ID: 1083272617

View in Genome Browser
Species Human (GRCh38)
Location 11:61580048-61580070
Sequence CTCCCAGGCCACTCCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083272614_1083272617 -7 Left 1083272614 11:61580032-61580054 CCAAGCAGACAGTGGGCTCCCAG 0: 1
1: 0
2: 3
3: 60
4: 385
Right 1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG 0: 1
1: 0
2: 4
3: 45
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083272617 Original CRISPR CTCCCAGGCCACTCCCCTGG CGG Intronic
900098082 1:948457-948479 TGCCCAGGCCCCTCCCCAGGAGG + Intronic
900325720 1:2107843-2107865 CTCCCTCGACACTGCCCTGGGGG - Intronic
900432127 1:2607390-2607412 CTCCCAGGCTCCTCGCCTGCTGG - Intronic
900513410 1:3070563-3070585 CGCCCGGGCCGCTCCCCTCGAGG + Intronic
900945784 1:5830718-5830740 CCCCCAGACCTCTCCCCTGAGGG + Intergenic
901051774 1:6429018-6429040 CTCCCAGCCCACTCCCCAGGAGG - Intronic
901137567 1:7007787-7007809 CTCCCTGGCCTCTCTTCTGGAGG - Intronic
901476719 1:9495081-9495103 CTCCCAGGACACACCCCAAGCGG - Intergenic
901629240 1:10640284-10640306 CACACAGGCCTCTCCCCCGGGGG + Intronic
901702766 1:11054303-11054325 CACCCACCCCACTGCCCTGGGGG + Intergenic
901933428 1:12612037-12612059 CCCCCAGGCCCTTCCCTTGGGGG - Intronic
902482550 1:16719343-16719365 CTCCCAGACCACTCCCCAGGAGG + Intergenic
902874368 1:19331982-19332004 CACACAGGGCACTCCCCAGGGGG - Intergenic
903060131 1:20663596-20663618 ATCCCAGGCCAGTCCTGTGGGGG - Intergenic
903567956 1:24283351-24283373 CTCCCATGCTGCTGCCCTGGAGG + Intergenic
904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG + Intronic
904683796 1:32246905-32246927 CTCCCAGGCCAGGGCCCTGGAGG + Intergenic
904835091 1:33330568-33330590 CAGCCAGGCCACTCCCCAGCAGG - Intronic
905247411 1:36624676-36624698 CTTGCAGCCCCCTCCCCTGGAGG - Intergenic
905919185 1:41708073-41708095 CTCCCTGTGCACTCACCTGGGGG - Intronic
906142829 1:43543947-43543969 CTCCCATACCCCTCACCTGGGGG - Intronic
906584614 1:46965454-46965476 CTCTCAGGCCACTCTACTGTAGG + Intergenic
907391536 1:54161423-54161445 CTTCCATCCGACTCCCCTGGCGG - Intronic
907934688 1:59031804-59031826 CTCCCAGGCCCGTCCACTTGAGG + Intergenic
911005732 1:93220778-93220800 CTCCCATCCCACTCCCCTATAGG + Intronic
913284723 1:117216019-117216041 GTTGCAAGCCACTCCCCTGGTGG + Intergenic
913684644 1:121220282-121220304 TTCCCAGGCCACTCACTTGTTGG + Intronic
914036480 1:144007898-144007920 TTCCCAGGCCACTCACTTGTTGG + Intergenic
914152974 1:145060048-145060070 TTCCCAGGCCACTCACTTGTTGG - Intronic
914250821 1:145919894-145919916 GTCCTAGGTCACTCACCTGGGGG - Intergenic
916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG + Intergenic
916821256 1:168401017-168401039 CTCCCAGGACTCTTCCCTGTCGG - Intergenic
917820557 1:178759141-178759163 CTCCCAGACCAATGCTCTGGAGG + Intronic
919794296 1:201311939-201311961 CTCACAGGCCCCTCCCAAGGAGG + Intronic
920048855 1:203151221-203151243 CTCCCTGGCCACTTCCCCAGTGG + Intronic
920471955 1:206238832-206238854 TTCCCAGGCCACTCACTTGTTGG + Intronic
920815437 1:209327123-209327145 CTCCCCTGCCACGCCCCTGTGGG + Intergenic
921872998 1:220161439-220161461 GTCCCTGGCCACTCAGCTGGAGG + Intronic
922317679 1:224456984-224457006 CGCTCAGGCCTCTGCCCTGGAGG + Intronic
923790640 1:237108217-237108239 TTCCCAGGCCCCTCTCCTGGAGG - Intronic
1062763310 10:44188-44210 CTCCCAGTCCTCTCCCATGCAGG + Intergenic
1062919350 10:1267493-1267515 CTCCCAGGCCAGGCCCATCGAGG - Intronic
1063198619 10:3766189-3766211 CTCCCAGGGGACTGCACTGGTGG + Intergenic
1065941115 10:30564689-30564711 CTCCCAGGCCATTTGGCTGGTGG - Intergenic
1066281123 10:33919277-33919299 CTCCCAGCCCAGTCCTTTGGGGG + Intergenic
1066389187 10:34965110-34965132 CTTCAAGGCCACTGCCGTGGTGG + Intergenic
