ID: 1083274289

View in Genome Browser
Species Human (GRCh38)
Location 11:61588016-61588038
Sequence GGGTGGGGCCTATCCCTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274272_1083274289 29 Left 1083274272 11:61587964-61587986 CCAGGATTGAGGCCCCACCCTCT No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274276_1083274289 15 Left 1083274276 11:61587978-61588000 CCACCCTCTGCCCTAACTGGAGT No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274271_1083274289 30 Left 1083274271 11:61587963-61587985 CCCAGGATTGAGGCCCCACCCTC No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274274_1083274289 17 Left 1083274274 11:61587976-61587998 CCCCACCCTCTGCCCTAACTGGA No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274280_1083274289 4 Left 1083274280 11:61587989-61588011 CCTAACTGGAGTTGAAGACCTTA No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274275_1083274289 16 Left 1083274275 11:61587977-61587999 CCCACCCTCTGCCCTAACTGGAG No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274279_1083274289 5 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274278_1083274289 11 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data
1083274277_1083274289 12 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274289 11:61588016-61588038 GGGTGGGGCCTATCCCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274289 Original CRISPR GGGTGGGGCCTATCCCTCGC AGG Intergenic