ID: 1083274293

View in Genome Browser
Species Human (GRCh38)
Location 11:61588024-61588046
Sequence CCTATCCCTCGCAGGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274279_1083274293 13 Left 1083274279 11:61587988-61588010 CCCTAACTGGAGTTGAAGACCTT No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274277_1083274293 20 Left 1083274277 11:61587981-61588003 CCCTCTGCCCTAACTGGAGTTGA No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274274_1083274293 25 Left 1083274274 11:61587976-61587998 CCCCACCCTCTGCCCTAACTGGA No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274280_1083274293 12 Left 1083274280 11:61587989-61588011 CCTAACTGGAGTTGAAGACCTTA No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274278_1083274293 19 Left 1083274278 11:61587982-61588004 CCTCTGCCCTAACTGGAGTTGAA No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274275_1083274293 24 Left 1083274275 11:61587977-61587999 CCCACCCTCTGCCCTAACTGGAG No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274288_1083274293 -6 Left 1083274288 11:61588007-61588029 CCTTAGTGGGGGTGGGGCCTATC No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data
1083274276_1083274293 23 Left 1083274276 11:61587978-61588000 CCACCCTCTGCCCTAACTGGAGT No data
Right 1083274293 11:61588024-61588046 CCTATCCCTCGCAGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274293 Original CRISPR CCTATCCCTCGCAGGTGGAA GGG Intergenic