ID: 1083272972

View in Genome Browser
Species Human (GRCh38)
Location 11:61581247-61581269
Sequence GCCGCCCGAAGCCGCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083272960_1083272972 23 Left 1083272960 11:61581201-61581223 CCTGCGCCCGCTGCCGGCCGCGC No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data
1083272963_1083272972 10 Left 1083272963 11:61581214-61581236 CCGGCCGCGCGCCGCACTGCACC No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data
1083272965_1083272972 -1 Left 1083272965 11:61581225-61581247 CCGCACTGCACCCGCGCCCGCCG No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data
1083272961_1083272972 17 Left 1083272961 11:61581207-61581229 CCCGCTGCCGGCCGCGCGCCGCA No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data
1083272964_1083272972 6 Left 1083272964 11:61581218-61581240 CCGCGCGCCGCACTGCACCCGCG No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data
1083272957_1083272972 29 Left 1083272957 11:61581195-61581217 CCACCGCCTGCGCCCGCTGCCGG No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data
1083272959_1083272972 26 Left 1083272959 11:61581198-61581220 CCGCCTGCGCCCGCTGCCGGCCG No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data
1083272962_1083272972 16 Left 1083272962 11:61581208-61581230 CCGCTGCCGGCCGCGCGCCGCAC No data
Right 1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083272972 Original CRISPR GCCGCCCGAAGCCGCCCCGA GGG Intergenic
No off target data available for this crispr