ID: 1083291246

View in Genome Browser
Species Human (GRCh38)
Location 11:61691490-61691512
Sequence CTGCAGACACAGTTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083291246_1083291255 21 Left 1083291246 11:61691490-61691512 CCTGCCTCCAACTGTGTCTGCAG 0: 1
1: 0
2: 1
3: 30
4: 303
Right 1083291255 11:61691534-61691556 GGACCCCCCCCAACCCAACCTGG 0: 1
1: 0
2: 0
3: 18
4: 221
1083291246_1083291251 -1 Left 1083291246 11:61691490-61691512 CCTGCCTCCAACTGTGTCTGCAG 0: 1
1: 0
2: 1
3: 30
4: 303
Right 1083291251 11:61691512-61691534 GAGCCTGCAGCCTTTGGAGGTGG 0: 1
1: 0
2: 4
3: 28
4: 286
1083291246_1083291250 -4 Left 1083291246 11:61691490-61691512 CCTGCCTCCAACTGTGTCTGCAG 0: 1
1: 0
2: 1
3: 30
4: 303
Right 1083291250 11:61691509-61691531 GCAGAGCCTGCAGCCTTTGGAGG 0: 1
1: 0
2: 2
3: 34
4: 310
1083291246_1083291252 0 Left 1083291246 11:61691490-61691512 CCTGCCTCCAACTGTGTCTGCAG 0: 1
1: 0
2: 1
3: 30
4: 303
Right 1083291252 11:61691513-61691535 AGCCTGCAGCCTTTGGAGGTGGG 0: 1
1: 0
2: 2
3: 25
4: 260
1083291246_1083291249 -7 Left 1083291246 11:61691490-61691512 CCTGCCTCCAACTGTGTCTGCAG 0: 1
1: 0
2: 1
3: 30
4: 303
Right 1083291249 11:61691506-61691528 TCTGCAGAGCCTGCAGCCTTTGG 0: 1
1: 0
2: 3
3: 40
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083291246 Original CRISPR CTGCAGACACAGTTGGAGGC AGG (reversed) Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901012192 1:6208205-6208227 CTGGAGTCACACTTGGGGGCGGG - Intronic
905925502 1:41746700-41746722 CAGCAGACACTGTTGGAGCTTGG + Intronic
906521522 1:46469636-46469658 CTACACACACACTTGGAGACTGG - Intergenic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
909024695 1:70468495-70468517 CTGCACACACAGTTGCCAGCAGG + Intergenic
909803162 1:79840090-79840112 CTGCAGAAACAGGTGTAGCCAGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
913232715 1:116755155-116755177 CTGAAGACAGAGTTGTAGGCAGG - Intronic
913366799 1:118048012-118048034 CTGCAGAGTCAGGTGCAGGCTGG + Intronic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914506904 1:148297249-148297271 CTGCAGATACAGTAGGAAGATGG - Intergenic
916084917 1:161261464-161261486 CTGCATTCACAGCTGCAGGCGGG + Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917567757 1:176230184-176230206 CTGCACACACAGTTGCCAGCAGG + Intergenic
918070437 1:181130257-181130279 CTGCAGGGACATTTTGAGGCAGG - Intergenic
919002729 1:191854217-191854239 CTGCATACAAAATTGGAGGACGG - Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
919766027 1:201127805-201127827 CTGCAGTCCCTGGTGGAGGCTGG - Intergenic
919826950 1:201509849-201509871 CAGCAGACAAAGTTGGAAGCTGG - Intergenic
920188662 1:204178539-204178561 CTGCATACATGGTGGGAGGCAGG - Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
923966133 1:239140983-239141005 CGGAAGCCACAGGTGGAGGCAGG - Intergenic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1064553191 10:16522203-16522225 CAGCAGCCCCAGTTGGAGGGTGG + Intergenic
1069714780 10:70513810-70513832 GAGCAGACCCACTTGGAGGCAGG + Intronic
1069906369 10:71734842-71734864 CAGAGGACAGAGTTGGAGGCAGG - Intronic
1071501283 10:86206046-86206068 ATGCTGGCACAGATGGAGGCTGG - Intronic
1071957407 10:90774223-90774245 ATTCAGACACATTTGGAGTCTGG - Intronic
1072447544 10:95512639-95512661 CTGCAGATACAGTAGCAGGTGGG - Intronic
