ID: 1083294207

View in Genome Browser
Species Human (GRCh38)
Location 11:61706544-61706566
Sequence CAGGCTCTGTCTAAAACAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083294201_1083294207 27 Left 1083294201 11:61706494-61706516 CCTGCTCGTGGTTGGGGGTGGGC 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1083294207 11:61706544-61706566 CAGGCTCTGTCTAAAACAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1083294204_1083294207 -1 Left 1083294204 11:61706522-61706544 CCTGTGAGGATTTTCTGGTCGTC 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1083294207 11:61706544-61706566 CAGGCTCTGTCTAAAACAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 144
1083294199_1083294207 28 Left 1083294199 11:61706493-61706515 CCCTGCTCGTGGTTGGGGGTGGG 0: 1
1: 0
2: 2
3: 32
4: 276
Right 1083294207 11:61706544-61706566 CAGGCTCTGTCTAAAACAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083294207 Original CRISPR CAGGCTCTGTCTAAAACAGG CGG Intronic
900085249 1:890462-890484 CAGGCTATGTCTGAACTAGGAGG + Intergenic
907532092 1:55109278-55109300 AAGTGTCTGTCAAAAACAGGAGG - Intronic
915442614 1:155954926-155954948 CATCCTCTGTCTCAATCAGGGGG + Exonic
915832419 1:159143260-159143282 AAGGCTCTTTCTAACACAAGGGG + Intronic
916469756 1:165111748-165111770 GAGGCTCAGCCTAGAACAGGAGG + Intergenic
917099028 1:171427330-171427352 CAGGCTTTGCCTAAAAAATGGGG - Intergenic
920075625 1:203334437-203334459 CAGGCTCTGTCTCACATAGTGGG - Intergenic
920309297 1:205039225-205039247 CAGGCACTGTGCTAAACAGGAGG + Intergenic
921053716 1:211528543-211528565 CAGGCTGAGTCCAAAAAAGGAGG + Intergenic
924189011 1:241529289-241529311 CAGGCTGATTCTAAAACAGATGG + Intergenic
924315795 1:242795159-242795181 GAGGCACTGTCTAAAAAAAGAGG - Intergenic
1068563409 10:58543517-58543539 CAGACCCTGTCTAAAAAAGTGGG - Intronic
1069996329 10:72344305-72344327 CATGCTCAGTCTCACACAGGCGG + Intronic
1070523493 10:77275312-77275334 CAGTATCTGTCTAATACAGGAGG + Intronic
1073947701 10:108770012-108770034 CATGCTCTGTGTAAAACACGAGG + Intergenic
1082202933 11:49395724-49395746 CAGGCAGGGGCTAAAACAGGAGG + Intergenic
1083294207 11:61706544-61706566 CAGGCTCTGTCTAAAACAGGCGG + Intronic
1086652096 11:89304355-89304377 CAGGCAGGGGCTAAAACAGGAGG - Intergenic
1086938086 11:92766246-92766268 CAGGCTGTTGCTAAAACAGAGGG + Intronic
1095231159 12:39741798-39741820 AAGGCTCTGTCTAAAACTTGAGG + Intronic
1095506192 12:42901659-42901681 GTGTCTCTGTCTCAAACAGGAGG - Intergenic
1096186148 12:49582163-49582185 CAGGATCTGCCTCTAACAGGTGG - Intronic
1099176753 12:79430893-79430915 CAGGCTCTGTGTCAAGCATGGGG + Intronic
1099534228 12:83825907-83825929 CCAGCTCTGTCTAAAGCAGGTGG + Intergenic
1102013409 12:109632697-109632719 CAGGCCCTGTCTGCTACAGGAGG - Intergenic
1102203209 12:111072571-111072593 CAGGCTCTGAGTAAAGTAGGAGG + Intronic
1102588209 12:113938102-113938124 CAGACACTGCCCAAAACAGGAGG + Intronic
1103005467 12:117416999-117417021 CAGGGTCTCTCTAAAAATGGTGG + Intronic
1103050493 12:117775229-117775251 CAGGCACTGTGGAAAACAGCAGG - Intronic
