ID: 1083272915

View in Genome Browser
Species Human (GRCh38)
Location 11:61580993-61581015
Sequence TGCTCCGCGGGCGGGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083272915_1083272927 20 Left 1083272915 11:61580993-61581015 CCCTCCCGCCCGCCCGCGGAGCA 0: 1
1: 0
2: 1
3: 27
4: 205
Right 1083272927 11:61581036-61581058 AGCGCCGAGCCGCCTCCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083272915 Original CRISPR TGCTCCGCGGGCGGGCGGGA GGG (reversed) Intronic