1072620158 10:97074445-97074467 CTGCAGACCCAGTGAGATGCAGG + Intronic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075290374 10:121224855-121224877 GGGTGGACACAGTTGGAGGCAGG - Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077047672 11:553564-553586 CTCCAGACACCGGTGGAGGCGGG + Intronic
1077206791 11:1348684-1348706 CCTCAGACACTGTGGGAGGCTGG + Intergenic
1077452018 11:2654104-2654126 GTGGAGACACAGGTGGTGGCGGG + Intronic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1079032262 11:16994502-16994524 CTGCGGACATAGGTGGGGGCTGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1080768378 11:35317597-35317619 CTCCAGGCACAGTTGGAATCTGG + Intronic
1081471406 11:43375055-43375077 CTGCAGATACAGTTTGATTCAGG + Intronic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1081961075 11:47137948-47137970 CTGAAGATAGAGTTGGAGGGTGG + Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1084401641 11:68947308-68947330 CTGCAAACACAGGCAGAGGCTGG + Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1085641625 11:78196550-78196572 CTGCAGACCCAGCTGCACGCAGG - Exonic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087290990 11:96320290-96320312 CTGCTGACACACTGGGAGGCTGG + Intronic
1088972819 11:114788388-114788410 TTGCAGACACTGCTGGAGGAAGG + Intergenic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1089748545 11:120634104-120634126 CTGCACACACACTGGAAGGCAGG - Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090522667 11:127495874-127495896 CTGCAGAAACAATTGAAGACTGG - Intergenic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1092479552 12:8847711-8847733 CTGCTGACAGAGTGGGAGGAGGG + Intronic
1092713670 12:11365468-11365490 CTGCAGTCCCAGTTAGTGGCAGG + Intronic
1096258453 12:50076697-50076719 CTGCTGACAGAGCTGGGGGCAGG + Intronic
1097872215 12:64610812-64610834 CCGCAGAGACACGTGGAGGCAGG - Intronic
1098816420 12:75170883-75170905 CTGCATACTCATTTGGGGGCGGG + Intronic
1099075684 12:78104479-78104501 CTGGATTCACAGTTAGAGGCAGG - Intronic
1101432683 12:104639774-104639796 GTGCAGGCCCAGTTGGAGGTCGG + Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101735400 12:107459514-107459536 CTGCAGACACAGTTTTAAGAAGG + Intronic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1102525177 12:113507522-113507544 CTTCAGGCACAGTTGGATCCAGG + Intergenic
1103673523 12:122637931-122637953 CTGCAGTCGCAGATGGAGTCTGG + Intergenic
1104313723 12:127677774-127677796 CTGCAGGCCCAGTGGGTGGCTGG + Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1105358057 13:19678231-19678253 TTGCAGACACAGTGGGAGTGAGG - Intronic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1107736549 13:43405141-43405163 CTGAAGAGACAGTTTCAGGCAGG + Intronic
1108743108 13:53359440-53359462 CTGCAGACACAGATGTACGTGGG + Intergenic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1116064813 14:39969688-39969710 CTGCAGACACACTACCAGGCTGG + Intergenic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119742384 14:77022591-77022613 ATGAAGAGACAGTTGCAGGCCGG + Intergenic
1120692993 14:87614174-87614196 CAGCCGACACAGTAGGGGGCTGG - Intergenic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121311087 14:92935475-92935497 CTGCACACACTCTTTGAGGCAGG - Intergenic
1121339170 14:93094741-93094763 CTGCAGGCACAGGGAGAGGCAGG + Intronic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124397795 15:29319848-29319870 CAGCAGTCTCACTTGGAGGCTGG - Intronic
1124645457 15:31434914-31434936 CTGCAGACACAAGTGCTGGCGGG + Intronic
