ID: 1083300748

View in Genome Browser
Species Human (GRCh38)
Location 11:61738590-61738612
Sequence TCCCTAGGCTCAGGGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083300740_1083300748 -1 Left 1083300740 11:61738568-61738590 CCTCTGCCGAAGCCTCTGAGATT 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG 0: 1
1: 0
2: 1
3: 33
4: 345
1083300741_1083300748 -7 Left 1083300741 11:61738574-61738596 CCGAAGCCTCTGAGATTCCCTAG 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG 0: 1
1: 0
2: 1
3: 33
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083300748 Original CRISPR TCCCTAGGCTCAGGGAGGGC TGG Intronic
900176946 1:1295170-1295192 GCCCTAGGCTGAGGGCCGGCTGG + Intronic
900427529 1:2587334-2587356 TCCCTAAGCTCAGGGCGTTCGGG + Intronic
901261632 1:7875803-7875825 TCCCCAGGCTCAGGGACTGGTGG - Intergenic
901866788 1:12111733-12111755 TCCTGAGGCTCAGAGAGGACAGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902862645 1:19257237-19257259 GCCGGAGGCTCAGGGAGAGCAGG + Intronic
902877416 1:19349282-19349304 TGCCTAGGCTCAGGGCTGGGTGG + Intronic
902986674 1:20158723-20158745 TCTCTAGGCAGAGGGAGGACAGG + Intergenic
903382173 1:22905022-22905044 AGCCTGGGCTCAGGGAGGACTGG + Intronic
904277624 1:29394733-29394755 TCCCCATGCTCAGGGATGGGGGG - Intergenic
904754093 1:32758592-32758614 TCCCTGGGATCAGAGAGAGCTGG - Intronic
904769176 1:32871258-32871280 TCCCTAGGCCCAGGGAAGGGAGG - Intronic
905075843 1:35269350-35269372 TATCTAGGCCCAGGGAGGGGAGG + Intronic
905632227 1:39525187-39525209 TCCCCAGGCTCTGGGAGGCCAGG - Intronic
905665513 1:39761001-39761023 TCCCCAGTCTCTGGGAGGCCAGG + Intronic
905867812 1:41385731-41385753 ACCCTAGGCTGACGGAGGGTGGG + Intergenic
907313858 1:53555030-53555052 TCCCTAGGCTCAGGGACCCACGG + Intronic
908137817 1:61151133-61151155 TCCCTGGGCTCAGGATAGGCTGG + Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912744272 1:112232142-112232164 CCACTAGGCTCAGAGAGGGCTGG + Intergenic
912798354 1:112706237-112706259 TCCCTAGGTGTAGGGTGGGCCGG - Exonic
913229339 1:116728784-116728806 TACATGGGCTCAGGGAAGGCAGG - Intergenic
915490400 1:156247306-156247328 TACCTGGGCTCAGGAGGGGCAGG - Intronic
915534343 1:156526010-156526032 TGCCTAGACTCAGGAAGGGCAGG + Exonic
915663554 1:157424179-157424201 TCCCTTGGCTGGGGGAGGGAGGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
918127232 1:181595431-181595453 TCCCCAGGCACAGGCGGGGCTGG + Intronic
919060030 1:192620720-192620742 TCCCCAGGCTCATGGACTGCTGG + Intergenic
919147149 1:193650718-193650740 CACCTAGGACCAGGGAGGGCCGG - Intergenic
922718197 1:227887611-227887633 GCCCTAAGCTCAGGGCGGGAGGG - Intergenic
922740505 1:228011762-228011784 TCCCACAGCTCTGGGAGGGCTGG - Intronic
924454089 1:244204236-244204258 TTCCCAGGCACAGGCAGGGCAGG - Intergenic
1064420275 10:15184942-15184964 TCCCAACGCCCAGGGAGGACGGG + Intergenic
