTGGCTGTGCTGAGGCTGATGGG - Exonic
1030197134 7:106863632-106863654 GTGTATGTGCAGTGCCAGATTGG + Intergenic
1032342404 7:131087044-131087066 GTGTTTTGGCAGAGGCAAATAGG + Intergenic
1035048508 7:155984508-155984530 GTATCTCTGCAGAGGCACAGAGG - Intergenic
1037331932 8:17751457-17751479 GTGTCTGGGCAGACCCTCATAGG - Intronic
1040447161 8:47507130-47507152 GTGGCTGGGAAGAGGCATATGGG - Intronic
1041374033 8:57193814-57193836 GTGGCTGTGGAGAGCCACAAGGG + Intergenic
1041584351 8:59498572-59498594 GTGGGAGTGCATAGGCACATTGG + Intergenic
1041723738 8:60999239-60999261 GTTACTGTGCAAAGGAACATGGG + Intergenic
1042462710 8:69089421-69089443 GTGGGTGTGGAGAGGCACAAAGG + Intergenic
1043193066 8:77251393-77251415 GTGTTTCTGCAGAGACACAAAGG - Intergenic
1043193068 8:77251398-77251420 GTGTCTCTGCAGAAACACCTGGG + Intergenic
1044531225 8:93309953-93309975 GTGCAGGTGCAGAGGCTCATGGG - Intergenic
1046024887 8:108710771-108710793 GTGTCTTTGCAGATGGACAGTGG - Intronic
1046988166 8:120414717-120414739 GTGTCTGTGGAGAGTGACATTGG - Intronic
1047370765 8:124254005-124254027 GTGGCTGTGCAAAGGCCCAGTGG + Intergenic
1048005604 8:130417149-130417171 GTGTGTGTGCAGTTGTACATGGG - Intronic
1048714963 8:137258180-137258202 TTGTCTGTGGTGAGGCACACAGG - Intergenic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1050529694 9:6577686-6577708 GTGTGTGTGCACAGGGGCATAGG - Intronic
1054077105 9:60546649-60546671 GAGTCTGTGCAAAGGTCCATGGG + Intergenic
1055282795 9:74694044-74694066 ATCTCTGAGCAGAGTCACATGGG - Intergenic
1056706530 9:88956603-88956625 GTGCATGTGCAGAGACACCTGGG - Intergenic
1058961517 9:109996769-109996791 CTGTGTGTGCACATGCACATGGG + Intronic
1059134757 9:111794748-111794770 TTGTCTCTACAGAGCCACATCGG + Intronic
1061935304 9:133854220-133854242 GTATGTGTGCAGGTGCACATGGG - Intronic
1061935309 9:133854294-133854316 GTGTGTGTGCAGGTGCACATGGG - Intronic
1062282487 9:135758238-135758260 GTGTCTCGGCTGAGGCCCATGGG - Intronic
1189995846 X:46636683-46636705 CTGTCTGTGCTGTGGCACTTTGG - Intronic
1190545243 X:51518783-51518805 GTCTCTTTGAAAAGGCACATTGG - Intergenic
1191123028 X:56925890-56925912 GCTGCTGTGCAGAGGCACAGGGG + Intergenic
1194950545 X:100120801-100120823 TTGGCTGTGCTGAGGCACTTAGG - Intergenic
1200219356 X:154383563-154383585 GTGGCTGGACAGAGGCAGATGGG + Intergenic
1200909468 Y:8517280-8517302 GAGCCAGTCCAGAGGCACATGGG - Intergenic
1201233014 Y:11883789-11883811 GTGTGTGTGCATGGGCACACTGG - Intergenic