1125085197 15:35721730-35721752 CTGCAAACACTGTTGGGGGATGG + Intergenic
1126065699 15:44824773-44824795 CTGCACACACAATAGGAGTCAGG - Intergenic
1126094136 15:45075794-45075816 CTGCACACACAATAGGAGTCAGG + Exonic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1129312312 15:74721306-74721328 CTGCAGACACAGTGATTGGCAGG - Exonic
1129821425 15:78604629-78604651 ATGCAGACCCAGCTGGAGACTGG + Intronic
1130067112 15:80614025-80614047 ATGCTGACATAGCTGGAGGCTGG + Intergenic
1130297382 15:82656813-82656835 CAGCACACACAGGTGGAAGCAGG - Intergenic
1132113556 15:99119507-99119529 AAGCAGTCACAGTGGGAGGCGGG + Intronic
1132546031 16:533853-533875 CTGCAGAGAGGGCTGGAGGCGGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133810780 16:9159565-9159587 CTTCAGAGACAACTGGAGGCCGG + Intergenic
1133893840 16:9906693-9906715 CTGAAGACACCGTTTGAGCCTGG + Intronic
1135063755 16:19292004-19292026 GAGCAGACAGGGTTGGAGGCAGG + Intronic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136711098 16:32237917-32237939 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1136756809 16:32691490-32691512 CTGCTGACAGAATAGGAGGCAGG + Intergenic
1136811300 16:33178885-33178907 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1136817776 16:33288965-33288987 CTGCTGACAGAATAGGAGGCAGG - Intronic
1136824340 16:33345494-33345516 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1136829406 16:33444265-33444287 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1138189977 16:55006877-55006899 CTGAAGAGATATTTGGAGGCCGG + Intergenic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139659562 16:68411482-68411504 CTGCAGGCATGGGTGGAGGCTGG + Intronic
1141263019 16:82470956-82470978 GTGCATACACAATTAGAGGCAGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142220941 16:88854636-88854658 CAGCAGACCCAGTGGGAGGTTGG - Intronic
1202989878 16_KI270728v1_random:1854-1876 CTGCTGACAGAATAGGAGGCAGG - Intergenic
1203058959 16_KI270728v1_random:951842-951864 CTGCTGACAGAATAGGAGGCAGG + Intergenic
1142889347 17:2932941-2932963 CTCCAGGCACAGGTCGAGGCTGG + Intronic
1143095437 17:4476248-4476270 CCTCAGACACACCTGGAGGCCGG - Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143626186 17:8111354-8111376 CTGCAGACAGAGCTAGAGGTGGG - Exonic
1145252030 17:21301951-21301973 GTGCAGGCAGAGTTGGAGGGTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147425912 17:40345772-40345794 CTGCACACACAGGTGGAGTGGGG - Intronic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1147835137 17:43324653-43324675 CTGCAGGCATGGTTGCAGGCGGG + Intergenic
1148166095 17:45485023-45485045 CTGCAGACCCAGTAACAGGCCGG + Intronic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1150397318 17:64831747-64831769 CTGCAGACCCAGTAACAGGCCGG + Intergenic
1152292734 17:79449406-79449428 TTGCAGACTCACCTGGAGGCAGG - Intronic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1152789319 17:82270252-82270274 CTGCTGTGACAGTTGGAGGGCGG - Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1154982180 18:21511939-21511961 CAACAAACACAGTTGGGGGCTGG - Intronic
1155160480 18:23191379-23191401 CTACATACCCAGTTGGAGTCAGG - Intronic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1159148860 18:64493963-64493985 CTCCAGGCACAGTTGAAGACAGG + Intergenic
1159693732 18:71526386-71526408 CTGCAAACGCTGTTGGAGTCAGG + Intergenic