1064922496 10:20533634-20533656 TCCCTAGACTCTGGGACGGTTGG + Intergenic
1069683429 10:70301074-70301096 TGACAAGGCTCAGAGAGGGCAGG + Exonic
1069877049 10:71569282-71569304 TGCCTAGGAGAAGGGAGGGCTGG - Intronic
1070324414 10:75378520-75378542 TGCCTGGGCTGAGGGAGGGAGGG - Intergenic
1070788584 10:79176482-79176504 TCCTGAGGCTCAGGGAGGTAGGG + Intronic
1071515026 10:86291491-86291513 CCCCTGGGCTGAGGCAGGGCTGG - Intronic
1071786466 10:88905850-88905872 GGCTTAGGGTCAGGGAGGGCAGG + Intronic
1072687770 10:97548987-97549009 TGGCTGGGCTCAGGGAGAGCAGG - Intronic
1072722948 10:97792047-97792069 TTCCTAGGCTCAGGGGGTCCAGG + Intergenic
1073214380 10:101828568-101828590 TCTCTAGGCTGAGGGAGGGAGGG - Intronic
1073582574 10:104681583-104681605 AACCTAGGCTCAGAGAGGGCTGG - Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1075079245 10:119371634-119371656 GCCCTGAGCTCCGGGAGGGCAGG - Intronic
1075961135 10:126568484-126568506 TCCCTGACCTCAGGAAGGGCAGG + Intronic
1076003744 10:126931799-126931821 TCCCGAAGCCCAGGGAGAGCAGG - Intronic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077137495 11:1008326-1008348 GCCCTGGGCTCCGGGACGGCAGG + Intronic
1077247724 11:1547485-1547507 TCCTTGCCCTCAGGGAGGGCGGG + Intergenic
1078088975 11:8252115-8252137 TCCCCAGGCTCATGGCAGGCGGG + Intronic
1078767143 11:14309412-14309434 TCCCCAGGCTCTTAGAGGGCTGG + Intronic
1079360069 11:19763045-19763067 TCCATAAGCTCCAGGAGGGCAGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082238871 11:49851963-49851985 TCCCCAGGCACAGGGAGTTCTGG - Intergenic
1082243273 11:49892366-49892388 TCCCCAGGCACAGGGAGCTCTGG + Intergenic
1082828324 11:57597651-57597673 CCCCCAGGGTCAGGGAGGGTGGG - Exonic
1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG + Intronic
1083319103 11:61834478-61834500 CCCCTGGGCTCAGGGAGGTGAGG + Intronic
1083332898 11:61907244-61907266 AACCTAGGCCCAGGGAGGGAAGG - Intronic
1083566958 11:63727065-63727087 TCCCTGGGCTCAGGGACTACAGG - Intronic
1083566960 11:63727072-63727094 TCCCTGAGCCCAGGGAGGTCAGG + Intronic
1084398766 11:68931701-68931723 TCCCTGGGAGCAGGGAGGACAGG + Intronic
1084599244 11:70135153-70135175 TCCCCAGGGCCAGGGAGGGAGGG - Intronic
1085033874 11:73288757-73288779 TACCCAGGCTCAGAGAGGGTAGG + Intronic
1085789546 11:79485352-79485374 TCCCTAGGCACAATGAGGGAAGG - Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088271325 11:108037413-108037435 CCCCTAGGCTCAGTGATTGCTGG + Intronic
1091113543 11:132993634-132993656 ACTCTAGGCTCGCGGAGGGCAGG - Intronic
1091545594 12:1499563-1499585 TCCCTGTGGACAGGGAGGGCTGG - Intergenic
1091784958 12:3237723-3237745 TCCCCAGGCACAGAGAGGGCAGG + Intronic
1092916595 12:13194854-13194876 TCCCAACCCTCAGGGAGGGGAGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095968451 12:47884802-47884824 TCCCCAGGCCAAGGGATGGCAGG + Intronic