1104293620 12:127491996-127492018 CAGGCTCTCTCTAGACCAGTGGG - Intergenic
1104358690 12:128112007-128112029 CAAGCTCTGTCAGAAAAAGGAGG + Intergenic
1106931222 13:34667896-34667918 CAAGCTCTGTCAAAAGCAGATGG - Intergenic
1107432538 13:40352819-40352841 CAGGTTGTGTCTAAAACATCTGG + Intergenic
1108268881 13:48739072-48739094 AAGGCTCTGTCAAGAACAAGGGG + Intergenic
1113696438 13:112349333-112349355 CAGAGTCTGTCTAAAAAATGGGG - Intergenic
1115002350 14:28438456-28438478 CAGGCTCTGCCTAGCACTGGAGG + Intergenic
1118901128 14:69986860-69986882 CAGGTTCTTTCCAAAGCAGGAGG - Intronic
1122894098 14:104746991-104747013 CAGTCTGTGACTAAAACAGCTGG - Exonic
1128491138 15:68146219-68146241 AATGCTATGTCTTAAACAGGAGG + Intronic
1130032980 15:80332723-80332745 CAGGCACTGGCAAAAACAGCTGG - Intergenic
1131723683 15:95200310-95200332 CAGGCTCCTTCTACAACACGTGG - Intergenic
1133888588 16:9855785-9855807 CAAGCTATCTCTAAAAAAGGTGG + Intronic
1135507525 16:23051741-23051763 CAAGCTCTGCCTGACACAGGGGG + Intergenic
1135738414 16:24952859-24952881 CAGGTTCTGTCTCAGACAGATGG - Intronic
1136558452 16:31023595-31023617 CAGGGTCTCTTTAACACAGGCGG - Intergenic
1136955584 16:34781937-34781959 CAGGCTTTGTGAAAGACAGGTGG + Intergenic
1139250795 16:65493582-65493604 CAAGATCTGTTTAAAACACGGGG - Intergenic
1139304058 16:65968420-65968442 CAGGCCCTGACTAAAGCAGCTGG - Intergenic
1141880344 16:86854363-86854385 CAGGCTCTGGGTAAAACTGGGGG - Intergenic
1142422384 16:89979858-89979880 CAGACTCTGCTTAGAACAGGTGG + Intergenic
1145287555 17:21517664-21517686 CAGGCTTTGTCGAAAACTTGGGG - Intergenic
1148736475 17:49868002-49868024 CAGCCTCTGTCTGAAATAAGAGG + Intergenic
1149962856 17:61131043-61131065 AAGACTCTGTCTCAAAAAGGGGG + Intronic
1152459498 17:80433737-80433759 CAGGCTCTGCTTAAAACCGTTGG + Intronic
1153505368 18:5791157-5791179 CAGGTTGTGTCTAAGGCAGGAGG + Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1160112590 18:76047788-76047810 CAAGCAATGTCTAAAGCAGGTGG - Intergenic
1164598899 19:29548117-29548139 CAGGGAATGGCTAAAACAGGCGG + Intronic
1164995359 19:32717262-32717284 CAGGATCTGATTTAAACAGGAGG - Intergenic
925637815 2:5959283-5959305 CCAGCTGTGGCTAAAACAGGTGG + Intergenic
925726685 2:6879427-6879449 CAGGCTGTGTCTACAGCAGAGGG - Intronic
927023889 2:19045856-19045878 CATGCTCTTTCTAGCACAGGGGG + Intergenic
927430308 2:23021707-23021729 CAGCCTGTGACTCAAACAGGGGG - Intergenic
928177641 2:29045944-29045966 CATGGTCTGTCTGAAAAAGGAGG - Intronic
930182455 2:48375712-48375734 CAGCCTCTGTCTTAAACTTGTGG + Exonic
931260976 2:60619025-60619047 CAGCCGCTGTAGAAAACAGGTGG - Intergenic
934526592 2:95055921-95055943 CTGCCTCTGTCTTACACAGGAGG + Intergenic
935401154 2:102662018-102662040 CAGGTTCATTGTAAAACAGGTGG + Intronic
936885654 2:117308148-117308170 CTGGATGTGTCTAAAGCAGGTGG + Intergenic
936890272 2:117360873-117360895 CTGGTTTTGGCTAAAACAGGCGG - Intergenic
948062267 2:235050705-235050727 AATGCTCAGTCTAAAACAGCTGG + Intronic
1168850458 20:973136-973158 CAGGCTCTGCCTGACACAGGAGG - Intronic
1170189244 20:13628192-13628214 TAGTCTGTGTCTAAGACAGGAGG + Intronic