1159924000 18:74250569-74250591 GTGCAGACACAGATGGCGTCCGG - Intergenic
1160007327 18:75076897-75076919 CTGCAGGCACTGTGGGATGCGGG + Intergenic
1160187777 18:76688806-76688828 CAGCAGACACACTAGGAGGATGG - Intergenic
1160438715 18:78871987-78872009 CTGCAGAGAAAGGTGGGGGCTGG - Intergenic
1160689930 19:456827-456849 TTGCAGACAGAGTTCCAGGCAGG - Intronic
1160689975 19:457060-457082 TTGCAGACAGAGTTCTAGGCGGG - Intronic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1161218147 19:3105012-3105034 CTCCAGACCCAGTCTGAGGCAGG + Intronic
1161219712 19:3112885-3112907 CTCCAGACACACCGGGAGGCAGG - Intronic
1161282259 19:3452459-3452481 CTGCGGAGACAGTGGGAAGCGGG - Intronic
1161396408 19:4047130-4047152 CCGCAGGCAGGGTTGGAGGCGGG + Exonic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161682726 19:5687985-5688007 CTCCAGGGACAGTTGGAGGGAGG - Exonic
1161701201 19:5796620-5796642 AAGCAGAAAGAGTTGGAGGCCGG + Intergenic
1162958385 19:14112411-14112433 CTGCAGCCACAGCTGGAAGGTGG + Intronic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164937891 19:32229280-32229302 CTGAGGACACAGTCCGAGGCAGG + Intergenic
1165067648 19:33238444-33238466 CTGCAGACACAGACGGGAGCAGG + Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166361612 19:42254967-42254989 CGGCGGACACAGGTGGGGGCGGG - Exonic
1166520641 19:43477991-43478013 TTGGAGACTCAGTTGGAGTCAGG - Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167374337 19:49103066-49103088 CTGCAGACGCAGCTGGTGGGAGG + Intronic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
925843772 2:8017611-8017633 CTGCAGACAGTGATGGTGGCAGG + Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927989039 2:27434572-27434594 GAGCAGACAAAGTTTGAGGCTGG + Intronic
928131267 2:28652877-28652899 CTGCACATACAGTTGGAAGATGG - Intergenic
928217456 2:29373826-29373848 CTGTAGAGGTAGTTGGAGGCAGG - Intronic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
933107504 2:78350549-78350571 CTGAAGAGATAGTTGGAGGTGGG + Intergenic
934079873 2:88458700-88458722 CTGAAGACTCACTGGGAGGCTGG - Intergenic
935951381 2:108332377-108332399 CTGCAGACATAGGTGAAGGCTGG - Intergenic
938277456 2:130038555-130038577 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938328426 2:130429358-130429380 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938361520 2:130692136-130692158 CTTCAGTCACAGATGGGGGCTGG + Intergenic
938437927 2:131298825-131298847 CTTCAGTCACAGATGGGGGCTGG + Intronic
939826845 2:147025364-147025386 CTGCAGACTCATTCTGAGGCTGG - Intergenic
940252397 2:151693430-151693452 CAACACACACTGTTGGAGGCTGG - Intronic
940711307 2:157165763-157165785 CTGCCAACACAGTAGGGGGCAGG + Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
1169476004 20:5931786-5931808 CTGCACACAGATTTGGAGGATGG - Intergenic
1170940957 20:20847820-20847842 CTCCTGACACAGATGGATGCAGG + Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171339655 20:24417474-24417496 CTGAAGACACAGGTGCGGGCGGG + Intergenic
1172094063 20:32452178-32452200 CTGCAGACCCAGCTGGGTGCTGG + Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1173313772 20:41925100-41925122 CTGCACTCCCACTTGGAGGCAGG + Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1175285959 20:57836955-57836977 CTGCAGAAAAATTTGGAGGCTGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175806965 20:61834957-61834979 GTCCAGACACCGCTGGAGGCTGG + Intronic
1178214778 21:30582581-30582603 CTGCATACACATTTTTAGGCTGG + Intergenic
