ID: 1083293706

View in Genome Browser
Species Human (GRCh38)
Location 11:61703905-61703927
Sequence GCTTAAGTTTGAGGAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083293697_1083293706 22 Left 1083293697 11:61703860-61703882 CCTTCAGAATGAAGATCCAAAGA 0: 9
1: 101
2: 166
3: 192
4: 456
Right 1083293706 11:61703905-61703927 GCTTAAGTTTGAGGAGGAATGGG 0: 1
1: 0
2: 2
3: 18
4: 226
1083293701_1083293706 -2 Left 1083293701 11:61703884-61703906 CCAGGGAAACTCCATTTTTATGC 0: 1
1: 0
2: 0
3: 13
4: 225
Right 1083293706 11:61703905-61703927 GCTTAAGTTTGAGGAGGAATGGG 0: 1
1: 0
2: 2
3: 18
4: 226
1083293700_1083293706 6 Left 1083293700 11:61703876-61703898 CCAAAGATCCAGGGAAACTCCAT 0: 1
1: 0
2: 0
3: 20
4: 180
Right 1083293706 11:61703905-61703927 GCTTAAGTTTGAGGAGGAATGGG 0: 1
1: 0
2: 2
3: 18
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083293706 Original CRISPR GCTTAAGTTTGAGGAGGAAT GGG Intronic
901814902 1:11788414-11788436 GGTTAAGTATGAGGTGAAATGGG - Exonic
902914315 1:19627146-19627168 GCTGAAGTTTGAGGACAAAAGGG + Exonic
904554506 1:31350447-31350469 GCTAAAGTCTCAGGAGGGATAGG - Intronic
905579687 1:39074812-39074834 GCTTAAGATTCAGCAGGACTTGG + Intergenic
906122467 1:43403600-43403622 GCTTCAGTCTGAACAGGAATTGG + Exonic
906449421 1:45932187-45932209 GTTAAAATTTGATGAGGAATGGG - Intronic
907071246 1:51536989-51537011 GCAAAAGTTTGAAGAGGAACAGG - Intergenic
908378332 1:63569670-63569692 GCTTTATTTGGAGGAGGATTAGG + Intronic
911841970 1:102694334-102694356 TCTTAATTTTAAGGAGGCATCGG + Intergenic
912223572 1:107705285-107705307 GCTCAATTCTGAGGAGGATTAGG - Intronic
912600926 1:110932743-110932765 GCAAAAGTTCGAGGAGAAATAGG - Intergenic
912989311 1:114468380-114468402 CCTTTAGTTAGAGGAGGAAGGGG + Intronic
913062987 1:115224982-115225004 TCTTAAGAATGAGGAGGAGTTGG - Intergenic
915678332 1:157552994-157553016 GATTATGTTTGAGGAGCAATAGG + Intergenic
916608050 1:166362621-166362643 GATAAAGTTTGATGAGAAATGGG - Intergenic
916624018 1:166534134-166534156 GCCTAAGATGGAGGAGGAAAAGG - Intergenic
917990928 1:180377985-180378007 CCATAAGTTTGAGGAGAAACAGG + Intronic
918073067 1:181147958-181147980 TGTCAAGTTTGAGGGGGAATGGG + Intergenic
918146365 1:181759453-181759475 AATTAAGTTTGAGGAGGTTTGGG + Intronic
918199974 1:182257795-182257817 GCCTAATTTGGAGGAAGAATGGG - Intergenic
920282488 1:204854462-204854484 GCTGCAGTTTGAGGAGGGAGGGG + Intronic
920445686 1:206014447-206014469 GATTCATTTTGAGGAGGAAAAGG + Intronic
921647978 1:217642285-217642307 TTTTAAGTTTGATGAGGAATAGG - Intronic
921799556 1:219386396-219386418 CCTGAAATTTGAAGAGGAATTGG + Intergenic