1170638331 20:18129029-18129051 CACCCTCTGTGGAAAACAGGAGG + Intergenic
1171774242 20:29350713-29350735 CAGGCTATGTCTGAACTAGGAGG - Intergenic
1173884632 20:46446536-46446558 CAGGCTCTGTGTACATCAGAAGG - Intergenic
1174510084 20:51044760-51044782 AAGACCCTGTCTAAAACAGGAGG - Intergenic
1174863627 20:54114865-54114887 CAGGCTCTGTCTCAGATAAGGGG + Intergenic
1176985690 21:15433080-15433102 CAGGTTCTATGTAAAGCAGGTGG + Intergenic
1178845906 21:36174051-36174073 GAGGCTCTGCTTTAAACAGGAGG - Intronic
1182830682 22:33302383-33302405 CAGACTCTGTTAAAAACAGTAGG - Intronic
1183782012 22:40004957-40004979 CAGGCTGTGTACAAAACTGGAGG + Intronic
1184205033 22:42996679-42996701 GAGGCCCTGTCTCAATCAGGGGG + Intronic
1184930083 22:47674526-47674548 AAGGCCCTGTCTGAACCAGGAGG - Intergenic
951815781 3:26752778-26752800 CAGACTCTGTATAAATCAGTTGG - Intergenic
953408281 3:42671322-42671344 CAGGCTCTTTATAAAACAGAAGG + Intergenic
953866476 3:46587415-46587437 CAGGCTCTGGCTGATACTGGGGG - Intronic
954402353 3:50325602-50325624 CAGCCTCTGTCCAACACAGGAGG + Exonic
957157909 3:76569193-76569215 CAATCTCAGTCTAAAACAGTTGG + Intronic
958727207 3:97920538-97920560 CAGACTCTATCTAAAAAAAGTGG - Intronic
958899888 3:99873361-99873383 CAGGCTCTGTGAACAACAGATGG + Intronic
961019114 3:123489227-123489249 CAGGCTCTCCATGAAACAGGAGG + Intergenic
962270887 3:133977375-133977397 CAGGATCTGCTTAAGACAGGAGG - Intronic
965584894 3:170309185-170309207 CAGGCTCTTTCTTAAACAATTGG - Intergenic
967537573 3:190624710-190624732 CAGGCACTGCCTGAAACAAGAGG - Intronic
969956069 4:10892021-10892043 CAGGTTCTGTCTAATACAGATGG + Intergenic
973582799 4:52360830-52360852 CTGTCTCTTTGTAAAACAGGTGG + Intergenic
974979195 4:68932921-68932943 CAGTCTATGTATAAAACATGTGG + Intronic
977771835 4:100869531-100869553 CCAGCTGTGTCTGAAACAGGTGG + Intronic
978461783 4:108962973-108962995 CAGGCTGTGTCTGCTACAGGGGG + Intronic
981139608 4:141253473-141253495 CTGGCTGTGGCTAAAGCAGGTGG + Intergenic
982045570 4:151442277-151442299 CAAACTCTGACTAAAACAGCAGG - Intronic
986072784 5:4303104-4303126 CCTGCTCTGTCCAAAACATGGGG + Intergenic
987718107 5:21597270-21597292 GAGACTCTGTCTAAAACAATAGG + Intergenic
988095130 5:26597401-26597423 CAGTCACTGTAGAAAACAGGAGG - Intergenic
990051620 5:51508633-51508655 CAGGCTCTGTGTAGAACATTAGG - Intergenic
992457424 5:76928626-76928648 CAGGCTCAGTAAAAAACAGAAGG + Intergenic
995426526 5:112029781-112029803 GAGGCTCTGTCTTAAAAAAGGGG - Intergenic
999013901 5:148075578-148075600 TAGACTCTGACTAAATCAGGTGG + Intronic
999331105 5:150673940-150673962 CTGGGTCTGTCTAAGACAGACGG + Intronic
999470583 5:151851308-151851330 CTTGCTCTGCCTAAAACATGGGG - Intronic
999929435 5:156414651-156414673 CAGGCTTTTACAAAAACAGGCGG + Intronic
1001748756 5:174111800-174111822 CAGACTCAGTCTAGAACAGCAGG + Intronic
1003691885 6:8362945-8362967 GAGCCTCTGTCTAATGCAGGAGG - Intergenic
1004129953 6:12910112-12910134 CAGGCTTTGTATAAAACACTTGG + Intronic
1006919973 6:37621106-37621128 TGGGCTTTGTCTAAAACATGTGG + Intergenic
1007178667 6:39913132-39913154 GGGGCTCTGCCTAAAACTGGTGG + Intronic