1178666736 21:34554403-34554425 CTGCTGATACATCTGGAGGCTGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179562791 21:42227103-42227125 CTGCAAGCCCAGTTGGTGGCTGG + Intronic
1179649039 21:42794721-42794743 CTGCAGGCACAGCTGAAAGCTGG + Intergenic
1180196314 21:46196511-46196533 CTGCAGACACAGCTGCAAACAGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181079155 22:20402243-20402265 CTGCAGCCACTGTTGCAGGTTGG - Intronic
1181830725 22:25558395-25558417 ATGCAGATCCAGTTGGAGGCAGG - Intergenic
1182777557 22:32842069-32842091 TTGCAGGCACCTTTGGAGGCTGG + Intronic
1185066196 22:48632823-48632845 CTGCAGCCCCAGGCGGAGGCTGG + Intronic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949394979 3:3605034-3605056 GTTCAGGCACAGTTGGAGTCAGG - Intergenic
950279943 3:11698201-11698223 ATGAAGAAACAGCTGGAGGCTGG + Intronic
951864610 3:27294264-27294286 GTGCAGGCACAGCTGCAGGCTGG - Intronic
952327568 3:32335002-32335024 CTGCTGGCACATTTGGGGGCTGG + Intronic
952858972 3:37796444-37796466 CTGCAGACACATTTGTTGGTTGG + Intronic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954317672 3:49810129-49810151 CTGAAGCCACTGCTGGAGGCAGG - Exonic
955506935 3:59641828-59641850 CTGCAGAGAAAGTAGGAGGAAGG - Intergenic
955999061 3:64709439-64709461 CTTCAGGCACAGTTGGATCCAGG + Intergenic
956423083 3:69104834-69104856 CTTCAGACACAATAGGAGGGTGG - Exonic
958852481 3:99345728-99345750 CTGCAGACACAGTGTAAGGCAGG - Intergenic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962532920 3:136300458-136300480 CTGCTGAGACACTTGGATGCAGG + Intronic
963651190 3:147982314-147982336 CTTCAGACACACTTGGATCCAGG + Intergenic
964523714 3:157594846-157594868 TTGTAACCACAGTTGGAGGCAGG + Intronic
965678265 3:171222713-171222735 CTTCAGAAAGAGATGGAGGCTGG + Intronic
966841508 3:184092753-184092775 CTAAAGACAGAGTTTGAGGCTGG - Intergenic
968935530 4:3608196-3608218 ACGCACACACAGTCGGAGGCAGG - Intergenic
969338131 4:6523600-6523622 CTGCACACACTGCTGGGGGCAGG + Intronic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
969924741 4:10575390-10575412 TTTCAGACACAGTTGGATGGTGG - Intronic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971957889 4:33446105-33446127 CTGCAGAAACCATTGTAGGCAGG + Intergenic
972564544 4:40258434-40258456 CGGCAGAAAAAGATGGAGGCCGG - Intergenic
974337669 4:60570789-60570811 CTGCAGACTAAGTTGAAGACTGG - Intergenic
974487065 4:62519084-62519106 GTACAGACACTGTTGGATGCTGG + Intergenic
976278734 4:83305677-83305699 CACCAGATACAGTTGGAGGAAGG + Intronic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
984950376 4:185003585-185003607 GTGCAGACACAAGTGGAGACGGG + Intergenic
985657957 5:1141957-1141979 CAACAGCCACAGTTGGTGGCTGG - Intergenic
987119841 5:14756676-14756698 CTGCAAACACAGCTGTGGGCTGG + Intronic
989008189 5:36839038-36839060 TTGAAGAGACAGTTGGAAGCTGG + Intergenic
989558080 5:42820244-42820266 ATGCAGACACATTGGAAGGCAGG + Intronic
992419608 5:76589551-76589573 CTACAGACAGAGATGGATGCAGG - Intronic
996330022 5:122318109-122318131 CTGCACCCACAGGAGGAGGCAGG - Intronic
997522577 5:134532693-134532715 CTGCAAACACACTTGGGGGGTGG - Intronic
998002275 5:138634676-138634698 CTTAAGAAACAGTTTGAGGCCGG + Intronic
1000319088 5:160119405-160119427 CTGCAGCCGGAGTTGGAGGAGGG - Exonic
1001484566 5:172110583-172110605 CTGCAAACAGACTGGGAGGCAGG + Intronic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1004320456 6:14627872-14627894 CTGCAGGCACAGTCCCAGGCGGG + Intergenic