1067431545 10:46249084-46249106 CTGCCAGGCCCCTCCCCCAGGGG - Intergenic
1067441869 10:46313090-46313112 CTGCCAGGCCCCTCCCCCAGAGG + Intronic
1067793879 10:49307012-49307034 CTCTCAGGCAACTCCCCTCCTGG + Intronic
1068845141 10:61663159-61663181 CTCCCAGGCCGCTCACCAGCCGG - Exonic
1069513068 10:69056549-69056571 CTCCCAGGTCCCTCCTCTGGCGG - Intergenic
1070173015 10:73946832-73946854 CTCCCAGTCCCCTCTCCGGGTGG - Intergenic
1071430653 10:85603817-85603839 CTCCCAGGCCACCCTGCAGGTGG + Intronic
1071431765 10:85612236-85612258 CACCCAGGCCACACACATGGTGG + Intronic
1071503415 10:86219144-86219166 CTCCCTGGCCTGTCACCTGGTGG + Intronic
1072021878 10:91410462-91410484 CTCGCCCGCCACTCCGCTGGTGG + Exonic
1072618008 10:97062626-97062648 CTCACAGGCTGCTCCCCTGCTGG - Intronic
1074859504 10:117499644-117499666 CTCCCAGCCCAGGCCCCTGAGGG - Intergenic
1075319351 10:121477575-121477597 ACCCTAGGCCACTCCCCTGATGG + Intergenic
1075332041 10:121580956-121580978 CTCCCAGGTGCCTCGCCTGGGGG - Intronic
1076096236 10:127736840-127736862 CTCCCAAGCCACAGCCCTGGGGG + Intergenic
1076293723 10:129367803-129367825 CTCCCAGGCCACCACCCTGCAGG - Intergenic
1076372931 10:129966791-129966813 CTCCCAGGCCGCTCCGCAGCAGG - Intergenic
1076642340 10:131927281-131927303 CTCACACCCCACTCCCCGGGGGG - Intronic
1077395335 11:2317668-2317690 CTCCCAGCCCGTTCCCATGGAGG - Intronic
1078296498 11:10076519-10076541 CTCCCAGGCCACACCCCTCCTGG - Intronic
1078664488 11:13313402-13313424 CTCCCAGTCCACACTCCTAGTGG + Intronic
1080314424 11:30934029-30934051 TTCCCAGGCCACTCAGCTGGTGG + Intronic
1081815540 11:45938119-45938141 CTCCTCGGCCCCTCCCCTGTTGG + Intronic
1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG + Intronic
1083344892 11:61982466-61982488 CTCTCAAGGCAGTCCCCTGGTGG + Intergenic
1084153127 11:67300414-67300436 CTCCCAGGCCACGTCGCTGGGGG - Intronic
1084707642 11:70824568-70824590 ATCCCAGGCCAAGCCCCTCGAGG - Intronic
1084779872 11:71400999-71401021 GTCCTGGGCCTCTCCCCTGGTGG - Intergenic
1084795493 11:71502110-71502132 AACCCACTCCACTCCCCTGGAGG - Intronic
1085454238 11:76656749-76656771 CTCCCAGGCCACTCCTTTTCAGG - Intergenic
1085940559 11:81201573-81201595 TTCCCAGGCCATTCAGCTGGTGG - Intergenic
1088107430 11:106223039-106223061 CTCTATGGCCACTCCCCTGAAGG - Intergenic
1089602470 11:119624183-119624205 GTCCCAGGCAGCTTCCCTGGGGG + Intronic
1090178604 11:124673754-124673776 CGCCCAGGCCCCGCCCCTGCCGG - Exonic
1091186925 11:133655625-133655647 TTCCCAGGCTCCTCCCCTGGAGG + Intergenic
1091220278 11:133926512-133926534 CTTCCAGGCCACCTTCCTGGAGG - Intronic
1091397255 12:161639-161661 CTCCCAGGCCTCTTTCCTGATGG - Intronic
1091750477 12:3018846-3018868 TTCCCAGCCTCCTCCCCTGGGGG - Intronic
1092247885 12:6873441-6873463 CTCCGAGGCCACGCCCCTGTGGG + Intronic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1092333303 12:7605505-7605527 TTCCCAGGCCATTCAGCTGGTGG - Intergenic
1096499482 12:52056224-52056246 CCCCCAGGCTTCTGCCCTGGAGG + Intronic
1097102778 12:56601164-56601186 CTCCAAGGTCACTCACCAGGTGG + Exonic
1100140455 12:91612535-91612557 CCACAAAGCCACTCCCCTGGGGG + Intergenic
1101722971 12:107366524-107366546 CTCCTAGCCCACTCCCCAGCAGG - Intronic
1101897511 12:108767628-108767650 CTCTGAGGCCACTGCCCTGAAGG - Intergenic
1102028624 12:109727396-109727418 CTCCCTGGCCAGTCCCCTGGAGG - Intronic
1102510742 12:113413753-113413775 CCCCCGGGACACTTCCCTGGAGG - Intronic
1103516881 12:121513960-121513982 CTTCAAGGCCCCACCCCTGGAGG - Intronic
1104270747 12:127280541-127280563 CTGCCAGGACACTCCACTGCCGG + Intergenic
1104559689 12:129832640-129832662 CTCCCAGGCCTCTGCCCGGCAGG + Intronic
1104766699 12:131334290-131334312 CTCCCAGGACATGCCTCTGGAGG - Intergenic
