ID: 1083271378

View in Genome Browser
Species Human (GRCh38)
Location 11:61574616-61574638
Sequence CCTGACCCCCATCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083271378_1083271389 20 Left 1083271378 11:61574616-61574638 CCCATCCTTGGATGGGGGTCAGG 0: 1
1: 0
2: 4
3: 16
4: 162
Right 1083271389 11:61574659-61574681 GGAGTCCCAGTATCTGGACGCGG 0: 1
1: 0
2: 0
3: 6
4: 102
1083271378_1083271388 14 Left 1083271378 11:61574616-61574638 CCCATCCTTGGATGGGGGTCAGG 0: 1
1: 0
2: 4
3: 16
4: 162
Right 1083271388 11:61574653-61574675 GTGCAGGGAGTCCCAGTATCTGG 0: 1
1: 0
2: 2
3: 13
4: 152
1083271378_1083271390 21 Left 1083271378 11:61574616-61574638 CCCATCCTTGGATGGGGGTCAGG 0: 1
1: 0
2: 4
3: 16
4: 162
Right 1083271390 11:61574660-61574682 GAGTCCCAGTATCTGGACGCGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1083271378_1083271387 -1 Left 1083271378 11:61574616-61574638 CCCATCCTTGGATGGGGGTCAGG 0: 1
1: 0
2: 4
3: 16
4: 162
Right 1083271387 11:61574638-61574660 GGATGGTAAGGAGGTGTGCAGGG 0: 1
1: 1
2: 1
3: 29
4: 322
1083271378_1083271386 -2 Left 1083271378 11:61574616-61574638 CCCATCCTTGGATGGGGGTCAGG 0: 1
1: 0
2: 4
3: 16
4: 162
Right 1083271386 11:61574637-61574659 GGGATGGTAAGGAGGTGTGCAGG 0: 1
1: 0
2: 0
3: 25
4: 290
1083271378_1083271385 -10 Left 1083271378 11:61574616-61574638 CCCATCCTTGGATGGGGGTCAGG 0: 1
1: 0
2: 4
3: 16
4: 162
Right 1083271385 11:61574629-61574651 GGGGGTCAGGGATGGTAAGGAGG 0: 1
1: 0
2: 6
3: 35
4: 525
1083271378_1083271391 22 Left 1083271378 11:61574616-61574638 CCCATCCTTGGATGGGGGTCAGG 0: 1
1: 0
2: 4
3: 16
4: 162
Right 1083271391 11:61574661-61574683 AGTCCCAGTATCTGGACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083271378 Original CRISPR CCTGACCCCCATCCAAGGAT GGG (reversed) Intronic
900381435 1:2385966-2385988 CCTGCCCGCCCTCCAAGGAGCGG - Intronic
900386850 1:2414541-2414563 CCTGCCGGCCATCCCAGGATAGG - Intergenic
900608015 1:3532341-3532363 AGTGACCCCCGACCAAGGATAGG - Intronic
901761430 1:11474307-11474329 CCTGACCCCCAGAGAAGTATAGG - Intergenic
902200925 1:14833154-14833176 CCTCAACCCACTCCAAGGATGGG - Intronic
902285535 1:15406076-15406098 CCTGGGCCCCTTCCAAAGATGGG - Intergenic
902385321 1:16072847-16072869 TCTGTCCCCTGTCCAAGGATGGG + Intronic
903355850 1:22746910-22746932 CCTAACCCCCTTCCAGGAATGGG - Intronic
903648209 1:24907253-24907275 CCAGACCCCAATCCAAGGTACGG - Exonic
903833422 1:26188357-26188379 CCTAGCCCCCATCCCAGGAAAGG - Intronic
905028137 1:34865297-34865319 CCTGAGCTCCTTCCAGGGATGGG - Intergenic
905345803 1:37310236-37310258 CCCGACTCCCAGCCAAGGACAGG - Intergenic
905478255 1:38244072-38244094 CCTCACCCCCAGCCCAGGCTGGG + Intergenic
906607598 1:47182719-47182741 CCTGACTCCCACCCCAGGACTGG + Intergenic
907359702 1:53904542-53904564 CCTACCCCCCACCCCAGGATGGG - Intronic
907527730 1:55063589-55063611 CCAGACACCCATCCTGGGATGGG - Exonic
908911012 1:69072283-69072305 CCCCACCCCCAGCCAAGGAAGGG - Intergenic
