ID: 1083274442

View in Genome Browser
Species Human (GRCh38)
Location 11:61588668-61588690
Sequence AATGAAGCAGCCACGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083274442_1083274448 15 Left 1083274442 11:61588668-61588690 CCCAGCTCCGTGGCTGCTTCATT No data
Right 1083274448 11:61588706-61588728 GCTCCCACCCCTCCCAACGGTGG No data
1083274442_1083274457 28 Left 1083274442 11:61588668-61588690 CCCAGCTCCGTGGCTGCTTCATT No data
Right 1083274457 11:61588719-61588741 CCAACGGTGGGCGTACCCCAAGG No data
1083274442_1083274447 12 Left 1083274442 11:61588668-61588690 CCCAGCTCCGTGGCTGCTTCATT No data
Right 1083274447 11:61588703-61588725 CCTGCTCCCACCCCTCCCAACGG No data
1083274442_1083274449 16 Left 1083274442 11:61588668-61588690 CCCAGCTCCGTGGCTGCTTCATT No data
Right 1083274449 11:61588707-61588729 CTCCCACCCCTCCCAACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083274442 Original CRISPR AATGAAGCAGCCACGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr