ID: 1083274268

View in Genome Browser
Species Human (GRCh38)
Location 11:61587957-61587979
Sequence GGGGCCTCAATCCTGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274268_1083274284 16 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274268_1083274286 20 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274286 11:61588000-61588022 TTGAAGACCTTAGTGGGGGTGGG No data
1083274268_1083274285 19 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274285 11:61587999-61588021 GTTGAAGACCTTAGTGGGGGTGG No data
1083274268_1083274282 14 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274282 11:61587994-61588016 CTGGAGTTGAAGACCTTAGTGGG No data
1083274268_1083274281 13 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274281 11:61587993-61588015 ACTGGAGTTGAAGACCTTAGTGG No data
1083274268_1083274283 15 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274283 11:61587995-61588017 TGGAGTTGAAGACCTTAGTGGGG No data
1083274268_1083274287 21 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274287 11:61588001-61588023 TGAAGACCTTAGTGGGGGTGGGG No data
1083274268_1083274273 -5 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274273 11:61587975-61587997 GCCCCACCCTCTGCCCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274268 Original CRISPR GGGGCCTCAATCCTGGGGTT GGG (reversed) Intergenic
No off target data available for this crispr