909677615 1:78255516-78255538 CCATTCTCCCATCCAAGGATAGG - Intergenic
912412225 1:109487251-109487273 CCTGACCCTGACCCATGGATGGG + Intronic
912727064 1:112067935-112067957 CCTGAGCCCCATGCCAGTATGGG - Intergenic
914914829 1:151813227-151813249 CCTGCCCCTCACCCAAGGCTCGG + Exonic
915912617 1:159924164-159924186 CCTGTCCCCCACCCCGGGATTGG - Intronic
919377582 1:196814212-196814234 CCTGCCCCCCACCCCATGATAGG + Intergenic
919387096 1:196936109-196936131 CCTGCCCCCCACCCCATGATAGG + Intronic
920555725 1:206902872-206902894 CCTGACTCCAATCCAAGGGATGG - Intronic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
923083656 1:230684406-230684428 CCTGCCCAACATCCTAGGATGGG - Intronic
923374388 1:233345575-233345597 CCTGCCCCCCATCCCATGACAGG - Intronic
1062835236 10:631066-631088 TCTGACCCCCTTCCAGGGTTGGG - Intronic
1062977676 10:1697630-1697652 CCTGAACCCCAGACAAGGGTGGG + Intronic
1064189319 10:13191947-13191969 CCTGACCACAAGCCCAGGATGGG - Intronic
1065244254 10:23741664-23741686 ACTGACCCCCATCCTGGGAGTGG - Intronic
1065878004 10:30013704-30013726 CCTAACCCCTATCAAAGCATGGG + Exonic
1066584705 10:36919645-36919667 CGTGACCCCCATCCCAGGAAAGG + Intergenic
1067533546 10:47091953-47091975 CCTGAGCCCCATGCACGCATTGG + Intergenic
1067945256 10:50684957-50684979 CCTGACCCCCAACAAGGGGTTGG + Intergenic
1069757415 10:70781795-70781817 CGTGACCCACATCCAAGGTAGGG - Exonic
1070566683 10:77608504-77608526 CCTGAGCCCCGGCCAAGGAGAGG + Intronic
1070656067 10:78272359-78272381 CCTCACAGCCATCCAGGGATTGG + Intergenic
1070788422 10:79175702-79175724 CCTGAGCCCAGCCCAAGGATGGG - Intronic
1070866767 10:79711829-79711851 CCTGACCCCCAACAAGGGGTTGG + Exonic
1071026300 10:81117887-81117909 CCTGCCCCCCAGCCATGGACTGG - Intergenic
1071647126 10:87366268-87366290 CCTGACCCCCAACAAGGGGTTGG + Exonic
1074780165 10:116796753-116796775 CATGTTCCCCATCCAAGGGTGGG - Intergenic
1075183464 10:120233204-120233226 ACTCACCAGCATCCAAGGATGGG - Intergenic
1076497340 10:130905616-130905638 CCTGAGCCCCATCCAGGGAGGGG - Intergenic
1077112111 11:866448-866470 CCTGACCCCGACCCCAGGGTGGG - Intronic
1078177656 11:8982226-8982248 CCTGACCCCTGTCAAAGGTTGGG - Exonic
1078659337 11:13274367-13274389 CCTGACTCTGATCCAATGATTGG - Intergenic
1080407523 11:31992826-31992848 GGTGACCCCCATTCAGGGATAGG + Intronic
1081143441 11:39532819-39532841 CCTGCCCCCCATCCCATGATAGG + Intergenic
1083271373 11:61574609-61574631 CCTGACCCCCATCCTTGGATGGG + Intronic
1083271378 11:61574616-61574638 CCTGACCCCCATCCAAGGATGGG - Intronic
1084054688 11:66624818-66624840 CCTGACCCCCATAGGAGGAAAGG - Exonic
1084391698 11:68881462-68881484 CCTAACCCCCTTCCTAGGAAGGG - Intergenic
1084499490 11:69526304-69526326 CCTGACCTCCAGCAAAGGAGAGG + Intergenic
1084771846 11:71348412-71348434 CCTGAACCCCATCCAAGCTGAGG - Intergenic
1086591360 11:88518681-88518703 CCTGACCACCATCCAAATCTTGG + Intronic
