ID: 1083300663

View in Genome Browser
Species Human (GRCh38)
Location 11:61738201-61738223
Sequence GCCCAAAGTGAGCCCCCACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083300659_1083300663 16 Left 1083300659 11:61738162-61738184 CCGCAGACAGCTCCTGGATGTCC 0: 1
1: 0
2: 1
3: 18
4: 247
Right 1083300663 11:61738201-61738223 GCCCAAAGTGAGCCCCCACCTGG 0: 1
1: 0
2: 1
3: 21
4: 165
1083300660_1083300663 4 Left 1083300660 11:61738174-61738196 CCTGGATGTCCTGCAGCGAAGCA 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1083300663 11:61738201-61738223 GCCCAAAGTGAGCCCCCACCTGG 0: 1
1: 0
2: 1
3: 21
4: 165
1083300661_1083300663 -5 Left 1083300661 11:61738183-61738205 CCTGCAGCGAAGCACCAAGCCCA 0: 1
1: 0
2: 1
3: 18
4: 156
Right 1083300663 11:61738201-61738223 GCCCAAAGTGAGCCCCCACCTGG 0: 1
1: 0
2: 1
3: 21
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083300663 Original CRISPR GCCCAAAGTGAGCCCCCACC TGG Exonic