1104997677 12:132668722-132668744 CTCCCAGCCCTCTGCCATGGTGG - Exonic
1105204317 13:18207381-18207403 CTTCCAGGGCCCTTCCCTGGTGG - Intergenic
1105403849 13:20118342-20118364 CGCTCAGGCCAGGCCCCTGGCGG + Intergenic
1107411464 13:40162322-40162344 CTCCCAGCCCACCTCTCTGGTGG - Intergenic
1107993439 13:45838550-45838572 CCCCCAGGCCACCACGCTGGGGG + Intronic
1111586958 13:90293343-90293365 TTCCCAGGCCATTCAGCTGGTGG - Intergenic
1112299457 13:98217027-98217049 CGCCCAGGCCATTTCCCTGATGG + Intronic
1113458663 13:110466746-110466768 CACCCAGGCTACTGCCCTGCAGG + Intronic
1113750410 13:112773083-112773105 CTCACAGGCCACAGCCCTCGGGG - Intronic
1113953058 13:114082498-114082520 CTCCGAGGCTGCTCCCCGGGTGG + Intronic
1117008369 14:51445276-51445298 CTGGCAGGCGACTCTCCTGGAGG - Intergenic
1118462104 14:65996766-65996788 CTCCCAGGCCACTCTACTTTTGG + Intronic
1118645653 14:67836332-67836354 CTTCAAGACCACTCACCTGGGGG - Intronic
1119421185 14:74508911-74508933 CTCCCAGGCAGCTGCTCTGGGGG + Exonic
1119744281 14:77033263-77033285 CTCCCAGGCCCATTCCGTGGCGG + Intergenic
1121681337 14:95795071-95795093 CTCCCACCCCACTCCCCAGGAGG - Intergenic
1122549016 14:102539978-102540000 CTCTGAGGCCACTGCCCTGTGGG + Intergenic
1123153758 14:106205811-106205833 CTGCCTGGCCACTCCCCGTGAGG + Intergenic
1124381768 15:29173171-29173193 CTCCCAGGACAGTCCACTGCAGG + Intronic
1124414908 15:29466670-29466692 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1124415034 15:29466975-29466997 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1125315460 15:38426608-38426630 CTGCCAGGCCACTCACTGGGTGG - Intergenic
1125748605 15:42013799-42013821 CTCCAAGGCCATTGCCCCGGGGG + Intronic
1126547713 15:49890850-49890872 ATGCCAGGCCACTCCCATGTGGG + Intronic
1128052487 15:64676119-64676141 CTCCCGGGCCAGGCCCCTGAAGG + Exonic
1128331816 15:66761015-66761037 TTCCCAGGCCCCGCCCCTGGAGG - Intronic
1129199087 15:73988211-73988233 CTCCCAGCCCAGTCACCTGCTGG - Intronic
1129652070 15:77498085-77498107 CCCCCAGGCCCCTCCTCTGCTGG + Intergenic
1130540284 15:84817185-84817207 CTCCGAGTCCGCTCCCTTGGCGG - Exonic
1130939764 15:88497779-88497801 CTCCCTGGCCACCCCAATGGGGG + Intergenic
1131117441 15:89803808-89803830 CTACCAGGCCAGTCTCCTGATGG - Intronic
1132314874 15:100882055-100882077 CTGCCAGGCCACCCACCTGCCGG - Intronic
1132598409 16:763409-763431 CTCCCAGGCCAGTCACATGCAGG - Intronic
1132600492 16:770656-770678 CCCCCAGGCGGCTCCCCTGGTGG - Exonic
1132600513 16:770702-770724 CCCCCAGGCGGCTCCCATGGTGG - Intronic
1132600534 16:770748-770770 CCCCCAGGCAGCTTCCCTGGTGG - Intronic
1132741922 16:1418390-1418412 CTCCCAGATCGCTGCCCTGGAGG + Intergenic
1132746294 16:1437720-1437742 CTGTCAGGCCTCTACCCTGGGGG + Intronic
1132986610 16:2770711-2770733 CTTCCAGGACACGCACCTGGAGG - Exonic
1133738682 16:8635043-8635065 CACCATGGCCACGCCCCTGGAGG + Exonic
1134028961 16:10976748-10976770 CCCCCAGGCCCCTGCCCTGGAGG - Intronic
1134681812 16:16131663-16131685 CTCCCAGGCCTCAGCACTGGGGG - Intronic
1136025299 16:27464677-27464699 CCCCCAGGCCAGACCCCTGGAGG - Exonic
1136171704 16:28493958-28493980 CTCCCAGGTCACTCAGCTGATGG + Intronic
1136371170 16:29836975-29836997 CTCCCAGGGCAGTCCTCTGTGGG - Intronic
1137004072 16:35255911-35255933 TTCCCTGCCCACTGCCCTGGCGG + Intergenic
1137553872 16:49457981-49458003 CCCCAAGGCCACTTCCATGGTGG - Intergenic
1137585737 16:49663387-49663409 CCCCCAGCCCACCCCCCTCGAGG + Intronic
1138379276 16:56589248-56589270 CTGCCAGCCCACTCCCCGCGTGG - Intronic
1138681300 16:58685135-58685157 CCCCCAGCCCACTCCCTTGCAGG - Intergenic
1138763115 16:59567717-59567739 CTCTCAGGCCATCCCCCTGCCGG + Intergenic
1139650376 16:68359301-68359323 CTCACAGGCCAGCCCCTTGGAGG + Exonic