924368162 1:243318859-243318881 GCTTAATTTCAAAGAGGAATAGG - Intronic
1063865446 10:10360280-10360302 GCTTAAGTTTGGGCAGAAAGGGG + Intergenic
1063901876 10:10741824-10741846 GCAAAATTGTGAGGAGGAATCGG - Intergenic
1065212281 10:23415733-23415755 GCTGAAGTTTGAGGAATAAGAGG - Intergenic
1065801247 10:29354958-29354980 GGTTAGCTTTGAGGAGGAACAGG - Intergenic
1066428737 10:35333148-35333170 CCTCAAGCTTGAGGAGGATTAGG - Intronic
1067809310 10:49415005-49415027 GCAAAAGTTGGATGAGGAATAGG + Intergenic
1067918133 10:50422636-50422658 GTTTACATTTAAGGAGGAATTGG - Intronic
1069412431 10:68167318-68167340 GCTTAAGTTGAAGCAGAAATGGG - Intronic
1073180074 10:101578234-101578256 GCCCAAGTATGAGGAGGAGTGGG - Intronic
1074889132 10:117720611-117720633 GGTTGAGTGTGAGGAGGCATGGG + Intergenic
1083293706 11:61703905-61703927 GCTTAAGTTTGAGGAGGAATGGG + Intronic
1084902866 11:72322819-72322841 GTTGAAGTTTGAGGAGTAACAGG - Intronic
1085958955 11:81436299-81436321 TCTTTAGTTTGATGAGTAATAGG + Intergenic
1087023120 11:93623072-93623094 GCTTAAGTTTGAAAAGTGATTGG - Intergenic
1087964778 11:104399088-104399110 GCTTAAGTTTGATGAAGTAGGGG + Intergenic
1088053587 11:105549524-105549546 GCTTAAATTTGATGAAAAATGGG + Intergenic
1090700480 11:129290612-129290634 TCTCAAGTTTGAGGAGAACTGGG - Intergenic
1090730652 11:129570734-129570756 TGTAAAGTTTGATGAGGAATGGG + Intergenic
1091882315 12:3989923-3989945 CATTAAGTTTGAGGAGCACTGGG + Intergenic
1092137029 12:6156751-6156773 GCTTGAGTCTGAGGAGGTCTAGG - Intergenic
1092485507 12:8899321-8899343 GCTTAGGTCTGATGAAGAATGGG + Intergenic
1092812216 12:12282091-12282113 TCAAAAGTTTGATGAGGAATGGG + Intergenic
1093999749 12:25682438-25682460 GCTTTAGTGTGAGGAGGATCAGG + Intergenic
1094214587 12:27927163-27927185 GCTTCAGTTGGTGGAGGAAAAGG + Intergenic
1095119209 12:38394587-38394609 GCTCTAGTTTGAGGAGTAAATGG + Intergenic
1096327864 12:50681819-50681841 GCTTAGGGTTCAGGAGGACTAGG - Intronic
1097128695 12:56794243-56794265 GTTAAAGTTTGATGAGGAACAGG - Intergenic
1099046886 12:77732149-77732171 CATTAAATTTGAGGAGGAAAAGG - Intergenic
1099582286 12:84465433-84465455 GCCTAAGTTAGAGAAGGGATTGG - Intergenic
1099599997 12:84722567-84722589 ACTTAGGTTTGATGAAGAATTGG - Intergenic
1100287578 12:93182216-93182238 GCTTACCTTTGAGGGGAAATTGG - Intergenic
1102404305 12:112659669-112659691 GATAAAGTTAGATGAGGAATGGG - Intronic
1103592529 12:122002438-122002460 GCTTAAGTGGGAGGATGACTTGG + Intronic
1105706922 13:22973014-22973036 GCTCAAGTTTGAGAGGGAAAGGG + Intergenic
1106117411 13:26829527-26829549 GCTTAAGTTTCAAGGGGAAGAGG + Intergenic
1106284440 13:28306667-28306689 GCTCAAGATTGAGTAAGAATTGG - Exonic