1089570367 11:119404022-119404044 CCTGACCAACATCCCAGAATGGG + Intergenic
1092144529 12:6205297-6205319 CCTCACCACCATCAAAAGATTGG - Intronic
1097526028 12:60737362-60737384 CCTGACCCCCACCCCATGACAGG - Intergenic
1098442774 12:70535674-70535696 CCTGCCCCTCATCCCAGGAAAGG - Intronic
1102808442 12:115802667-115802689 CCTCATCCCAATCCAATGATGGG - Intergenic
1106104368 13:26721452-26721474 CCCGAGCCCCATCCAGGGAGCGG - Intergenic
1106557129 13:30819207-30819229 CCTGACCCTCAGCCTAGGCTGGG + Intergenic
1112478075 13:99750198-99750220 CCTCAGCCCCCTCAAAGGATTGG + Intronic
1114218178 14:20673355-20673377 TCTGACCCCCAAGCAAGGAGGGG - Intergenic
1115645830 14:35367965-35367987 CCTGACCCCCATGCAGGGCTGGG - Intergenic
1121142472 14:91555343-91555365 CCTGCCCCCCATCCCAGCAGGGG + Intergenic
1128247864 15:66145094-66145116 CCAGACCCTCCTGCAAGGATAGG + Intronic
1128322199 15:66701801-66701823 CCAAACCCCCATCCTAGGGTAGG - Intergenic
1130968033 15:88711466-88711488 CTGTACCCCCACCCAAGGATGGG + Intergenic
1133994902 16:10740750-10740772 ACTGACCCCCATCCCTGTATAGG + Intergenic
1139282963 16:65785524-65785546 CCTGACACCCAGCCAGGGCTGGG - Intergenic
1140779591 16:78282523-78282545 CCTGACCCCCATCAAATCAGTGG - Intronic
1141143028 16:81509652-81509674 CCTGACCCCAACCCTAGGGTAGG - Intronic
1142027619 16:87823000-87823022 CCTCACCCCCAGCCAAGGGAGGG - Intergenic
1147531411 17:41281599-41281621 CCTGACCCCCACCCCATGACAGG - Intergenic
1148340825 17:46872535-46872557 CCTGACGCCCTTCCCAGGATTGG + Exonic
1151556727 17:74850463-74850485 CCTGCCCCACACCCAAGCATGGG + Intronic
1151598054 17:75089803-75089825 CCTGACTCCCACCCCAGGCTGGG - Intronic
1152611627 17:81317667-81317689 CCTGACCCCCATCCCCCGAGTGG + Intronic
1153954349 18:10083423-10083445 CCTGACCCCCAGCCAGAGTTAGG - Intergenic
1157422960 18:47561401-47561423 CCTGACCTCAATCCATTGATCGG + Intergenic
1157914249 18:51649094-51649116 CCTTACCCCCATCCCAGCATGGG - Intergenic
1160160489 18:76466675-76466697 CCTCACACCCATCCCAGGCTTGG - Intronic
1160211838 18:76887508-76887530 CCTGGCCCTCAACCAATGATAGG - Intronic
1160526767 18:79543110-79543132 TCTGACCCCCAGCAAAGGTTGGG - Intergenic
1160825365 19:1077800-1077822 ACTGAGTCCCATCCGAGGATAGG + Intronic
1161455664 19:4368563-4368585 CCTGGCCCTCCTCCAAGGCTTGG + Intronic
1161508943 19:4659877-4659899 CGCCACCCCCATCCAAGGGTGGG - Intronic
1161701011 19:5795336-5795358 CTTGTCCACCATCCAGGGATGGG + Intergenic
1166375297 19:42324261-42324283 CCTGACCCCCCTCCCAGGCCGGG + Intronic
1166617942 19:44267936-44267958 CATCACGCCCAGCCAAGGATAGG - Intronic
931885203 2:66609792-66609814 CCTGCCCCCCACCCCAGGACAGG + Intergenic
939535023 2:143416926-143416948 CCTGACCCCCATCCCAAGAGGGG - Intronic
939547267 2:143569006-143569028 CCTGCCCCCCATCCTATGACAGG - Intronic
943947837 2:194090482-194090504 CCTGAGCCCCACCCCAGGGTGGG - Intergenic
947960448 2:234232100-234232122 CCTGACCTCCAGACAAGGAAGGG - Intergenic