1140511199 16:75509691-75509713 CTCCTAGGTCACTGCCCTGATGG - Intergenic
1140785013 16:78332411-78332433 ATCACAGGCTACTCCGCTGGAGG - Intronic
1141686618 16:85574017-85574039 CTCCCAAGCCAGTCCCCGCGGGG - Intergenic
1141760648 16:86026533-86026555 ATCCCAGTCCACTTTCCTGGAGG + Intergenic
1142115227 16:88352907-88352929 CTCCCAGGCCTCTCCAACGGAGG - Intergenic
1142476722 17:193321-193343 CTCCTATCACACTCCCCTGGAGG + Intergenic
1142682592 17:1559104-1559126 CTTCCTGGCCCTTCCCCTGGAGG - Intronic
1142741922 17:1936543-1936565 CTCCTCGGCCAGTTCCCTGGGGG - Exonic
1143031945 17:3972875-3972897 CTCCCCTGCCCCTCCCCTGAGGG - Intergenic
1143259031 17:5584543-5584565 CCCCCTGGCCACGCCCCTTGTGG - Intronic
1143718820 17:8796156-8796178 ATTCCAGGCCCTTCCCCTGGGGG + Intergenic
1143996688 17:11012517-11012539 CTCTCAGGCCTCTCCCCTCTTGG - Intergenic
1144058190 17:11559643-11559665 CCCCTAGGCCAGTCGCCTGGAGG - Exonic
1145998055 17:29115673-29115695 CTCCCAGGCCACTCTCCTCGGGG + Exonic
1146062311 17:29613760-29613782 TTCCCAGGCCAGGGCCCTGGAGG + Exonic
1146469211 17:33110870-33110892 CTCCCCTCCCACTCCCCTGCAGG + Intronic
1146531331 17:33609948-33609970 CTCCCAGGCTGCTCACCGGGAGG - Intronic
1147044595 17:37743611-37743633 CTCCCGGGCCACTCCGCTTTAGG - Intronic
1148768069 17:50051038-50051060 CTCCCTAGACACTCCACTGGGGG - Intergenic
1149658673 17:58323530-58323552 TTTCCAGGCCACGCCCCAGGAGG - Exonic
1149999746 17:61426288-61426310 CACCCAGGCCTCTTGCCTGGAGG + Intergenic
1151668398 17:75558398-75558420 CCCCCTGGCCACTCCCAGGGTGG - Intronic
1151732254 17:75918365-75918387 CTCCCAGGCCTCTCCTCCGCCGG + Intronic
1151822935 17:76506857-76506879 CACCCTGGCTTCTCCCCTGGTGG - Intergenic
1152027675 17:77822378-77822400 GTGCCCGGCCACTTCCCTGGAGG + Intergenic
1152437404 17:80284888-80284910 CTCACAGGCCAATCCCCCAGTGG + Intronic
1152610892 17:81314566-81314588 CTCCCAGGCCACCCCGGTGCTGG - Intronic
1152615186 17:81334590-81334612 TTCCCAGGCCACAGCCCTGGGGG - Intergenic
1152956220 18:44519-44541 CTCCCAGTCCTCTCCCATGCAGG + Intergenic
1153636579 18:7117913-7117935 CACCCAGACCCCTCCCCCGGGGG + Intergenic
1154318485 18:13325416-13325438 TGCCCAGTCCACTCCCTTGGTGG + Intronic
1155819926 18:30362217-30362239 ATCACAAGCCACTCCCGTGGTGG - Intergenic
1156260112 18:35438644-35438666 CTCCCATATCACTCCCCTGCTGG + Intergenic
1156571842 18:38264494-38264516 CTCCAAGGCCACTCCTATTGGGG - Intergenic
1157575806 18:48742264-48742286 CACCCACGCCATTCCCCTGCAGG - Intronic
1160707993 19:538810-538832 CTTGCAGGCCACTTCCCAGGAGG - Intronic
1160809488 19:1007296-1007318 CTCCTCTGCCTCTCCCCTGGGGG - Intronic
1160984812 19:1833656-1833678 CTCCCGGCCCACTTCACTGGGGG + Intronic
1161194376 19:2977954-2977976 CTCCCAGGCCTCACCCTAGGAGG - Intronic
1162427228 19:10603688-10603710 CTTCCAGCCCAGTCCCCTGGAGG + Intronic
1162975543 19:14205770-14205792 CTCCCAGGCCCCTCGCCAGTGGG + Intronic
1163236058 19:16031387-16031409 CTCACAGGCCAGGCCCCTGAGGG - Intergenic
1163237571 19:16038378-16038400 CTCCCAGGCCTGGGCCCTGGAGG - Intergenic
1163252132 19:16132223-16132245 CTCCCTGGTTGCTCCCCTGGGGG - Exonic
1163297345 19:16420926-16420948 CTGCCAGGCCACTCTGCTAGAGG + Intronic
1163300377 19:16441769-16441791 CGACCAGGCCACTACCCAGGAGG + Intronic
1163386201 19:17001863-17001885 TTCCCGTGCCCCTCCCCTGGGGG - Intronic
1163591225 19:18195110-18195132 CACCCAGGGGACTCCCCAGGGGG + Intronic
1163862304 19:19748711-19748733 CTCCCAGGCCTGGGCCCTGGAGG + Intergenic
1164607891 19:29613125-29613147 CTCCAATGCCACTCCCCTCAGGG + Intronic
1165255804 19:34576765-34576787 CACCCAGGCCTGTCCCCTGCGGG - Intergenic
1165309777 19:35022999-35023021 ATGCCAGGCCACCTCCCTGGGGG - Intronic
1166126263 19:40717057-40717079 CTCCCCAGCCACACCCCTCGCGG + Intronic