1096115104 12:49050969-49050991 TCCCCAGGCTCAGACAGGGCTGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097223819 12:57465284-57465306 TCCCTCAGCTCAGGGTGGGTGGG + Intronic
1099445234 12:82744020-82744042 TCCCTGTGCTCTGGGAGGCCAGG + Intronic
1099902539 12:88729579-88729601 TCCATTGGCTCAGGCAAGGCAGG - Intergenic
1102179347 12:110900502-110900524 ACCCTAAGCTCAGAGAGGACAGG + Intronic
1102382822 12:112482404-112482426 TCCCTAGGCTCGATGAGGGCAGG - Intronic
1103224475 12:119274922-119274944 CCCCTAGGCTTGGGGAGGGAAGG - Intergenic
1103744953 12:123116170-123116192 TCTCTAAGCTTAGGGAGGCCTGG + Intronic
1103848359 12:123915083-123915105 TCCCTAGCCTCAGCGAGGCTGGG + Intronic
1104040696 12:125128457-125128479 TCCCTAGCCTCTGAGAGGTCAGG + Intronic
1104977613 12:132559298-132559320 AACCGAGGCCCAGGGAGGGCGGG + Intronic
1106220808 13:27744845-27744867 GCCCTAGGCTCAAAGAGGGATGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108056548 13:46490954-46490976 TCCTGAGACTCAGGCAGGGCAGG - Intergenic
1108426953 13:50312188-50312210 TCCCTAGCCCCAGGGACAGCAGG - Intronic
1108453027 13:50586264-50586286 TTCCTAGGCTAAGGGAAGGGAGG - Intronic
1108505035 13:51105164-51105186 TCCCTGGGCTCAGAAGGGGCTGG + Intergenic
1110419630 13:75291348-75291370 TTACTAGGCCCAGGGAGAGCTGG - Intronic
1112637052 13:101226930-101226952 TCCCTAGGTGCAGGAATGGCTGG + Intronic
1113260063 13:108552031-108552053 TCCCTAGACTCAGGGAGATATGG - Intergenic
1113778520 13:112962708-112962730 CCCCCAGGCTCTGGGAGGGAAGG + Intronic
1116257238 14:42571453-42571475 TCCCTGGGCTCAGCTAGAGCAGG + Intergenic
1116664981 14:47763025-47763047 TCCCAGAGCTCAGGTAGGGCGGG + Intergenic
1118809430 14:69262112-69262134 GCCCTAGTCTCAGGCAAGGCAGG + Intronic
1119262538 14:73245992-73246014 TCCCTGGGCTCGGGCGGGGCGGG + Intronic
1119421070 14:74508390-74508412 GCCCGGGGCTCAGGGAGGGAGGG - Intronic
1119436265 14:74599811-74599833 TGCCCATGCTCAGGGAGTGCTGG - Intronic
1119618847 14:76116675-76116697 TCACTGGGCTCCGGGAAGGCAGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1121011590 14:90523137-90523159 TCCCTGGGAGCAGGGAGGGATGG - Intergenic
1122485266 14:102075382-102075404 TCTCTGGGCTAAGGGAGGCCAGG - Intergenic
1122602819 14:102929866-102929888 CCCATAGGCTCGGGGAGGGCGGG + Intronic
1122820776 14:104343739-104343761 AACCCAGGCTCAGAGAGGGCAGG - Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1124010565 15:25835459-25835481 TCCCTGGTCGCAGTGAGGGCAGG + Intronic
1125518395 15:40335455-40335477 TCCCTGGGCCCAGGGAGAGCGGG - Exonic
1125593881 15:40872443-40872465 TCCCCAAGGCCAGGGAGGGCGGG - Exonic
1125607271 15:40947658-40947680 TCCACAGGCTCGGGGAGAGCAGG - Intergenic
1125622214 15:41073600-41073622 TCCCTGGGTTCACGGAGGGTGGG + Intronic
1125734764 15:41917024-41917046 GCCCGAGGCTCAAGGATGGCAGG + Intronic
1128221124 15:65969408-65969430 TCCCATGGGTCAGGGAGGGATGG + Intronic
