ID: 1083297924

View in Genome Browser
Species Human (GRCh38)
Location 11:61725252-61725274
Sequence GAGGAACCTCTGTGAATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083297924 Original CRISPR GAGGAACCTCTGTGAATAAC TGG Intronic
902492247 1:16791795-16791817 GAGGAAAATCTGTGTATAAGTGG + Intronic
906803995 1:48762065-48762087 GAGGGACCTCAGTGAACAAGTGG + Intronic
907397855 1:54204508-54204530 AAGGAACCTTTGGAAATAACTGG - Intronic
907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG + Intergenic
907844861 1:58195532-58195554 GAGAACTCTCAGTGAATAACAGG - Intronic
914339907 1:146751223-146751245 CAGGAACATCTGTGAAGAATAGG + Intergenic
916008897 1:160686571-160686593 AAAGAACCTATGTGAATATCAGG - Intronic
916377600 1:164172582-164172604 GAGAAACATCTGTAGATAACTGG + Intergenic
916624677 1:166542368-166542390 GAGGAATATCTGTGAAGAATAGG + Intergenic
917727191 1:177839157-177839179 GAGCAACCTCTGTGGATCCCAGG - Intergenic
918030165 1:180799894-180799916 GATGAATCTTGGTGAATAACTGG - Intronic
921785186 1:219221293-219221315 GGGGAACCTCTATGAATCAGGGG + Intergenic
923528201 1:234790742-234790764 GAGGAAAATCTGTGTATAAGTGG - Intergenic
1062931206 10:1353938-1353960 GAGCAACCTCTGTTATTTACGGG - Intronic
1065125071 10:22566315-22566337 AAAGAACCTATGTGAATATCGGG + Intronic
1065290725 10:24226968-24226990 GTAGAAATTCTGTGAATAACTGG - Intronic
1065542191 10:26781434-26781456 AGGGAACCTCTGTGAATCAAGGG - Intronic
1068137008 10:52959785-52959807 GATGAACCTCTTTTTATAACTGG - Intergenic
1069592674 10:69651681-69651703 GTGGATCCTCAGGGAATAACAGG - Intergenic
1072822975 10:98576623-98576645 GAGGGCCCTCTGTGAAACACAGG - Intronic
1073496641 10:103897555-103897577 GAGGAGGCACTGTGAATCACAGG + Exonic
1074162542 10:110846263-110846285 GAGGAACCCCTGAGACTAAGAGG - Intergenic
1077622604 11:3740699-3740721 GAGGACCCTCTGATAATAGCCGG + Intronic
1080263579 11:30377068-30377090 GAGGGACCTGTGTAAATAAGAGG - Intergenic
1080725318 11:34893689-34893711 GAGGTTCCTCTGTTAACAACTGG - Intronic
1082298757 11:50478278-50478300 AAGGAAACTCTCTGAAAAACTGG - Intergenic
1082774220 11:57233611-57233633 GATGAACCACAGTGACTAACAGG + Exonic
1083297924 11:61725252-61725274 GAGGAACCTCTGTGAATAACTGG + Intronic
1084344896 11:68540203-68540225 AAAGAACCTATGTGAATATCGGG - Intronic
1087731920 11:101788517-101788539 GAGGAACCTCTGAAGATAATTGG - Intronic
1088566764 11:111180783-111180805 TAGGACCCTCTGTGTATACCGGG - Intergenic
1088922202 11:114268346-114268368 GAGGGAACTCTGTGAACAAGTGG - Intronic
1091660722 12:2381273-2381295 CAGGGACCTCTGAGAATCACAGG - Intronic
1094663497 12:32495112-32495134 GTGAAACCTCTTTGAATATCTGG - Intronic
1096679637 12:53247041-53247063 GAGGAAGCTCTGGGAGTTACTGG - Intergenic
1101604613 12:106238786-106238808 GCGCAGCCCCTGTGAATAACAGG - Exonic
1108143661 13:47453334-47453356 GAGGTACATCTTTGATTAACTGG + Intergenic
1110132768 13:72027663-72027685 GAGGACTCCCTGTGAATAACGGG + Intergenic
1112432461 13:99362328-99362350 GAGGATCTTCTGTGAAGCACTGG - Intronic
1112816545 13:103279733-103279755 GAATAACCTTTGTGAATCACTGG + Intergenic