1166260998 19:41640714-41640736 CTCCCAGGGCACTTCCCAGGTGG + Intronic
1166793134 19:45409607-45409629 CTCCCAGGCCAGGCTCCTGCTGG - Exonic
925601298 2:5611170-5611192 CTCCCAGTCCAGGCCCCAGGAGG + Intergenic
925922426 2:8646701-8646723 CCCACAGCCCACTGCCCTGGGGG + Intergenic
926502990 2:13678087-13678109 CTCTCTGGCCACTCCCCAGAGGG - Intergenic
927707596 2:25306445-25306467 CTGAAAGGCCACTCTCCTGGAGG + Intronic
928197257 2:29224832-29224854 CTCGCAGGCCAGGCCCCTGCAGG - Intronic
932217837 2:69978267-69978289 CCCCAAGGAGACTCCCCTGGAGG - Intergenic
933264521 2:80168122-80168144 CAGCCATGCCCCTCCCCTGGTGG - Intronic
933853733 2:86393682-86393704 GTCCTAGGCAACTCCCCTTGAGG + Intergenic
933997203 2:87678878-87678900 GTCCAAGGCCACACCACTGGTGG - Intergenic
934852008 2:97707485-97707507 CTCCCAGAGCTCTCCACTGGGGG + Intergenic
934927539 2:98392006-98392028 CTCCCGGAACACTCCCGTGGGGG - Intronic
936296648 2:111272032-111272054 GTCCAAGGCCACACCACTGGTGG + Intergenic
936748696 2:115613931-115613953 CTCCCATGCCTCTCCACAGGAGG + Intronic
937067199 2:119026335-119026357 TTGCCAGGCCTCTCCCCTGCAGG + Intergenic
937097563 2:119245619-119245641 CTCCCTGGCCACACGCCTGGTGG + Exonic
937350085 2:121155193-121155215 CCCCCAGGCCCCTCCCCAGCTGG + Intergenic
938754594 2:134368131-134368153 CTCCACTGCCACTACCCTGGAGG + Intronic
943188606 2:184646906-184646928 CTCCCTGCTCACTCCCCAGGTGG - Intronic
943624112 2:190180360-190180382 CTCCAAGGCCTCTCCCCCGCGGG - Intronic
946431909 2:219630760-219630782 CTCCCATCCCACTACCCTTGGGG + Intronic
947617572 2:231568335-231568357 CTCCCCAGCAAGTCCCCTGGAGG - Intergenic
948463049 2:238139375-238139397 CTGCCTGGCCCCTCCCCAGGAGG - Intronic
948738223 2:240025107-240025129 CTCCCAGGTCGCTCTCCGGGTGG - Intronic
948981089 2:241495231-241495253 CGGCCAGGACACTCCTCTGGGGG + Exonic
1168765949 20:381601-381623 CACCCAGGACTCTCCCCTGCGGG - Intronic
1168890593 20:1293453-1293475 CCCGCAGGCCTCTCCCCAGGTGG - Intronic
1168895229 20:1319574-1319596 ATCCCAGCCCACTCACCTGGTGG + Exonic
1169199734 20:3703082-3703104 CTTCAAGGCCACTTACCTGGAGG - Intronic
1171351868 20:24508787-24508809 CTCCCACTCCACTACCCTGCAGG + Intronic
1171414038 20:24965522-24965544 GTGCCAGGCCACTCCCCTGCAGG - Intronic
1171452954 20:25248557-25248579 CTTCCAGGCGACTCCCCAGTCGG - Intronic
1173106876 20:40145097-40145119 CTCCTTGGCCAATCTCCTGGGGG + Intergenic
1174421052 20:50399414-50399436 CTCCCAGCACAGTCTCCTGGGGG + Intergenic
1174582133 20:51579508-51579530 TTCCCAGGCCCCTCTCCTGAAGG + Intergenic
1175791144 20:61740606-61740628 CTTCCAGGCCTCTCTCCAGGAGG + Intronic
1175825490 20:61934370-61934392 TGCCCAGGCCACCCCGCTGGAGG - Intronic
1176059663 20:63167021-63167043 GCACCCGGCCACTCCCCTGGAGG + Intergenic
1176200416 20:63857906-63857928 ATCCCAGTACACACCCCTGGGGG - Intergenic
1176222596 20:63977142-63977164 CTGCCACGCCCCTCCCCTGCAGG - Exonic
1176248874 20:64110546-64110568 CTCCCTGGCCCCTGCCCTAGGGG - Intergenic
1176713661 21:10330705-10330727 CTTCCAGGGCCCTTCCCTGGTGG + Intergenic
1179250414 21:39667089-39667111 CCCCGAGGCCACCTCCCTGGAGG + Exonic
1179820955 21:43936455-43936477 CTCCCAGGCCATTCTTCCGGAGG - Intronic
1180830610 22:18904081-18904103 CGCTCAGGCCACTGCCGTGGAGG - Intergenic
1180945181 22:19688715-19688737 CTCCAAGGCCATTGCTCTGGGGG - Intergenic
1180954212 22:19734271-19734293 CCCCCAGGCTACCCTCCTGGAGG - Intergenic
1181051588 22:20240613-20240635 CTCCCCAGCCACTGCCCTGGCGG + Intergenic
1181069070 22:20321203-20321225 CGCTCAGGCCACTGCCGTGGAGG + Intergenic
1181322918 22:22022588-22022610 CTCCCAGGGCCCTCCCAAGGCGG + Intergenic
1181358678 22:22318518-22318540 CTCCCAGGGCCCTCCCGAGGGGG + Intergenic
1181390880 22:22579894-22579916 CCCCAAGGCCCCTTCCCTGGAGG - Intergenic
