ID: 1083274273

View in Genome Browser
Species Human (GRCh38)
Location 11:61587975-61587997
Sequence GCCCCACCCTCTGCCCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274268_1083274273 -5 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274273 11:61587975-61587997 GCCCCACCCTCTGCCCTAACTGG No data
1083274269_1083274273 -6 Left 1083274269 11:61587958-61587980 CCAACCCCAGGATTGAGGCCCCA No data
Right 1083274273 11:61587975-61587997 GCCCCACCCTCTGCCCTAACTGG No data
1083274267_1083274273 -4 Left 1083274267 11:61587956-61587978 CCCCAACCCCAGGATTGAGGCCC No data
Right 1083274273 11:61587975-61587997 GCCCCACCCTCTGCCCTAACTGG No data
1083274270_1083274273 -10 Left 1083274270 11:61587962-61587984 CCCCAGGATTGAGGCCCCACCCT No data
Right 1083274273 11:61587975-61587997 GCCCCACCCTCTGCCCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274273 Original CRISPR GCCCCACCCTCTGCCCTAAC TGG Intergenic
No off target data available for this crispr