1107256284 13:38431432-38431454 GGGTAATTTTGAGCAGGAATGGG + Intergenic
1108670136 13:52678316-52678338 GTTTTGTTTTGAGGAGGAATGGG + Intronic
1109957586 13:69588813-69588835 CCTTAAGTTTTAGGAGGGTTGGG - Intergenic
1110171843 13:72510606-72510628 GCTTCAGATTGAGGTGGGATGGG - Intergenic
1110499109 13:76205167-76205189 CCTGAAGTTTGAGGAGGCACTGG - Intergenic
1112552394 13:100433949-100433971 GCTTAGGTTTAATGAAGAATGGG + Intronic
1113047490 13:106171410-106171432 GCTTTATTTTGAGGATGAGTGGG - Intergenic
1113825136 13:113246859-113246881 GCTTAGGTTTGATAAAGAATGGG + Intronic
1115158945 14:30370956-30370978 TCTTAACTTTGAAGAGGTATAGG - Intergenic
1117643431 14:57825091-57825113 ACTTAAGCTTGTGGAGGATTTGG + Intronic
1118397124 14:65347231-65347253 GTTGAAGGTTGAGGAGAAATAGG + Intergenic
1118693329 14:68360813-68360835 GCTTTGGTCTGAGGAAGAATGGG + Intronic
1119676456 14:76559159-76559181 GTTAAAGTTTGATGAGGAACAGG + Intergenic
1120646707 14:87082871-87082893 GCTTATGTATGAGGAGGAGGAGG - Intergenic
1122850828 14:104529507-104529529 GCTCAAGTTTGAGAGGGAAAGGG + Intronic
1125793232 15:42385761-42385783 GCTGAAGTCAGAAGAGGAATTGG + Intronic
1126343670 15:47670639-47670661 GATTAAGTTTGAGGAACAAAAGG + Intronic
1127061021 15:55184591-55184613 GTACAAGTTTGAGGAGTAATAGG + Intronic
1127559623 15:60122981-60123003 TGTTAAGGTTGAGGAAGAATCGG - Intergenic
1127691067 15:61398418-61398440 GAGGAAGTTTGAGGAGGAAGAGG + Intergenic
1127930724 15:63595580-63595602 GCATTGGTTTGAGGAGGATTGGG + Intergenic
1128521217 15:68376077-68376099 GCTTAAGTTTGAGAAGCATGAGG + Intronic
1131958647 15:97765143-97765165 CCTTAAGGGTGAAGAGGAATTGG + Intergenic
1133646498 16:7769617-7769639 GCTTAGATTTGCTGAGGAATAGG + Intergenic
1134611529 16:15612988-15613010 GCTTAACTTTGAGGATTAGTGGG - Intronic
1136003162 16:27311647-27311669 GCTTGGGTTTCAGGAGGAATAGG - Intergenic
1137803332 16:51281062-51281084 GCTGAAATTTGAGGACGAGTTGG - Intergenic
1138756803 16:59496510-59496532 ACTTAAGTTTGGGGAGGAATGGG - Intergenic
1140268992 16:73446141-73446163 TCTTAAGTCTGAGGGGGAAATGG + Intergenic
1141454699 16:84133037-84133059 GCCTAAGTTTGAGAAAGAATGGG + Intronic
1141761718 16:86033125-86033147 GCTTGAGTTTGGGGAGGACACGG - Intergenic
1142564648 17:832133-832155 GCTTACGTTTGAAGGGTAATAGG - Intronic
1142639202 17:1275966-1275988 GCTTCAGTGAGAAGAGGAATTGG + Intergenic
1143690393 17:8558245-8558267 TCTTAAGTTTGGGGAGCATTAGG - Intronic
1143982127 17:10879239-10879261 TCTTCAGTTAGAGGAGGAAGAGG - Intergenic
1144096135 17:11902342-11902364 GAGTGAGTTTGAGGAGGAAAGGG + Intronic
1146436916 17:32858770-32858792 TTTGAAGTTTGATGAGGAATGGG - Intronic