1181391779 22:22588265-22588287 CCCCAAGGCCATTTCCCTGGAGG - Intergenic
1181428062 22:22856641-22856663 CCCCGAGGCCCCTTCCCTGGAGG - Intronic
1181441732 22:22939550-22939572 ATCTCAACCCACTCCCCTGGGGG + Intergenic
1182368789 22:29796629-29796651 GTCACAGGCCCCTTCCCTGGTGG - Intronic
1182505706 22:30780879-30780901 CTCCCTGGTCACCCCACTGGAGG - Intronic
1182663864 22:31943865-31943887 CACCCAGTCCCCTCCTCTGGTGG + Intronic
1183199255 22:36374670-36374692 CTCCCAGGTCACTCACCTTGGGG - Intronic
1183490566 22:38113448-38113470 CCCCCAGGCCACTTCCCTCAGGG - Intronic
1183714485 22:39525768-39525790 ATCCCAGCCCAGTCCCCTGCCGG - Intergenic
1183895791 22:40967709-40967731 CACCCATGCCACTACCCTGTGGG + Intronic
1183932912 22:41246328-41246350 CTCACAGCCCTTTCCCCTGGGGG + Exonic
1184206546 22:43007607-43007629 CTCCCAAGTCACTTCCCTGAAGG + Intronic
1184640426 22:45867377-45867399 CGCCCAGGCCGCTCCCGTCGCGG + Intergenic
1184649342 22:45912564-45912586 CCCACAGGCCCCTCTCCTGGGGG - Intergenic
1184697398 22:46147693-46147715 CTCAGAGGCCACTGCCCTGGCGG + Intergenic
1185066312 22:48633281-48633303 CTCCCAGGCCACAGCCATGCTGG - Intronic
1185164538 22:49253154-49253176 CTCCAGGGCCACTGCCATGGAGG - Intergenic
1185335639 22:50269911-50269933 CTCCCAGGCCTCAGGCCTGGTGG + Intronic
1203280700 22_KI270734v1_random:129352-129374 CGCTCAGGCCACTGCCGTGGAGG - Intergenic
950054064 3:10011399-10011421 CTCCTGGGCCACTTCCCTGCGGG + Intergenic
950417451 3:12876475-12876497 CTCCCGGGCCACTTCCCCGTGGG + Intergenic
950435955 3:12980226-12980248 CCTCCAGGCCACTCAGCTGGTGG + Intronic
950532884 3:13563267-13563289 CACCCAGGTCTCTCACCTGGAGG + Intronic
950885044 3:16355708-16355730 CTGCCAGGCCCCACCCCCGGAGG + Intronic
950892108 3:16413322-16413344 CAACCAGGCCACAGCCCTGGAGG - Intronic
951133677 3:19077977-19077999 CTCCCTGGCCACTGCCCCTGTGG + Intergenic
952942426 3:38454502-38454524 CCCCCAGCCCACGCCCCCGGAGG - Intronic
953719368 3:45341871-45341893 GCCCCAGGTCACTGCCCTGGAGG + Intergenic
955412457 3:58664737-58664759 TCCCCAGGCCACACCCTTGGGGG + Intronic
956835761 3:73094991-73095013 CTCCCAGTCCAGTCCCCTGAAGG - Intergenic
960742960 3:120855253-120855275 CGCCCAGGCCTGTCCCTTGGAGG - Intergenic
961135668 3:124508284-124508306 CTCCCTGGTCACAACCCTGGAGG + Intronic
961565492 3:127760638-127760660 CCCCAGGGCCACTCGCCTGGGGG + Intronic
961808588 3:129507376-129507398 CTCCCAGATTATTCCCCTGGGGG - Intronic
962876905 3:139542079-139542101 CTCCCAGGCACAGCCCCTGGTGG + Intergenic
963233750 3:142935595-142935617 CTCCCAGGCCACACAGCAGGAGG + Intergenic
967630494 3:191739158-191739180 TTCCCAGGCCATTCAGCTGGTGG + Intergenic
968358112 3:198123722-198123744 CTCCCAGTCCTCTCCCATGCAGG - Intergenic
968580029 4:1385514-1385536 CTGCGAGGCCGCTCCCCGGGAGG + Intronic
968742615 4:2339189-2339211 CTCCAAAGCCCTTCCCCTGGAGG + Intronic
968750954 4:2388808-2388830 CACCCAGACCCCTCCCCTGCTGG + Intronic
968886965 4:3340294-3340316 GTCCCATGGCAGTCCCCTGGGGG + Intronic
968917419 4:3502629-3502651 CTCCCCGGGCACTCTGCTGGAGG - Intergenic
969007880 4:4036356-4036378 CTGCCTGGCCACTCCCCCTGAGG + Intergenic
969583239 4:8077555-8077577 CTCCCAGTCAACTCCCAGGGGGG + Intronic
969681299 4:8644875-8644897 CTCCTGGGCCTCTCCCCTTGTGG + Intergenic
969843509 4:9901145-9901167 CTCCCAACCCAAACCCCTGGGGG - Intronic
970349118 4:15183384-15183406 TTCCCAGGCCACTCACATGGGGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972284024 4:37631157-37631179 CACACAGGCCAAGCCCCTGGAGG + Intronic
975730563 4:77333661-77333683 CTCCCAGGCCATCCAGCTGGTGG + Intronic
976203928 4:82606727-82606749 CTCCCGAGGCACTGCCCTGGAGG - Intergenic
977204301 4:94152694-94152716 CTCACAACCCACTCCCCTGTGGG + Intergenic