1114339677 14:21730135-21730157 AAGGAACCTACGTGAATATCAGG - Intergenic
1118116300 14:62781046-62781068 AAAGAACCTATGTGAATATCGGG - Intronic
1119786289 14:77316707-77316729 CAGGAACCCCTGTGAATCAAGGG - Intronic
1125340946 15:38674672-38674694 GAGGAACATCTTTCAACAACAGG - Intergenic
1127293491 15:57590930-57590952 GAGGAACCTGTGTGCTTAGCTGG - Intergenic
1128477239 15:68007722-68007744 AAAGAACCTATGTGAATATCGGG + Intergenic
1134149055 16:11791371-11791393 GAGGCAGCTCTGTGAAGAGCTGG - Intronic
1136741482 16:32533846-32533868 AAGGAAGCTGTCTGAATAACAGG - Intergenic
1138277128 16:55743227-55743249 GAGTATCCTCTGTGGACAACTGG + Intergenic
1138283018 16:55786406-55786428 GAGTATCCTCTGTGGACAACTGG + Intergenic
1139448133 16:67011252-67011274 CAGGAACCTCTGGGAATAAAGGG - Intergenic
1139994386 16:70966187-70966209 CAGGAACATCTGTGAAGAATAGG - Intronic
1203028121 16_KI270728v1_random:541388-541410 AAGGAAGCTGTCTGAATAACAGG + Intergenic
1203043600 16_KI270728v1_random:793043-793065 AAGGAAGCTGTCTGAATAACAGG - Intergenic
1146556403 17:33828306-33828328 GAGGACCCTCAGTGAATCAAAGG - Intronic
1147348112 17:39817846-39817868 AAGTATCCTCTGTGAATAAGGGG - Intronic
1149557235 17:57582178-57582200 TAGCAATCTCTGTGAATAAGAGG + Intronic
1150113644 17:62524843-62524865 CAGGAACATTTGTGAATAACTGG + Intronic
1150467627 17:65407526-65407548 GTGGAACATGTGTGAGTAACTGG - Intergenic
1153161761 18:2213568-2213590 AAGGAAGTTCTGTGAATAAAGGG + Intergenic
1155121686 18:22827119-22827141 GAGGAAGTTCTGTGAAAAAGGGG - Intronic
1155401808 18:25447676-25447698 GAGGAAATTCTATGAATAGCAGG + Intergenic
1156329600 18:36107283-36107305 GAGGAAGTTCTTTTAATAACTGG - Intergenic
1157233527 18:45941799-45941821 GATGGACTTCTGTTAATAACAGG + Intronic
1157551638 18:48585839-48585861 GAGGCACATCTGTGAGTAGCAGG - Intronic
1158357533 18:56638155-56638177 TAGGAACCCCTGTGCATAAATGG + Intronic
1159264375 18:66061239-66061261 GAGAACCCACTGTCAATAACTGG + Intergenic
1162275418 19:9650018-9650040 AAAGAACCTATGTGAATATCGGG + Intronic
1163319308 19:16563875-16563897 GAATAACATCAGTGAATAACGGG + Intronic
1167766296 19:51484995-51485017 GAGAAATCTCTGTGGACAACAGG - Exonic
926450070 2:12992435-12992457 TAGGAACATTTGTGATTAACGGG + Intergenic
929614120 2:43294931-43294953 GATGAACATGTGTGAAGAACTGG - Intronic
932335040 2:70925808-70925830 GAGGAAGTTCTGTGAGTAGCTGG - Intronic
936051472 2:109227277-109227299 GAAGAAGCTCTGTGAATGTCAGG + Intronic
937635459 2:124151004-124151026 GAGATACATATGTGAATAACAGG + Intronic
937880360 2:126859797-126859819 GGTTAACCTCTCTGAATAACAGG + Intergenic
938146782 2:128841198-128841220 TAGGAGCTTCTGTGAAGAACTGG + Intergenic
940807127 2:158200332-158200354 GAGGAACCAAAGTAAATAACTGG - Intronic
940896556 2:159086603-159086625 GGGGAACCTCTGGAAATAAAGGG + Intronic
942839514 2:180342194-180342216 GAGGAACCTGTGTGAATGGGAGG - Intergenic
943939058 2:193966389-193966411 AAGTATCCTCTGTGAATAAATGG - Intergenic
945834895 2:214827833-214827855 GAGGAACTTCTGTGCAAAATCGG - Intergenic
948518676 2:238522272-238522294 GAGGCAGCTCTGAGAAGAACGGG - Intergenic