1146566248 17:33915525-33915547 GCTGTAGCTTGAGGAGAAATGGG - Intronic
1146772846 17:35584852-35584874 GCAGAAGTTTGGGGAAGAATAGG - Intronic
1146811133 17:35904324-35904346 GCTTAGGTTTGATGAAGAATGGG + Intergenic
1148191468 17:45681506-45681528 GTTTCAGTTTGAGGAGGCCTGGG - Intergenic
1150568639 17:66365359-66365381 GCTTAAGTAGGAGGAAGAAAAGG + Intronic
1154162481 18:11990503-11990525 GCTAAAGTTTGAGGTGGGAGAGG + Intronic
1155411825 18:25554679-25554701 GTTTAATTTTGAAGAGGTATGGG + Intergenic
1157912742 18:51633821-51633843 GCTTAAGATTTAGCAGGACTTGG - Intergenic
1159795281 18:72835706-72835728 TCTTAAATTTGAGGAAGAAATGG + Intronic
1160019308 18:75167911-75167933 GCTCAAGTTCAAGGAGGAAGAGG - Intergenic
1163052873 19:14697863-14697885 GGTTAAATTTAAAGAGGAATTGG - Intronic
925784594 2:7418913-7418935 GCTTAGGTTTTAGGAGAAAAAGG - Intergenic
927550299 2:23992335-23992357 GCCTAAGTTTGATGAGGAAGTGG + Intronic
927981964 2:27380153-27380175 TCTGGAGTTTGAGGAGGAAGAGG - Exonic
928133608 2:28671649-28671671 GCTAAAGTTTGAGGAGACAAAGG - Intergenic
928707266 2:33963885-33963907 ACTTAATTTTGAGGAGGTCTAGG - Intergenic
930378997 2:50603507-50603529 TCTTAAATTTGAAGAGGATTTGG + Intronic
930792923 2:55353996-55354018 GTATAAGTTTGAGAAGCAATAGG - Intronic
932730418 2:74217356-74217378 TCTTAAGTTTCATGAGGAATAGG + Exonic
933048824 2:77575565-77575587 GCTTAGGGCTGGGGAGGAATGGG + Intronic
937579803 2:123471179-123471201 GTTTAAGATTTAGGAGGACTTGG - Intergenic
938577517 2:132618737-132618759 GCTGAAGATAGAGGAGGATTGGG - Intronic
940185101 2:150975650-150975672 GTTTAAGTTTGATGAAGAATGGG - Intergenic
940667165 2:156622682-156622704 GCTTAAATTTGCAGATGAATAGG + Intergenic
940718733 2:157258376-157258398 GCTCAAGGTTGAGGTGGACTTGG + Exonic
941129875 2:161634457-161634479 GCAAAAGTTTGAGGAGAAATAGG - Intronic
941479385 2:165987390-165987412 GTGAAAGTTTGATGAGGAATAGG - Intergenic
941589510 2:167402067-167402089 GCATAAATTTGAGTAAGAATTGG + Intergenic
943848929 2:192690777-192690799 GCTTAAGACTGAGGAGTACTAGG + Intergenic
944081120 2:195789507-195789529 GCTGGATTTTGATGAGGAATGGG + Intronic
945364488 2:208934862-208934884 GCTTAAGTTTGGGGATGCAAAGG - Intergenic
945709788 2:213281554-213281576 GCTTAATGTAGAGGAGAAATGGG - Intergenic
945869454 2:215210883-215210905 GTTTAAGATTTAGCAGGAATTGG - Intergenic
946432328 2:219632333-219632355 GATCAAGTTTGAGGAGGACGTGG + Exonic
948748625 2:240113767-240113789 GCTTAGGTGTCAGCAGGAATAGG + Intergenic
1169097312 20:2913848-2913870 GTGAAAGTTTGATGAGGAATGGG - Intronic
1170421998 20:16202386-16202408 GTTTCAGTTTGGGGAGGAAAGGG - Intergenic