978340304 4:107715423-107715445 CACCCAGGCCAATCCTCTGAAGG + Intronic
979649046 4:123107902-123107924 CTCCCTGGCCACTCCGATTGTGG - Intronic
980510117 4:133774088-133774110 CTCCCTAATCACTCCCCTGGGGG + Intergenic
980522043 4:133948005-133948027 CTCCCAGGCCATTCAGCTGGTGG + Intergenic
980820308 4:138007757-138007779 CTCCCAAACCTCTCCCCTTGTGG - Intergenic
985283653 4:188312210-188312232 CACTCAGGCCCCTCACCTGGAGG - Intergenic
985773213 5:1825732-1825754 CGCCCTGGCCACTCCCCAGGTGG - Intergenic
986177669 5:5365583-5365605 CTCCAAGGCCTCTCCCCAGCAGG - Intergenic
997615252 5:135241785-135241807 CTCCCTGGTCACTTTCCTGGTGG + Intronic
998366684 5:141636928-141636950 CACCCAGGCCACGCCCCCAGGGG + Intronic
999126614 5:149250685-149250707 TTCCCAAGCCCCTCCCATGGGGG - Intronic
1001617719 5:173056507-173056529 CCCCCAGCCCAGGCCCCTGGGGG - Intronic
1001998203 5:176179052-176179074 CTCCCACCCATCTCCCCTGGTGG - Intergenic
1002349140 5:178570723-178570745 CAGCCTGGCCACTCCCCAGGTGG - Intronic
1002490401 5:179572197-179572219 CTTCAAGGCCATTGCCCTGGTGG + Intronic
1002792815 6:448133-448155 CCTCCAGGCCACTGCCATGGAGG + Intergenic
1004444562 6:15686158-15686180 CTCCTAGGCCATCCCGCTGGAGG - Intergenic
1005840084 6:29738662-29738684 CTGCCAGGCCTCTTCCATGGGGG - Intergenic
1005854268 6:29848673-29848695 CTGCCAGGCCTCTTCCATGGGGG - Intergenic
1006297044 6:33174299-33174321 CTCCCTGGCCACTGCCTTTGTGG - Intronic
1006423041 6:33947444-33947466 CTCCCAGCCCAGTCCCCTCAGGG - Intergenic
1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG + Intronic
1007122662 6:39396340-39396362 CCCCCATGCCACTCCCATGGAGG - Intronic
1007285030 6:40741443-40741465 CTCCCAGGCCACTCCTGCTGTGG - Intergenic
1007783519 6:44267376-44267398 TTCCCAGGCCTTTCCCCTCGTGG - Intergenic
1017036273 6:150270049-150270071 CTCACTGGCCACCCCCCTGCAGG - Intergenic
1017175018 6:151494315-151494337 GTCCCAGGCCACAGCCCTCGCGG - Intronic
1017446673 6:154512210-154512232 CTCCCATTCAACTCCCCTAGAGG + Intergenic
1018876743 6:167827496-167827518 CTCTCCGGCCGCTCACCTGGTGG + Intronic
1019180799 6:170186420-170186442 CTGTCTGGCCACACCCCTGGGGG + Intergenic
1019326160 7:439308-439330 CTCCCAGCCTGCTCCCCTGCGGG + Intergenic
1019392180 7:794781-794803 GTCCCGGGCCACGCCTCTGGAGG - Intergenic
1019494219 7:1330069-1330091 ATCCCAGGCCCCTGCCCTGGGGG + Intergenic
1019610811 7:1935837-1935859 CTGCCAGCCCCCTCCCTTGGGGG - Intronic
1019922562 7:4172219-4172241 CCCCCAGGCCACTGCCATGCAGG - Intronic
1020328400 7:6994487-6994509 CTGCCTGGCCACTCCCCTTGAGG + Intergenic
1021903897 7:25314397-25314419 CTCCCAACACACTCCCCTGCTGG - Intergenic
1022018452 7:26376237-26376259 CGCCCGGGCCGCTCCGCTGGCGG + Intergenic
1022106503 7:27200761-27200783 GTCCCAGGACATTCCACTGGAGG + Intergenic
1023805363 7:43869278-43869300 CCCCCAGGCCCCTGCCCCGGCGG + Intronic
1023883335 7:44334079-44334101 CTGCCAGGCCAGTCCCCTGCGGG - Intronic
1026959978 7:74401586-74401608 CTCCCAGGTCCCTCCCGTGCAGG + Intronic
1028793457 7:94878691-94878713 CTCTCTGGCCACTCCCCTAAGGG - Intergenic
1029180955 7:98701486-98701508 CTAGCAGGCCACATCCCTGGAGG - Intergenic
1029259066 7:99289166-99289188 CTCCCAGGCTACCTGCCTGGAGG - Intergenic
1029424638 7:100488262-100488284 CCCCCAGGCCCCTCTCCTCGAGG + Exonic
1029465073 7:100720440-100720462 CTCCCGGACACCTCCCCTGGGGG - Intergenic
1032583930 7:133129336-133129358 CTCCTAAGCCACTCCAGTGGTGG + Intergenic
1033894186 7:146052012-146052034 TTCCCAGGCCACTAGGCTGGTGG + Intergenic
1034405000 7:150897188-150897210 ATCCCTGGCCACACCCCTTGGGG + Intergenic
1035382766 7:158450256-158450278 CTCCCAGCACCATCCCCTGGGGG + Intronic
1035913351 8:3593415-3593437 TTCCTAGGCCTCTGCCCTGGAGG - Intronic
