ID: 1083274278

View in Genome Browser
Species Human (GRCh38)
Location 11:61587982-61588004
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274278_1083274290 14 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274290 11:61588019-61588041 TGGGGCCTATCCCTCGCAGGTGG No data
1083274278_1083274283 -10 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274283 11:61587995-61588017 TGGAGTTGAAGACCTTAGTGGGG No data
1083274278_1083274287 -4 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274287 11:61588001-61588023 TGAAGACCTTAGTGGGGGTGGGG No data
1083274278_1083274291 18 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274291 11:61588023-61588045 GCCTATCCCTCGCAGGTGGAAGG No data
1083274278_1083274286 -5 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274286 11:61588000-61588022 TTGAAGACCTTAGTGGGGGTGGG No data
1083274278_1083274293 19 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274278_1083274285 -6 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274285 11:61587999-61588021 GTTGAAGACCTTAGTGGGGGTGG No data
1083274278_1083274289 11 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274278_1083274284 -9 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274278 Original CRISPR TTCAACTCCAGTTAGGGCAG AGG (reversed) Intergenic