1128349486 15:66879647-66879669 TCCCTAGACACAGTGAGGGGTGG + Intergenic
1129334534 15:74844188-74844210 TCCCTCGGTTCGGGGAGGGGGGG + Exonic
1129676802 15:77636085-77636107 GACCGAGGCTCTGGGAGGGCTGG + Intronic
1129983700 15:79897264-79897286 GGCCCAGGCTCAGGGAGGTCAGG - Intronic
1130285625 15:82552070-82552092 TCACAAGGCACAGGAAGGGCAGG + Intronic
1132683163 16:1152166-1152188 GCCCTTGTCCCAGGGAGGGCTGG - Intergenic
1132990635 16:2791104-2791126 TCTGGAGGCTCAGGGAGGGTGGG - Intergenic
1133767169 16:8846141-8846163 TCGCTGGGCCCAGGGAGTGCTGG - Intronic
1135266545 16:21031483-21031505 TCCCAATACTCAGGGAGGCCAGG + Intronic
1135521800 16:23183305-23183327 TCGCTCCGCGCAGGGAGGGCAGG + Intronic
1136276695 16:29183002-29183024 TCCCTGGGGTCAGGAGGGGCTGG + Intergenic
1137675193 16:50300668-50300690 TCCCAGGGCTTAGGCAGGGCTGG + Intronic
1138525022 16:57600245-57600267 TGCCTGTGCTCAGGGAAGGCAGG - Intergenic
1138529911 16:57629422-57629444 AACCGAGGCTCTGGGAGGGCAGG + Intronic
1139383501 16:66549514-66549536 TCCCCACTCCCAGGGAGGGCAGG + Intronic
1139504402 16:67391878-67391900 GCCCTAGGCGCAGGGAGTGCTGG - Exonic
1139517487 16:67460364-67460386 TCCCTAGGCTCAGGAGTGGGAGG + Intronic
1139546476 16:67652268-67652290 TCCCCAGGCTCAAGGAGGCTGGG - Exonic
1139678125 16:68539416-68539438 GCCCGAGGCTCTGGGTGGGCCGG + Exonic
1141053403 16:80793644-80793666 ACCCTAAGCTCGGTGAGGGCAGG - Intronic
1141935702 16:87236552-87236574 TCCCCAGGCAGAGGGAGGGGCGG - Intronic
1142081077 16:88149063-88149085 TCCCTGGGGTCAGGAGGGGCTGG + Intergenic
1142290274 16:89190908-89190930 AACTGAGGCTCAGGGAGGGCAGG - Intronic
1142499928 17:326568-326590 TCACTAGGCTGAGGGACAGCAGG + Intronic
1142812586 17:2402114-2402136 TCGCCAGGCGCGGGGAGGGCCGG - Intergenic
1143082878 17:4394544-4394566 TCTCTTGGCTCAGGGATGGATGG + Intergenic
1143324162 17:6087618-6087640 TCTCTGAGCCCAGGGAGGGCAGG + Intronic
1143523908 17:7461851-7461873 TCCCAAGGGGCAGGGAGGCCAGG + Exonic
1144705871 17:17367532-17367554 TGCCAAGGCTCAGCGAGGGAAGG + Intergenic
1144782912 17:17816831-17816853 TGGCTAGGCACAGGGAGGACGGG + Intronic
1145005518 17:19335600-19335622 TCCCTAGGCTAAGACAGGGGTGG + Exonic
1145018898 17:19415249-19415271 TCGCTGGGGTCAGGGAGAGCAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146973218 17:37089523-37089545 TCTCTAGCCTCAGTGAGGCCTGG + Intronic
1147742033 17:42675276-42675298 TCCCCAGGCTCAGGGAAGGGGGG + Intronic
1149076166 17:52597786-52597808 TCTCCAGGCAGAGGGAGGGCAGG + Intergenic
1149992650 17:61391492-61391514 GCTCTAGGCACAGGCAGGGCAGG + Intronic
1151508574 17:74544563-74544585 GCCCTAGGCTCAGGCAGGCCTGG + Intronic
1152309138 17:79538537-79538559 TCCCTAGGCACAGTAAGAGCAGG + Intergenic
1152771710 17:82173847-82173869 TCCCTAGGAACTGGGTGGGCGGG - Intronic
1153342432 18:3989102-3989124 TCCCTATGCTCCTGGAGGGAAGG + Intronic
