ID: 1083274277

View in Genome Browser
Species Human (GRCh38)
Location 11:61587981-61588003
Sequence TCAACTCCAGTTAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274277_1083274293 20 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274277_1083274285 -5 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274285 11:61587999-61588021 GTTGAAGACCTTAGTGGGGGTGG No data
1083274277_1083274284 -8 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274277_1083274290 15 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274290 11:61588019-61588041 TGGGGCCTATCCCTCGCAGGTGG No data
1083274277_1083274286 -4 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274286 11:61588000-61588022 TTGAAGACCTTAGTGGGGGTGGG No data
1083274277_1083274287 -3 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274287 11:61588001-61588023 TGAAGACCTTAGTGGGGGTGGGG No data
1083274277_1083274282 -10 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274282 11:61587994-61588016 CTGGAGTTGAAGACCTTAGTGGG No data
1083274277_1083274291 19 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274291 11:61588023-61588045 GCCTATCCCTCGCAGGTGGAAGG No data
1083274277_1083274289 12 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274277_1083274283 -9 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274283 11:61587995-61588017 TGGAGTTGAAGACCTTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274277 Original CRISPR TCAACTCCAGTTAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr