ID: 1083274284

View in Genome Browser
Species Human (GRCh38)
Location 11:61587996-61588018
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274272_1083274284 9 Left 1083274272 11:61587964-61587986 CCAGGATTGAGGCCCCACCCTCT No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274269_1083274284 15 Left 1083274269 11:61587958-61587980 CCAACCCCAGGATTGAGGCCCCA No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274271_1083274284 10 Left 1083274271 11:61587963-61587985 CCCAGGATTGAGGCCCCACCCTC No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274267_1083274284 17 Left 1083274267 11:61587956-61587978 CCCCAACCCCAGGATTGAGGCCC No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274276_1083274284 -5 Left 1083274276 11:61587978-61588000 CCACCCTCTGCCCTAACTGGAGT No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274270_1083274284 11 Left 1083274270 11:61587962-61587984 CCCCAGGATTGAGGCCCCACCCT No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274275_1083274284 -4 Left 1083274275 11:61587977-61587999 CCCACCCTCTGCCCTAACTGGAG No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274278_1083274284 -9 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274268_1083274284 16 Left 1083274268 11:61587957-61587979 CCCAACCCCAGGATTGAGGCCCC No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274277_1083274284 -8 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data
1083274274_1083274284 -3 Left 1083274274 11:61587976-61587998 CCCCACCCTCTGCCCTAACTGGA No data
Right 1083274284 11:61587996-61588018 GGAGTTGAAGACCTTAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274284 Original CRISPR GGAGTTGAAGACCTTAGTGG GGG Intergenic