1155528258 18:26739795-26739817 ACCATAGGCTCCAGGAGGGCAGG - Intergenic
1155957718 18:31967614-31967636 TCCCCAGGCTTAGGGAGCGGTGG + Intergenic
1156586231 18:38434012-38434034 GCCCTACGCAGAGGGAGGGCAGG - Intergenic
1157539055 18:48486332-48486354 TTCCTAGCCTCAGGAAGGCCTGG + Intergenic
1157615796 18:48987104-48987126 TCCAGAGGCTGTGGGAGGGCGGG - Intergenic
1157731036 18:50004612-50004634 TCCCTAGCCTAGGGTAGGGCTGG + Intronic
1158346345 18:56520565-56520587 TCCCTACTCTCAGTGAGGGGAGG - Intergenic
1160700095 19:501941-501963 TCCCTGGGGGCAGGGAGGGTGGG + Intronic
1160756201 19:758221-758243 TCCCGGGGCTCAGGTACGGCTGG - Exonic
1160759395 19:775391-775413 TCCCTGGGGTCAGTGAGTGCTGG + Intergenic
1161021009 19:2011494-2011516 GCCCCAGGCTCAGGGATGGAAGG - Intronic
1161221447 19:3119949-3119971 TCCCCAGGCCCAGAGAGGGCTGG - Intronic
1161238002 19:3207478-3207500 TGCCCAGGCTCAGGTGGGGCAGG + Intronic
1161428284 19:4216449-4216471 TCCCTGAGGTCAGGGTGGGCAGG + Intronic
1161749326 19:6083028-6083050 TCCCTGGGCTCAGGGAGTACGGG + Intronic
1161760421 19:6167168-6167190 ACCCTAGGCTGAGGGGGGGCAGG - Intronic
1162011777 19:7820954-7820976 TCCCTAGGCTCAGGGCAAGCTGG + Intergenic
1162659741 19:12159764-12159786 TCCCAGGACTCGGGGAGGGCTGG - Intergenic
1162747476 19:12806806-12806828 CCCCTAGGGCCAGGGAGGGGAGG + Intronic
1163033973 19:14561172-14561194 TCCCTGGGCTCTGGGTGGGTGGG + Intronic
1163156498 19:15442638-15442660 GCCCTGACCTCAGGGAGGGCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164481104 19:28611537-28611559 TCTCCAGGCAGAGGGAGGGCAGG + Intergenic
1164483511 19:28634028-28634050 TCCCTAGGGAAAGGGAGGGATGG + Intergenic
1164675065 19:30095325-30095347 ACACTGGGCTGAGGGAGGGCTGG + Intergenic
1165058854 19:33195144-33195166 TCTCCAGGCTCAGCGCGGGCGGG - Intronic
1165312146 19:35034781-35034803 AACCAAGGCTCAGGGAGGGAAGG + Intronic
1165850848 19:38849666-38849688 GCCCTAGGCGCTGGGAAGGCCGG - Intronic
1166195514 19:41203304-41203326 TCTTTGGGCTCAGTGAGGGCTGG + Intronic
1166257863 19:41619129-41619151 GCCCTGGGCTCTGGGTGGGCCGG - Exonic
1167029319 19:46946837-46946859 TCCCTAGTCTCTGGGATTGCAGG + Intronic
1167038375 19:47007777-47007799 TCCCAAAGCACTGGGAGGGCAGG + Intergenic
1167439691 19:49500934-49500956 TACCCAGGTCCAGGGAGGGCGGG + Intergenic
1167477153 19:49707633-49707655 TCCCCAGAACCAGGGAGGGCTGG - Intronic
1168330321 19:55564258-55564280 TCTTTGGGCTCAGGGAGGGAGGG - Intergenic
926767005 2:16330599-16330621 CCCGTGGGCTCAGGGTGGGCGGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928411471 2:31057785-31057807 TTCCCAGGCTCAGGGCGGGGTGG - Intronic
928773210 2:34726958-34726980 TCCCTGAGCTCGGTGAGGGCAGG - Intergenic
929773429 2:44912496-44912518 TACCTGGGCTCAGAGAGGCCAGG - Intergenic
929837943 2:45425737-45425759 TCCCTTGGCTAGGGGAGGGAGGG - Intronic
930105095 2:47633111-47633133 GCCCTGGCCTCAGGCAGGGCTGG + Intergenic