948295605 2:236857979-236858001 CCTGACCCTGAACCAAGGCTTGG - Intergenic
1169084486 20:2818332-2818354 CCTGACCCCCACCCAAGCCCTGG + Intronic
1172208370 20:33180717-33180739 CCTGGCCCCCATCCCAGGCTAGG + Intronic
1174205192 20:48833176-48833198 GCAAACACCCATCCAAGGATCGG - Intergenic
1174236025 20:49092645-49092667 CCTGCCCCCCATCCCACGACAGG - Intronic
1174324570 20:49768972-49768994 CCTGAACCCCATTCTAGGATGGG - Intergenic
1175377823 20:58541605-58541627 CCCGGCCTCCATCCAAGGCTAGG + Intergenic
1175542617 20:59757204-59757226 CGTGACCCCCATCAAGGGCTGGG - Intronic
1175608991 20:60334503-60334525 CCTGACCCACACCCAGGGAAAGG - Intergenic
1175854412 20:62112703-62112725 CCAGATCCCCATCCAAGGAAGGG + Intergenic
1179935819 21:44602776-44602798 CGTGACCCCCACCCCAGGAGAGG + Intronic
1179961273 21:44768149-44768171 CGTGACCCCCACCCCAGGAGAGG + Intergenic
1180994987 22:19961103-19961125 CCTGAGCCCCTTCCCCGGATAGG - Intronic
1181024460 22:20120193-20120215 CCTGGCCCCCTTCCTTGGATAGG - Intronic
1184130062 22:42512354-42512376 CCTGACTACCATCCTAGGCTGGG - Exonic
1184140241 22:42574172-42574194 CCTGACTACCATCCTAGGCTGGG - Exonic
949687515 3:6592748-6592770 CCTTCCCCCCAACCAAGGACAGG - Intergenic
951217551 3:20039941-20039963 CCTCACCCACACCCAGGGATTGG + Intergenic
952404249 3:32991467-32991489 CATTTCTCCCATCCAAGGATGGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953840288 3:46384637-46384659 CCAGACCCCCATCCTTGGATTGG - Intergenic
953884943 3:46709870-46709892 CCTGCCCCCCAGCCTAGGCTTGG + Exonic
954486537 3:50858271-50858293 CCTGACCCCCATCCCACAACAGG - Intronic
955895973 3:63700219-63700241 CCTGGCCCCCACCCCAGGACAGG - Intergenic
962198994 3:133385985-133386007 CCTGACCCCCATGAAAGGAGAGG + Intronic
962266568 3:133948454-133948476 CCAGCCACCCATCCAGGGATGGG - Intronic
967088216 3:186112907-186112929 CCTTCCCCCCATACAAGAATAGG - Intronic
968812521 4:2806349-2806371 CCTGGCTCCCACCCAAGGCTGGG - Intronic
969318147 4:6394632-6394654 CATGCCCCCCATCCTGGGATGGG - Intronic
969626328 4:8307553-8307575 CCTGCCACCCATCCAGCGATGGG + Intergenic
976790801 4:88876134-88876156 CCAGCCCCCCATCCCAGGACAGG - Intronic
977127260 4:93185894-93185916 CCTGACCCCCACCCCATGACAGG + Intronic
985363990 4:189207143-189207165 CCTGGCATCCATCCAAGGAGCGG - Intergenic
986215394 5:5714776-5714798 CCTTACCGCCATCCAAGGTAAGG - Intergenic
990077246 5:51864012-51864034 CCTGTCCCAAATCTAAGGATAGG - Intergenic
991982903 5:72251780-72251802 CATGCCACCCATCCAAGGCTGGG + Intronic
992157332 5:73968311-73968333 CCTGGCCCAGACCCAAGGATGGG - Intergenic
993496873 5:88617596-88617618 CCTGCCCCCCATCCCACGACAGG + Intergenic
994244748 5:97466966-97466988 CATGACCTCCATCCATGGAGGGG + Intergenic
999194988 5:149775724-149775746 CCTGGCTCCCATCCTAGGACAGG - Intronic
1000343940 5:160298655-160298677 CCTGACTCCCAGACAAGGACGGG - Intronic
1000423890 5:161068328-161068350 CCTGCCCCCCACCCCAGGACAGG + Intergenic
1002443411 5:179275739-179275761 CCTGACCCAAATCCAGGCATCGG - Intronic