1012079532 6:94737452-94737474 CAGGTTGTGGCTAAAGCAGGTGG - Intergenic
1012622753 6:101366499-101366521 CAGGCTCTGTGTTAGACATGCGG - Intergenic
1018080533 6:160256056-160256078 CAGGGTCTGCCTACAACACGAGG - Intronic
1018942972 6:168321956-168321978 AAGGCCCTGTCTCAAAAAGGAGG - Intergenic
1019381208 7:724829-724851 CAGGCACTGTCTGCAACATGTGG - Intronic
1020450316 7:8314589-8314611 CTGGCTTTGGCTAAAGCAGGTGG + Intergenic
1021415199 7:20376086-20376108 CAGGCTCTGTTTAAAACCAATGG + Intronic
1023510235 7:40945106-40945128 CAAGCTGTGGCTAAAACAGGTGG + Intergenic
1024874803 7:54009484-54009506 AAGGCACTGTTTAATACAGGGGG - Intergenic
1025795151 7:64732695-64732717 GAGACTCTGTCTCAAAAAGGGGG - Intergenic
1029142130 7:98418851-98418873 CAGGCTCTGTCTATACCATGTGG - Intergenic
1035050531 7:155996318-155996340 CAGGCTCTGTCTCCACCAGTGGG - Intergenic
1038585917 8:28789382-28789404 CAGCCTCTGTCTTAGAAAGGGGG - Intronic
1039453136 8:37691642-37691664 CAGGCTGTGTCTGAAGCCGGGGG + Intergenic
1039465039 8:37779030-37779052 CAGGCTGTCTCTAAAAAAGTTGG - Exonic
1040299509 8:46180615-46180637 CAAGGTCTGTCCAAAACAGGTGG - Intergenic
1042377074 8:68063952-68063974 CTTGCTCTGTTTAAAACAGATGG - Intronic
1042499155 8:69489965-69489987 CAGGCTCTGTCTGAAACTACTGG + Intronic
1043315757 8:78919536-78919558 CAGGTTCAGTCAAAAACATGTGG - Intergenic
1044974219 8:97647516-97647538 GAGGCCCTGTCTAAAAAAAGGGG + Intronic
1046331283 8:112718212-112718234 CAGGCTCACTACAAAACAGGAGG - Intronic
1048454467 8:134565581-134565603 CATGCTCAGTCTTCAACAGGTGG + Intronic
1049096647 8:140552119-140552141 AAAGCTCTGTATAGAACAGGAGG - Intronic
1052583123 9:30387521-30387543 TAGGCTCTGGTTAAAATAGGGGG + Intergenic
1052956904 9:34259700-34259722 CAGGACCTGTCCAAAACAGAAGG + Exonic
1054459694 9:65456012-65456034 CAGGCCCTGTCAGGAACAGGAGG + Intergenic
1056559984 9:87721760-87721782 CAGGTTCTGTTTAGAACATGGGG - Intergenic
1056568304 9:87794094-87794116 CAGGTTCTGTTTAGAACATGGGG + Intergenic
1056740111 9:89247080-89247102 CAGGCTTTGTGTAAAGCATGTGG - Intergenic
1061934694 9:133850807-133850829 CAGGCTCTTCCTCAAACAGAGGG + Intronic
1185562671 X:1071872-1071894 GAGACTCTGTCTAAAAAAGAAGG - Intergenic
1188224453 X:27579800-27579822 CTGGCTCTGTAGAAAACAGCTGG - Intergenic
1188512463 X:30950921-30950943 CAGCCTCTGCCTAAAACTGAGGG + Intronic
1188878095 X:35457241-35457263 CAGGCTTAGTCTCAAACAAGTGG - Intergenic
1192886129 X:75336761-75336783 CTGGCTGTGTCTAAAACAGGTGG + Intergenic
1195206612 X:102605934-102605956 CAGGCACTGTGGAAAACAGCTGG - Intergenic
1195231909 X:102859048-102859070 CAGGCTCAGTCTGGAACTGGGGG + Intergenic
1195578493 X:106476169-106476191 AAGGCTCTGTCTAAAACTTGAGG - Intergenic
1197691768 X:129508684-129508706 CTTGCTCTGTCTAGTACAGGAGG + Intronic
1198165870 X:134056524-134056546 CAGGCACTGTAGAAAACAAGTGG - Intergenic
1198274999 X:135091816-135091838 CAGCCACTGTGGAAAACAGGTGG - Intergenic
1201070755 Y:10145628-10145650 CAGGCTATGTCTGAACTAGGAGG + Intergenic
1201219421 Y:11753788-11753810 GAGGCACTGTCTAAAAAAAGAGG - Intergenic