930518596 2:52435793-52435815 TCTCCAGGCAGAGGGAGGGCAGG + Intergenic
931510907 2:62992695-62992717 TCTCTAGCCTCAAGGAGGCCTGG - Intronic
931632240 2:64311607-64311629 GCCCCAGGCTCAGGGAAGGAAGG + Intergenic
931698341 2:64888950-64888972 TCTCCAGGCAGAGGGAGGGCAGG - Intergenic
933713901 2:85346210-85346232 TACCTAGACTCAGGCAGGGCAGG + Intronic
933775737 2:85770226-85770248 TCCTTGGGCTCAGGGAGCCCCGG - Intronic
933840954 2:86285119-86285141 ACCCAAGGCTGAGGGAGGGGTGG - Intronic
935019559 2:99216588-99216610 TCCCTAGGCTCAGTCAGAGCAGG + Intronic
937415429 2:121710795-121710817 TGCCTAGGCTCAGAGAGGGAAGG + Intergenic
937977967 2:127593146-127593168 TCCCTGGGGTCTGGGAGAGCTGG + Intronic
940518427 2:154712188-154712210 TTACCAGGCTCAGGGAGGTCTGG - Intronic
940794503 2:158062650-158062672 TCCCTTGGGTCCAGGAGGGCAGG + Intronic
944383796 2:199141698-199141720 GCCCTAGGCTCAGCCAGAGCAGG + Intergenic
944764277 2:202849042-202849064 TCCCTTGGCTGGGGGAGGGAGGG - Intronic
946026012 2:216672066-216672088 TCCGAGGGCTCAGGGAAGGCAGG - Intergenic
946363586 2:219234819-219234841 TCCCTAGGTTCAGGGTCGGAGGG + Exonic
948371237 2:237490235-237490257 TCCATGGGCTCAGGGAGGTGAGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948746056 2:240095309-240095331 TGCCTGGGCTCTGGGAGTGCAGG - Intergenic
948755042 2:240154761-240154783 GCCCTGGGCTCAGGAAGTGCAGG + Intergenic
948936371 2:241167554-241167576 GGCCTTGGCTCAGGGAGGCCAGG - Intronic
948972705 2:241441628-241441650 GACCTAGACACAGGGAGGGCCGG + Intronic
1168849229 20:965278-965300 TAGCCAGGCTCAGGGAGGGACGG + Intronic
1168954223 20:1823568-1823590 CCCTGAGGCTCAGAGAGGGCAGG + Intergenic
1169278252 20:4247796-4247818 GCCATAGGCTCAGGGAGAACAGG + Intronic
1169937231 20:10896668-10896690 TCCCAAGGCTCCAGGAGGGTGGG - Intergenic
1171964278 20:31517506-31517528 TGACTGGGCTCAGTGAGGGCAGG - Intronic
1173138724 20:40463315-40463337 TCCCGAAGCTCAGTGGGGGCAGG - Intergenic
1173250999 20:41364227-41364249 TCCCTGCCCACAGGGAGGGCTGG - Intronic
1173388642 20:42611688-42611710 TCTCAAGGCTCAGGGAAGGAAGG - Intronic
1174240037 20:49126308-49126330 TCCCAACGCTCTGGGAGGCCAGG + Intronic
1175514446 20:59559984-59560006 CCCCTTGGCTTAGGGAGGCCTGG + Intergenic
1179959330 21:44759352-44759374 TCAGCGGGCTCAGGGAGGGCTGG - Intergenic
1181164915 22:20978016-20978038 TCCCGAGGCACATGGAGGGGTGG + Intronic
1181235385 22:21445328-21445350 CCCTTTGGCTCTGGGAGGGCGGG + Exonic
1182638721 22:31750062-31750084 TCCGTAGGCTCAGGTAGACCTGG - Exonic
1183091524 22:35525466-35525488 TTCCCAGGCAGAGGGAGGGCGGG + Intergenic
1183352788 22:37343343-37343365 AACTGAGGCTCAGGGAGGGCAGG - Intergenic
1183540854 22:38428522-38428544 TCCCTATGCTCAGGGCAAGCAGG - Intronic
1184184230 22:42853636-42853658 TCCCAAGGCACAGGGAGCTCTGG - Intronic
1185208504 22:49553739-49553761 TTCCTAGGATCACGGAGGCCTGG - Intronic