948971656 2:241432737-241432759 CTGGAACATCTTTGAATAACTGG - Intronic
1169292749 20:4366623-4366645 GAGGAAGCTATGTGGATAATGGG - Intergenic
1169784468 20:9344240-9344262 GAGAAAGCTCTGTGTGTAACTGG - Intronic
1170158127 20:13286847-13286869 GAGTACCCTCTGTTCATAACAGG - Intronic
1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG + Intronic
1172880594 20:38197338-38197360 GAGGAAACTATGTGGATATCTGG + Intergenic
1174947635 20:55005838-55005860 GAGCAGCCTTTGTGGATAACAGG - Intergenic
1178093913 21:29193668-29193690 GAGTAACCACTGGGAACAACAGG + Intergenic
1179517847 21:41921315-41921337 GAGGAACTCCAGTGAATATCTGG + Intronic
1184198496 22:42948117-42948139 GAGGAACCTGTGTGACAAAGGGG + Intronic
950101889 3:10362306-10362328 GAGGACCCTCTGTCAGCAACTGG + Intronic
950870267 3:16222269-16222291 GAGGAACCTCTCTGAAGCCCAGG - Intronic
953459629 3:43072315-43072337 GAGAGACCTCTGTGAATATCTGG + Intergenic
954249787 3:49358600-49358622 CAGGAACCTCTGAGAAAAAACGG - Exonic
954928280 3:54256858-54256880 AAGGAGCCTCTCTGATTAACAGG + Intronic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
958271283 3:91502407-91502429 AAAGAACCTATGTGAATATCGGG + Intergenic
959115975 3:102178489-102178511 GTGGAACCTTTGAGAATATCTGG + Intronic
963662132 3:148140502-148140524 GAGGAACTTCTGTCATTGACAGG - Intergenic
964396210 3:156248824-156248846 GAGGAATCTCTGTTAAGAAAGGG - Intronic
966142644 3:176772982-176773004 AAAGAACCTATGTGAATATCGGG + Intergenic
967279605 3:187808995-187809017 GCTGAACCCCTGTGAAGAACTGG - Intergenic
967497911 3:190162599-190162621 AAAGAACTTCTGTGAATATCGGG + Intergenic
967643310 3:191894904-191894926 AAGGAACCTCTGTGATCACCAGG - Intergenic
968421036 4:485057-485079 AAAGAACCTATGTGAATATCAGG + Intronic
971987497 4:33845564-33845586 AAAGAACCTATGTGAATATCAGG - Intergenic
972976447 4:44642161-44642183 AAGCAACCTCTGTGAATGAGTGG + Intronic
973535722 4:51880213-51880235 GAAGAACCAGTGTGACTAACAGG + Intronic
973871950 4:55175644-55175666 GAAGAACCTCTCTGGATACCTGG + Intergenic
974472609 4:62337974-62337996 AAAGAACCTATGTGAATATCAGG - Intergenic
975827057 4:78331085-78331107 AAAGAACCTATGTGAATATCGGG + Intronic
976217651 4:82730157-82730179 GAGGAACCTAGGAGAATAAGGGG + Intronic
976783768 4:88792458-88792480 TGGGAACCACTATGAATAACAGG - Intronic
979147556 4:117264455-117264477 AACGAACCTATGTGAATATCGGG - Intergenic
981772879 4:148330405-148330427 CTGGGACCTCTGTGAATCACTGG - Intronic
982183165 4:152767622-152767644 TACGAACCTCTGTGATTGACTGG + Intronic
985910743 5:2878702-2878724 GAGGAGCCTCTGGGAATTAGAGG + Intergenic
986345176 5:6827974-6827996 GAAGAACCTCTGTGATACACAGG - Intergenic
988026263 5:25694367-25694389 GTGGAAATTCTGTGAAAAACAGG + Intergenic
991644691 5:68789944-68789966 GAGGAACCTCAGAGAACCACAGG + Intergenic
993372458 5:87109645-87109667 GAGCACCCTTTGTGAATTACTGG - Intergenic
995687827 5:114790243-114790265 GTGCTACCTCTGTGACTAACGGG + Intergenic
996443517 5:123517956-123517978 AATGAACCTCTGGGAATAACAGG - Intronic
996761111 5:126986762-126986784 GAGGCACCTGTATGAAAAACTGG + Intronic