1004368758 6:15034151-15034173 CTGCAGACATAGATGCCGGCAGG - Intergenic
1004747707 6:18527990-18528012 CTGCAGACCTAATTGTAGGCTGG + Intergenic
1004909672 6:20270836-20270858 CTGTATACACCCTTGGAGGCTGG - Intergenic
1006381617 6:33701461-33701483 GTACAGACACTGTGGGAGGCAGG - Intronic
1006386323 6:33733081-33733103 CTGCAGGCAGAGTAGGTGGCCGG + Intronic
1007234811 6:40383046-40383068 CTGCAGACAAAGCTGAATGCAGG + Intergenic
1007995444 6:46302980-46303002 CTGCATATACTGTTGGAGGCAGG + Intronic
1009649173 6:66451339-66451361 ATGCAGACACCGTTGGAGTAGGG - Intergenic
1011221572 6:85059923-85059945 TTGCAGACTCAGTTTGAGTCTGG - Intergenic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1015371331 6:132456918-132456940 CTGCAGACAGAAGTGTAGGCGGG + Exonic
1018662978 6:166105432-166105454 GAGCAGACACAGGTGGAGGTAGG + Intergenic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019674914 7:2305142-2305164 CCTCAGAAACAGCTGGAGGCAGG + Intronic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024512208 7:50213037-50213059 CTACAGAAAGAGTGGGAGGCAGG + Intergenic
1024540489 7:50471721-50471743 CTGCACACACAGTTGTCTGCTGG + Intronic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1029300697 7:99580357-99580379 CTGGAAACGCAGTTGGCGGCGGG + Intronic
1030914092 7:115291014-115291036 CTGCAGGCACTCTGGGAGGCTGG + Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1034127742 7:148688978-148689000 CTGCAGACACACTTGAAACCAGG - Intergenic
1034343150 7:150370514-150370536 CTGCAGTCTCCGTAGGAGGCTGG - Intronic
1034949106 7:155285015-155285037 CTGCAGACTAAGTGGGAAGCTGG + Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1042211957 8:66389869-66389891 CTCCAACCTCAGTTGGAGGCAGG + Intergenic
1043231564 8:77808643-77808665 CTGCAGGCACCATTTGAGGCAGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1045427464 8:102081289-102081311 AAGCAGACCCAGTTGTAGGCTGG - Intronic
1048049321 8:130802584-130802606 CTGAAGAGATAGGTGGAGGCAGG - Intronic
1048810017 8:138277071-138277093 CTGCAGACACAGGTCTTGGCAGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1051008109 9:12374106-12374128 GTGCAGAAACAGCTGCAGGCAGG + Intergenic
1055655103 9:78443284-78443306 TTCCAGACACAGTTGGAATCAGG + Intergenic
1056790487 9:89622302-89622324 CTGCAGGCACAGTTGCATGGTGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059328668 9:113520612-113520634 CTCCAGACCCAGAGGGAGGCTGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061876855 9:133548390-133548412 CTCCAGACACAGCTCCAGGCAGG - Intronic
1061895109 9:133643108-133643130 CTGCAGCCCCAGTGGGAGGCAGG - Intronic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1062478851 9:136742360-136742382 CAGCAGGCAGAGTTGGGGGCCGG - Intronic
1062585916 9:137249975-137249997 CTCCAGACACAGATAGGGGCAGG - Intergenic
1189175796 X:38955997-38956019 CAGCACACACTGTTGGTGGCTGG + Intergenic
1190180171 X:48185157-48185179 CAGCAGCCCCAGGTGGAGGCAGG - Intergenic
1192151312 X:68714383-68714405 CTGCAGAGAGAGTTCCAGGCAGG - Intronic
1193295738 X:79829586-79829608 CTGCAGAGGCAGTTGCAGGGAGG + Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1194553797 X:95332927-95332949 CTGGAGCCACTGTTGGGGGCTGG - Intergenic
1199688893 X:150291132-150291154 CTGCAAGCACAGTTGCTGGCTGG - Intergenic
1199897188 X:152136888-152136910 CTACAGACACAGTGGGTCGCAGG - Exonic