1036824192 8:11963685-11963707 CTCCCTGGACACTCAGCTGGGGG + Intergenic
1037584204 8:20265301-20265323 CTGCCATGCCGCTACCCTGGGGG - Intronic
1037709954 8:21347633-21347655 CCCCCATGTCCCTCCCCTGGGGG - Intergenic
1037768184 8:21784464-21784486 CTCTCAGGCCATCCCCCGGGAGG + Intronic
1037855563 8:22368338-22368360 CTCCCAGGCCACTCCTCAGCAGG - Intronic
1037885505 8:22594098-22594120 TTGCCAGGCCTCTCCCCTGCAGG + Exonic
1038583206 8:28768063-28768085 CTCTCATGCCACTCCTCAGGTGG + Exonic
1040983904 8:53272330-53272352 ATCTCTGGCCACTTCCCTGGGGG + Intergenic
1041148687 8:54908424-54908446 CTCAAAGACCACTCCCATGGTGG + Intergenic
1041187219 8:55313734-55313756 CTCCCAGGCCAAATCACTGGAGG - Intronic
1043116051 8:76255177-76255199 CTACCAGAACATTCCCCTGGAGG + Intergenic
1044707741 8:95024937-95024959 CGCCCCGGCCACGCCCCTGCAGG - Intronic
1048461212 8:134623298-134623320 ATCCCTGGACACTCCCCTGTGGG + Intronic
1048774563 8:137931720-137931742 CTGCCAGGACACTCCAGTGGAGG - Intergenic
1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG + Intronic
1049641506 8:143718070-143718092 GGCCCAGGCCACTCACCTGGAGG - Exonic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1050982293 9:12035855-12035877 CCCCCAGCCAACTCCCCAGGGGG + Intergenic
1051666358 9:19470277-19470299 CACCCTGGCCACATCCCTGGAGG + Intergenic
1053069622 9:35093407-35093429 ATCCCAGGCCTCACCTCTGGTGG + Exonic
1054860586 9:69948869-69948891 GTCCCATGCCACTCTCCTAGTGG - Intergenic
1056808339 9:89745537-89745559 ACACCAGTCCACTCCCCTGGGGG + Intergenic
1057123953 9:92601670-92601692 CTCCCAGCCCACTCCTCTGTGGG - Intronic
1057170578 9:92960874-92960896 CCCCCGGGCCTCTCTCCTGGTGG + Intronic
1057170610 9:92960972-92960994 CTTCCAGGCCTCTCTCCTAGTGG + Intronic
1057503751 9:95616140-95616162 CTCCCCAGCCACTCCCCTCAGGG - Intergenic
1059339252 9:113588131-113588153 TGCCCAGGCCAGTCCCCTGCAGG - Intronic
1059419708 9:114183309-114183331 CTCTCTGCCCACTCCCCTGAAGG - Intronic
1059465314 9:114465703-114465725 GTCCCAGGCCACACAACTGGTGG - Intronic
1059492034 9:114675986-114676008 CTCCCACAGCACTCCCCTGCTGG + Intergenic
1060524403 9:124312349-124312371 CTCCCAGGCACCCCCCCAGGGGG - Intronic
1061101045 9:128492605-128492627 CTACCAGGCCACTCCCAGGGAGG + Intronic
1061818411 9:133209286-133209308 CTCCCAGGACACTGGCCAGGGGG - Intergenic
1061933778 9:133846482-133846504 CTCAGAGGCCACTGCCCTGCTGG + Intronic
1062035231 9:134379939-134379961 CTCCCAGCCTGCTCCCCTGGGGG + Intronic
1062110325 9:134778701-134778723 GTCCCAGGCCTCTCCACTAGTGG + Intronic
1062235657 9:135506464-135506486 CTGCCAGGCCCATCCTCTGGTGG - Intergenic
1062242040 9:135546072-135546094 CTCCCAGGACACTGGCCAGGGGG + Intergenic
1062741982 9:138180257-138180279 CTCCCAGTCCTCTCCCATGCAGG - Intergenic
1187446352 X:19364460-19364482 CTCTCAGTCCATTCTCCTGGAGG + Intronic
1188251240 X:27897567-27897589 TTCCCAGACCACTCTCCTGTAGG - Intergenic
1189669406 X:43392053-43392075 CTCCCAGGCCACTGCTCTTTGGG + Intergenic
1189915400 X:45851268-45851290 CTTCCAGGCCACTGCGCTTGGGG - Intergenic
1191169145 X:57423385-57423407 CTCCCAGGCCACATCCATGCTGG - Intronic
1192550849 X:72052475-72052497 CTCCCAGGCAACTCCCAGGGCGG - Intergenic
1192924478 X:75741124-75741146 CTCCCAGGGCCCACCCTTGGCGG - Intergenic
1193376424 X:80767032-80767054 CTGCCAGGCCACTGCCTTGCAGG - Intronic
1195343721 X:103928177-103928199 CTCCCAGGCCTATGCCCTTGGGG + Intronic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262813 X:124334798-124334820 GCCCCAGGGCACTCCCCTGGGGG + Intronic
1199685977 X:150266050-150266072 CTCCCAGCCCAGTCAGCTGGAGG - Intergenic
1199779379 X:151044359-151044381 CTCCTGGGCAACTCCTCTGGGGG + Intergenic
1200078441 X:153563711-153563733 CTCCCAGGCCACTGGCCTTCTGG + Intronic