998588478 5:143453128-143453150 GAGGAATTTATGTGAGTAACAGG + Intergenic
1001523892 5:172415020-172415042 GAGGTCCCTCTGTGAACACCTGG + Intronic
1003999939 6:11588331-11588353 TAGGAAAGTCTGAGAATAACAGG - Intergenic
1005132433 6:22524522-22524544 AAAGAACCTATGTGAATATCGGG + Intergenic
1006392738 6:33768334-33768356 GAGGAGCCTCAGTGATGAACTGG + Intergenic
1008143458 6:47859818-47859840 GAGGAAGATCTGTGGCTAACTGG + Intergenic
1008393862 6:50984443-50984465 GAGAAAACTCTGAGTATAACGGG + Intergenic
1008536199 6:52508159-52508181 GAGGTACCCCTGGGAATAGCAGG + Intronic
1013923550 6:115440382-115440404 AAAGAACCTATGTGAATATCGGG - Intergenic
1017467705 6:154710170-154710192 AAGTATCCCCTGTGAATAACAGG - Intergenic
1019962553 7:4473065-4473087 GGGGAACCTTTGTGAACAAAAGG + Intergenic
1020688134 7:11320863-11320885 GAGTATCATCTTTGAATAACAGG - Intergenic
1024448382 7:49509322-49509344 GAAGTACCTCTGTCACTAACTGG + Intergenic
1026285661 7:68960621-68960643 ATGGAATTTCTGTGAATAACAGG - Intergenic
1028350784 7:89844863-89844885 GAGGAACCTCTGAAAATGAATGG - Intergenic
1032705252 7:134415711-134415733 GAAAAGCCTCTGTGAACAACTGG - Intergenic
1033421930 7:141211306-141211328 GAGGAGCATCTGCCAATAACTGG + Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035315804 7:157997160-157997182 GAGGCAGCTCTGTGCAGAACTGG - Intronic
1038885913 8:31663022-31663044 GAGGGCCTTCTGTGAATAGCAGG - Intronic
1041320025 8:56603350-56603372 GAGGAGCAACTGTGACTAACGGG - Intergenic
1042124663 8:65526075-65526097 GAGAAACATCTCTGAATAACAGG + Intergenic
1044107381 8:88227342-88227364 AAGGAACGTCTGTGATTAAAAGG + Intronic
1044996394 8:97841702-97841724 TATGAACCTCTGTGAGTAACTGG - Intronic
1046153308 8:110256455-110256477 AAAGAACCTATGTGAATATCGGG - Intergenic
1047539778 8:125753530-125753552 GAAGAACATATGTGAATATCTGG + Intergenic
1048479103 8:134771296-134771318 AAAGAACCTATGTGAATATCAGG + Intergenic
1049428882 8:142550108-142550130 GAGGAACATCTCCGAATAGCTGG + Intergenic
1052251004 9:26397356-26397378 GTGGAAGCTCAGTGAATAAATGG + Intergenic
1054792167 9:69266402-69266424 GAGGAACCTGGGTGAGTGACTGG + Intergenic
1055568131 9:77589596-77589618 GAGAAACCTCTGAGAGTAGCTGG + Intronic
1056237727 9:84612091-84612113 GAGCAACCTCTGGGAATTCCAGG - Intergenic
1059829341 9:118076113-118076135 GAAGAACCATTGTGAATACCTGG + Intergenic
1186288873 X:8074763-8074785 GAAGAAACTCTGTGTATAAGTGG - Intergenic
1188303910 X:28539149-28539171 GAGGATGCTCTGTGAATTCCTGG - Intergenic
1188723750 X:33554301-33554323 GAGGAACCTTTGTTATTAAATGG + Intergenic
1189417435 X:40827619-40827641 GAGAAACTTCTGTGAATCAACGG + Intergenic
1190166668 X:48078779-48078801 AAAGAACCTATGTGAATATCGGG + Intergenic
1190229694 X:48572755-48572777 GAGGAATCCCTGACAATAACAGG + Intergenic
1193594803 X:83433019-83433041 AAAGAACCTATGTGAATATCGGG + Intergenic
1197019705 X:121671957-121671979 GAGGAACCACAGTGAAACACGGG + Intergenic
1197024382 X:121730240-121730262 GTGGAATATCTGTGAATAAACGG + Intergenic
1197966166 X:132064262-132064284 GAGAGAACTCTGTGAAGAACTGG - Intergenic
1200454714 Y:3375910-3375932 GAGGAACCTATGTGACTATCGGG + Intergenic