ID: 1083279814

View in Genome Browser
Species Human (GRCh38)
Location 11:61620018-61620040
Sequence CCTTGAGACGGGTTTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083279814_1083279825 15 Left 1083279814 11:61620018-61620040 CCTCTTCCAAACCCGTCTCAAGG No data
Right 1083279825 11:61620056-61620078 AAGCCCTCCTGGCTGTCTCCAGG No data
1083279814_1083279819 -8 Left 1083279814 11:61620018-61620040 CCTCTTCCAAACCCGTCTCAAGG No data
Right 1083279819 11:61620033-61620055 TCTCAAGGTCCACCACCTCCAGG No data
1083279814_1083279822 4 Left 1083279814 11:61620018-61620040 CCTCTTCCAAACCCGTCTCAAGG No data
Right 1083279822 11:61620045-61620067 CCACCTCCAGGAAGCCCTCCTGG No data
1083279814_1083279826 16 Left 1083279814 11:61620018-61620040 CCTCTTCCAAACCCGTCTCAAGG No data
Right 1083279826 11:61620057-61620079 AGCCCTCCTGGCTGTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083279814 Original CRISPR CCTTGAGACGGGTTTGGAAG AGG (reversed) Intergenic