1002837375 6:876352-876374 CCTGACCCTCTCCCAGGGATGGG + Intergenic
1004553212 6:16669975-16669997 CATGACCCCCAACCAAGAAAGGG + Intronic
1005053498 6:21708259-21708281 CTTGTCCCCCATCCAAGTATGGG + Intergenic
1006808693 6:36806071-36806093 CCTGCCCCACATCCAACTATTGG + Intronic
1007172961 6:39877415-39877437 CTTCACCACCATCCAAGGAAGGG - Intronic
1013407039 6:109852668-109852690 CCTCACCCCTATCCAATGCTTGG + Intergenic
1018069903 6:160155117-160155139 CCTGACCCATATCCTAGGAATGG - Intronic
1019277226 7:182162-182184 CCTGACCCCCATCCAGAGTGTGG - Intergenic
1020663824 7:11014441-11014463 CCTGAACCCCAACCTAGGGTAGG - Intronic
1025993235 7:66511778-66511800 CCTGACCCCAATCCAAGGCTGGG + Intergenic
1026035989 7:66831042-66831064 CCTGACCCCAGTCCAAGGCTGGG - Intergenic
1026037333 7:66839386-66839408 CCTGACCCCAATCCAAGGCTGGG - Intergenic
1026983515 7:74540100-74540122 CCTGACCCTAATCCAAGGCTGGG + Intronic
1027214608 7:76175702-76175724 CCTGACCCCAATCCAAGGCTGGG + Intergenic
1027532647 7:79354505-79354527 CCTGTCCCCAATCCAAGAAGTGG - Intronic
1027933229 7:84567478-84567500 CCTGAGTTCCTTCCAAGGATAGG - Intergenic
1035924370 8:3711337-3711359 CCAGATCCCCCTCCAAGGAAGGG + Intronic
1039209294 8:35194285-35194307 CCCGCCCCCCATTCAACGATTGG + Intergenic
1040541214 8:48357721-48357743 ACTGACCCCCATCCCACGACAGG - Intergenic
1040549344 8:48426689-48426711 CCTGCTCCCCATCCCAGGCTGGG + Intergenic
1040652993 8:49470652-49470674 CCTGACCCCCTTCCAAAGTGTGG + Intergenic
1042813133 8:72847566-72847588 CTTTACCACCAACCAAGGATGGG + Intronic
1048361984 8:133705267-133705289 CCTGACCAGTATCCAAGGAGAGG + Intergenic
1048458366 8:134598842-134598864 CTTCATCCTCATCCAAGGATGGG + Intronic
1049225194 8:141447273-141447295 CCTGAGCCCCATCCATGGCCAGG - Intergenic
1049800780 8:144516610-144516632 CCTGAGCCCCAGCCAAGGCCAGG - Exonic
1050231044 9:3526151-3526173 CCTCAGCCCCAGCCAAGCATAGG - Intergenic
1051213468 9:14770847-14770869 CCTCACCCCCATGCAACGTTGGG + Intronic
1052073768 9:24115454-24115476 CTTGACCCCCATCCCCGGACAGG + Intergenic
1053048988 9:34942842-34942864 CCTGCCCCCCATCCCATGACAGG - Intergenic
1053162069 9:35820063-35820085 CCTCACCTCCATCAAGGGATAGG - Intronic
1059681833 9:116593181-116593203 CCTGAACCCCAGACAAGGCTGGG + Intronic
1061246113 9:129401953-129401975 CCTCACCCCCATCCAAGAGAGGG + Intergenic
1061451073 9:130667196-130667218 CCTCACCCCCAGCCCAGGACTGG - Intronic
1062232122 9:135487528-135487550 CCTGACCCCCAGCCCGGGAGCGG + Exonic
1186214083 X:7280613-7280635 CCTGACCCCCAACCATGAACAGG - Intronic
1191199925 X:57769619-57769641 CCTTACCCCCATCCCATGATAGG + Intergenic
1193067285 X:77273952-77273974 CCCTACCCCCATCCCATGATAGG - Intergenic
1195085219 X:101407501-101407523 CCGGACTCCCATCCCAGGAAAGG + Intronic
1197708271 X:129649108-129649130 CCTGCCCCCCAGCCAAGTACAGG - Intronic
1200650812 Y:5838192-5838214 CCTGCCCCCCATCCCATGACAGG - Intergenic