1172716942 20:36971530-36971552 GCTTAAGATTTAGTAGGAACTGG - Intergenic
1173181055 20:40806660-40806682 GGTTCAGTTTGAGAAAGAATTGG + Intergenic
1174212408 20:48890341-48890363 GCTTGAGATTGTGGAGGAAATGG - Intergenic
1178385379 21:32144718-32144740 GCTTATGTTTCATGAAGAATGGG - Intergenic
1178580147 21:33831495-33831517 ACGTAAGTTTGAGGGGGAAGAGG + Intronic
1178613368 21:34107532-34107554 GTTCAAGTTTGATGAGAAATAGG - Intronic
1179200259 21:39211839-39211861 GCTTAAATTTAAGGAGCATTTGG + Intronic
1179475257 21:41639151-41639173 GTGTAAGTCTGAGGAGTAATGGG - Intergenic
1180733463 22:17999392-17999414 GTTTGAGTGGGAGGAGGAATGGG + Intronic
1181306227 22:21918793-21918815 GCTTAAGTTTGAGGAGCTTGAGG - Intergenic
1183473312 22:38021214-38021236 GCTTATAGGTGAGGAGGAATTGG + Intronic
1184104630 22:42360243-42360265 GCTGAAGGGTGAAGAGGAATTGG - Intergenic
949659722 3:6264558-6264580 GCTCAAGATCGAGGAGGAACAGG + Intergenic
950418935 3:12885409-12885431 GCTTAATGTAGAGGTGGAATGGG + Intergenic
951688258 3:25368786-25368808 GCTAAAGTAAGAGGAGCAATGGG - Intronic
951845982 3:27085331-27085353 GAAGAAGTTTGAGGAGAAATAGG - Intergenic
952128227 3:30328546-30328568 GCTAAGGTTAGAGGAGGAAGGGG + Intergenic
953216048 3:40919902-40919924 GCTTCAGTTGGAGAAGGAAGGGG + Intergenic
954983528 3:54768503-54768525 GCAAAAGTTTGAGTAGCAATGGG - Intronic
955335833 3:58085235-58085257 GCTTATTTTTCAGGAGGAAGTGG + Intronic
956057833 3:65319299-65319321 GCCAGGGTTTGAGGAGGAATTGG + Intergenic
956705503 3:71995577-71995599 GCCTAAGTTTGCTGAGGAACAGG + Intergenic
957611850 3:82477550-82477572 GCTCAAGTGTGAGGAGAACTGGG + Intergenic
964395305 3:156239457-156239479 GCTTTAGTGGGAAGAGGAATGGG - Intronic
964873120 3:161335074-161335096 GCAAAAGTTTGAGGAGAAGTAGG + Intergenic
965961617 3:174435907-174435929 GCTTAAGTTTGATGAAGAATGGG - Intergenic
966128351 3:176606856-176606878 CCATAAGTTTGAAGTGGAATGGG - Intergenic
966392548 3:179467752-179467774 TCTTAAGTTTTGTGAGGAATAGG + Intergenic
967444179 3:189545394-189545416 GCTCAAGTTTTAGTAGGAGTTGG + Intergenic
967689778 3:192460314-192460336 GCTTAAGTTCGGGTAGGAAGAGG + Intronic
972131221 4:35836370-35836392 GATTAAGTTTCAGGAAAAATAGG + Intergenic
973182723 4:47289472-47289494 GCTGAAGGTTGAGGACAAATGGG - Intronic
973208395 4:47586644-47586666 GCTTAAGTTTGAGGTTCACTGGG + Intronic
973901873 4:55483557-55483579 ACTTAAGTTTGAGAAGCAACAGG + Intronic
974665112 4:64951707-64951729 GCCCAAGGTTAAGGAGGAATAGG - Intergenic
977226246 4:94395632-94395654 GCTTAACTTTGAGGAACAAGAGG - Intergenic
980071663 4:128249370-128249392 GTTTAAGATTTAGCAGGAATTGG + Intergenic
983762921 4:171435954-171435976 GTTTAAGTTTTTGGAGGAATTGG - Intergenic
