ID: 1083274162

View in Genome Browser
Species Human (GRCh38)
Location 11:61587571-61587593
Sequence GCCCGCGCTCCTGGTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274147_1083274162 27 Left 1083274147 11:61587521-61587543 CCAACCCAAGACCTGCTCCAGCA No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274146_1083274162 30 Left 1083274146 11:61587518-61587540 CCACCAACCCAAGACCTGCTCCA No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274153_1083274162 2 Left 1083274153 11:61587546-61587568 CCCACCCCAGCCAGCACCACTCG No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274156_1083274162 -3 Left 1083274156 11:61587551-61587573 CCCAGCCAGCACCACTCGCCGCC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274149_1083274162 22 Left 1083274149 11:61587526-61587548 CCAAGACCTGCTCCAGCAGCCCC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274154_1083274162 1 Left 1083274154 11:61587547-61587569 CCACCCCAGCCAGCACCACTCGC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274148_1083274162 23 Left 1083274148 11:61587525-61587547 CCCAAGACCTGCTCCAGCAGCCC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274151_1083274162 10 Left 1083274151 11:61587538-61587560 CCAGCAGCCCCACCCCAGCCAGC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274150_1083274162 16 Left 1083274150 11:61587532-61587554 CCTGCTCCAGCAGCCCCACCCCA No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274157_1083274162 -4 Left 1083274157 11:61587552-61587574 CCAGCCAGCACCACTCGCCGCCC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274155_1083274162 -2 Left 1083274155 11:61587550-61587572 CCCCAGCCAGCACCACTCGCCGC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274158_1083274162 -8 Left 1083274158 11:61587556-61587578 CCAGCACCACTCGCCGCCCGCGC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data
1083274152_1083274162 3 Left 1083274152 11:61587545-61587567 CCCCACCCCAGCCAGCACCACTC No data
Right 1083274162 11:61587571-61587593 GCCCGCGCTCCTGGTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274162 Original CRISPR GCCCGCGCTCCTGGTCCTCC AGG Intergenic
No off target data available for this crispr