ID: 1083274279

View in Genome Browser
Species Human (GRCh38)
Location 11:61587988-61588010
Sequence AAGGTCTTCAACTCCAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274279_1083274290 8 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274290 11:61588019-61588041 TGGGGCCTATCCCTCGCAGGTGG No data
1083274279_1083274297 27 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274297 11:61588038-61588060 GTGGAAGGGTGATCTGCACCGGG No data
1083274279_1083274296 26 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274296 11:61588037-61588059 GGTGGAAGGGTGATCTGCACCGG No data
1083274279_1083274287 -10 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274287 11:61588001-61588023 TGAAGACCTTAGTGGGGGTGGGG No data
1083274279_1083274289 5 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274279_1083274291 12 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274291 11:61588023-61588045 GCCTATCCCTCGCAGGTGGAAGG No data
1083274279_1083274293 13 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274279 Original CRISPR AAGGTCTTCAACTCCAGTTA GGG (reversed) Intergenic
No off target data available for this crispr