986040004 5:3984231-3984253 GCTTAAGCTTGAGGAAGAAGGGG - Intergenic
986891979 5:12320380-12320402 GCTACAGTGTGAGGAGGAAGTGG + Intergenic
987716095 5:21573408-21573430 GCTAAAGTTTGAGGTGGCTTTGG + Intergenic
987869175 5:23591007-23591029 CCTTAAGTTTGTGAAGAAATTGG + Intergenic
989471583 5:41825741-41825763 GCCTAAATTGGAGGAGGAGTGGG - Intronic
989993361 5:50796400-50796422 ACGTATGTTTGAGTAGGAATGGG - Intronic
992211921 5:74488716-74488738 GCTAGAGTTTGAGGACCAATGGG - Intergenic
995657254 5:114440468-114440490 TCTTAAATGTGAGAAGGAATAGG + Intronic
996653001 5:125904361-125904383 GCTTAGGTTTGATGATAAATGGG + Intergenic
999540661 5:152568743-152568765 GCTTATGTTTGGGCAAGAATAGG + Intergenic
999541361 5:152576018-152576040 GCTAAATGGTGAGGAGGAATGGG + Intergenic
999994402 5:157078491-157078513 TCTTAAGTTTTAGGAGGGCTTGG - Intergenic
1000294037 5:159897612-159897634 GCCTAATCTTGAGGAGAAATGGG - Intergenic
1002079270 5:176727900-176727922 GCTGCATTTTGAAGAGGAATCGG + Intergenic
1004116296 6:12771184-12771206 GCTTGAGTTAGAGCAGTAATAGG + Intronic
1004149322 6:13100249-13100271 GCTTAGGTTTGATGAAGAAGTGG + Intronic
1004164229 6:13241471-13241493 ACTAAAGTTTGAGAAGCAATGGG + Intronic
1004839725 6:19569250-19569272 GTCTAAGTTTGAGAAGGAATGGG - Intergenic
1004940271 6:20549457-20549479 GCCAAAGGTTGAGGAGAAATAGG - Intronic
1005886705 6:30102573-30102595 GATTAACTTTGAGGAGGAGGAGG - Intergenic
1006197224 6:32252383-32252405 GCTTAAGTTTGAGAATCACTTGG + Intergenic
1007395154 6:41573521-41573543 TCTTAAGCTTGAGGGGGAATGGG + Intronic
1008376706 6:50800355-50800377 GCTTGGGTTTCATGAGGAATGGG - Intergenic
1011505585 6:88039132-88039154 CCTTTAGTTTCAGGAGGCATTGG - Intergenic
1011834564 6:91415458-91415480 CCGTAAGTTTGAGAAGGAAACGG + Intergenic
1011960024 6:93076701-93076723 GCTTAAGCTTGCAGAGAAATGGG - Intergenic
1012356944 6:98326199-98326221 GGTTCATTTTGAGGAGGAAGGGG - Intergenic
1012444684 6:99295869-99295891 GCCAAAGTTTGAGGAGAAACAGG - Intronic
1012629699 6:101449559-101449581 GCTTAGGTTTGATGAAGAAGTGG + Intronic
1014117928 6:117687492-117687514 GGGTAAGTCAGAGGAGGAATGGG + Intronic
1014164595 6:118209173-118209195 GCTTAGGTTTGAGGAAGAAAGGG - Intronic
1014962195 6:127700934-127700956 GGTAAAGTTTGAGGAGAGATTGG - Intergenic
1015120663 6:129698018-129698040 GATTAAGTTTGAGTAAGAAAAGG - Intronic
1018017498 6:159725713-159725735 GCTTATTTTCGGGGAGGAATTGG - Exonic
1018145744 6:160886546-160886568 GTTTAAGATTTAGCAGGAATTGG - Intergenic
1022308045 7:29168659-29168681 GCTGAGGTTTGAGGGGGAAGAGG - Intronic
1024442067 7:49431540-49431562 GCTTAAGTTTAAGGAGTAAAAGG + Intergenic