1185284424 22:49994011-49994033 TCCCTAGCCTGGGGGAGGTCAGG - Intergenic
1185300131 22:50075213-50075235 CCGCCAGACTCAGGGAGGGCTGG + Intronic
949158159 3:851425-851447 TCTCCAGGCAGAGGGAGGGCAGG + Intergenic
950077227 3:10195792-10195814 TCCCCTGGCTCAGGGCCGGCTGG - Intronic
950225967 3:11234749-11234771 TCCCTCTCCTCAGGCAGGGCGGG + Intronic
950688923 3:14640223-14640245 TCCCTTGGCTCTGGGAGGCTTGG + Intergenic
951562439 3:23982095-23982117 TCCCTAGGCTGAGTCAGAGCTGG - Intergenic
954374979 3:50189286-50189308 TCCTCAGGGTCAGGGAGGGTGGG + Intergenic
954457505 3:50607818-50607840 TCCTTAGGCATAGGCAGGGCCGG + Exonic
955348804 3:58179581-58179603 TCCCCGGCCTCAGGGAGCGCTGG - Intergenic
959552604 3:107680005-107680027 TCCCTGGGATCAGGGAAGGCTGG + Intronic
960857866 3:122121598-122121620 TACCTAGACTCTGTGAGGGCAGG + Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
961618876 3:128207314-128207336 TCCCTTGGCTCTGTGAGAGCAGG + Intronic
961657991 3:128453785-128453807 TCCCAAGCCCCATGGAGGGCAGG + Intergenic
962785813 3:138767726-138767748 GCCGTAGCCTCAGGGAGAGCTGG - Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966880147 3:184345451-184345473 CCCATAGGCTCCGGGAGGGCAGG - Intronic
968488543 4:877029-877051 CGCCTAGGCTCATGGGGGGCTGG - Intronic
968742785 4:2339878-2339900 GCCCCAGGAGCAGGGAGGGCAGG + Intronic
969266919 4:6070544-6070566 GCTCTCGGCTCAGGGAGGACGGG - Intronic
969418253 4:7074923-7074945 ACCCAAGGCTCAGGCAGGGGTGG + Intergenic
969950548 4:10831097-10831119 TCCCAAGGATCAGGAAGTGCTGG - Intergenic
972072580 4:35039083-35039105 TCCCCAGGCTCAGCCAGAGCAGG + Intergenic
972372524 4:38438433-38438455 TCACTTGGCTGAGGGAGGGAGGG + Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
976118959 4:81759302-81759324 TCCCTAGGATAAGGCAGGGAGGG - Intronic
978408071 4:108400211-108400233 CCCAGAGGCTGAGGGAGGGCAGG - Intergenic
978429733 4:108620953-108620975 TCCTTAGTCTTTGGGAGGGCAGG + Intronic
978506679 4:109465121-109465143 TTCCTAGCTTCAGGGAAGGCTGG + Intronic
981865423 4:149412247-149412269 TTCTTAGGCTCAGGGTGGCCTGG - Intergenic
981971346 4:150666049-150666071 TGCCTAGGGGCAGGGAGGGTGGG + Intronic
985520935 5:373690-373712 CCCCCAGGCTCAGGGAGGGCGGG + Intronic
985682159 5:1261750-1261772 CCCATAGGCTCAGGGTGAGCCGG - Intronic
985995383 5:3594708-3594730 TTCCCAGGCTCAGGGAGGCGAGG + Intergenic
988527555 5:32000126-32000148 TCCCTTTCCTCAGGGATGGCAGG + Exonic
991035975 5:62127856-62127878 TCAGTAGGCTCAGGGAGCCCTGG - Intergenic
992205537 5:74427147-74427169 TCCCTGAGGTTAGGGAGGGCAGG - Intergenic
993328142 5:86567014-86567036 TCTCCAGGCAGAGGGAGGGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
997197629 5:131990363-131990385 TCCCAGGGATCAGGGAGGTCTGG + Intronic
997202190 5:132017753-132017775 TCTCTTGGTTCAGTGAGGGCTGG + Intergenic