1025888350 7:65621069-65621091 GCAGAAGTGTGAGGAGGATTGGG + Intergenic
1029025242 7:97410167-97410189 GGTTAACACTGAGGAGGAATAGG + Intergenic
1029963728 7:104715946-104715968 GGATAAGTTTGAGAAGGATTAGG + Intronic
1031403923 7:121360490-121360512 GCATAAGCTTAAGGAGGCATGGG + Intronic
1031952527 7:127906938-127906960 GCTAGAGTTTAAGGGGGAATTGG - Intronic
1033301251 7:140188134-140188156 CCATATGTTTGAGGAAGAATAGG + Intergenic
1035190208 7:157160714-157160736 GCAAAAGTTTGAGGAGAAACAGG - Intronic
1037924947 8:22836999-22837021 GGTTAAGTCAGAGGAGGAAATGG - Intronic
1038105625 8:24430701-24430723 GCTCAAGTATTAGGAGGCATAGG - Intergenic
1038251665 8:25910804-25910826 GGTTAAGTGGGAGGAGGAAGAGG + Intronic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1039425346 8:37480586-37480608 GATTAAGAGTCAGGAGGAATGGG + Intergenic
1043910457 8:85858009-85858031 GCTTAACGTTGAGGAGACATTGG + Intergenic
1043970589 8:86524216-86524238 GAGTAGGTTTAAGGAGGAATGGG + Intronic
1044961936 8:97539763-97539785 ACTTAAGAATGAGGAGGAAGAGG - Intergenic
1046743076 8:117848741-117848763 GCTTGAGCTGAAGGAGGAATGGG - Intronic
1047098045 8:121645139-121645161 GCTTAAGTTTAACAAAGAATGGG + Intergenic
1048560832 8:135535874-135535896 GCCTAATCTTCAGGAGGAATCGG - Intronic
1050051099 9:1602393-1602415 CCTTGAGTCTGAGGAGGACTGGG + Intergenic
1051758475 9:20433408-20433430 ACTTAAGTCTGAGGAAAAATGGG + Intronic
1056842944 9:90013490-90013512 GCTTTAATTTGAGGAGGATTTGG - Intergenic
1057051206 9:91925539-91925561 TCATAAGTTTGAGAAGAAATGGG - Intronic
1058791714 9:108453240-108453262 GCTAAGGTTAGAGGAGGAAGGGG - Intergenic
1059735803 9:117098661-117098683 GCTTAGCTTTGAAGTGGAATTGG + Intronic
1060320816 9:122559199-122559221 GCTGAAGATTTAGGAGGAGTGGG - Intergenic
1203625152 Un_KI270750v1:11019-11041 ACTTAATTTTTAGTAGGAATGGG + Intergenic
1189615223 X:42776341-42776363 GCTACAGTTAGGGGAGGAATGGG - Intergenic
1189861115 X:45273518-45273540 GCTTAGGTTTGATGAAGAATGGG + Intergenic
1190393811 X:49959583-49959605 GCTTAAGATTGAGGAATTATCGG - Intronic
1193600043 X:83500811-83500833 TCTTATTTTTGAAGAGGAATAGG + Intergenic
1194736248 X:97515557-97515579 GCTTAGGTTTGATGAAGAAGTGG + Intronic
1197133146 X:123029300-123029322 GGTTAGCTTTGAGGAGGAATAGG + Intergenic
1198398437 X:136246607-136246629 GCATAAGTTTGTGGATGAGTAGG + Intronic
1198621364 X:138514260-138514282 GATCAAGTGTGGGGAGGAATGGG + Intergenic
1199546394 X:149010859-149010881 GCTTCAGTTTAATTAGGAATGGG + Intergenic
1201191586 Y:11448164-11448186 GCTAAAGTTTGAGCAGGAGCAGG + Intergenic
1202138465 Y:21694622-21694644 GCTTGAGTAGGAGGAGGAAAAGG - Intergenic