997212165 5:132083244-132083266 CCCCAAGGCCCAGAGAGGGCAGG + Intergenic
997530855 5:134580328-134580350 TCCCGGGGCCCAGGGCGGGCCGG + Exonic
997598127 5:135120783-135120805 TCACTAGGCCCTGGGAGGGCAGG - Intronic
998139674 5:139692860-139692882 AAGCTAGGCTCAGGAAGGGCTGG - Intergenic
999145439 5:149390220-149390242 TCCCCAGGGACAGGGAGGGGGGG - Intronic
999267409 5:150275917-150275939 TCCCCATTCTCAGGGAGGGGAGG - Intronic
999868398 5:155726905-155726927 TCCCTAGGCAATGGGTGGGCGGG - Intergenic
1001407097 5:171483976-171483998 TCCCAGAGCTCAGGGAGGGTGGG - Intergenic
1002468124 5:179417935-179417957 GCCATGGGCTCAGGGAGGGGAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006083804 6:31582255-31582277 GCCCCAGGATCAGGGAGGACTGG - Exonic
1006122077 6:31813561-31813583 TCCCTAAGTTCTGGGATGGCAGG + Intronic
1006474214 6:34244566-34244588 CCCCCAGGCCCAGGGAGGGCAGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007357576 6:41332598-41332620 GGCCTGGGCTCAGGGAGTGCAGG - Intergenic
1007391151 6:41550034-41550056 TCCCTAGACCAAGGCAGGGCAGG + Intronic
1007751607 6:44074898-44074920 TCCCTAGGCCCATGGAAAGCTGG - Intergenic
1008044473 6:46837613-46837635 TTCCCAGGCTAAGGGAGGCCAGG + Intronic
1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG + Intergenic
1015174856 6:130295838-130295860 TGCCTAGGGTCAAGAAGGGCAGG - Intronic
1015503128 6:133953441-133953463 ACCCTGGGCACAGGGAGCGCGGG + Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1018857595 6:167685722-167685744 CCCCAGGGCTCAGGGAGGGAGGG + Intergenic
1019166258 6:170099518-170099540 TGCCTGGGCTCAGTGAGGTCAGG - Intergenic
1019182840 6:170202629-170202651 ACTGTAAGCTCAGGGAGGGCGGG - Intergenic
1019339703 7:503232-503254 TCCCCAGGGCCTGGGAGGGCAGG - Intronic
1019756182 7:2771921-2771943 ACCCAAGGCACAGTGAGGGCGGG - Intronic
1019901284 7:4022522-4022544 TGCCTGGGCTGAGGGAGGGAAGG + Intronic
1024226620 7:47330495-47330517 TCCTGAGGCTGAGGGAGGGAGGG + Intronic
1027059462 7:75073861-75073883 GCCCAAGGCTCAGGGAGGCGTGG + Intronic
1028108985 7:86916162-86916184 TCCCTACTCTCAGGGATGCCTGG + Intronic
1029139608 7:98400768-98400790 GCCCGGGGCTCAGGGAGGTCAGG - Intronic
1029991046 7:104962773-104962795 TCTCTAGGCTGAGGGAGGAGGGG - Intergenic
1032719549 7:134539373-134539395 TCCATAGGCTTAGGGAGGGAGGG + Intronic
1032724512 7:134578142-134578164 TCCACAGGCTTAGGGAGGGAGGG + Intronic
1034558088 7:151862744-151862766 TCCCCAGGCGCAGGGAGCACTGG + Intronic
1038411872 8:27365366-27365388 TCCCTAGCCCGAGGGAAGGCAGG + Intronic
1038473558 8:27845400-27845422 TCCCAAGGCTCTGGGACTGCAGG - Intergenic
1040607566 8:48949631-48949653 TCCCTAGGTTCAGGTAGAGCTGG - Intergenic
1041391435 8:57350579-57350601 TTCCTAGGCTCAGGTCGGCCAGG - Intergenic
1042103341 8:65297721-65297743 ACCCCAGCCTCATGGAGGGCTGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1047760739 8:127952258-127952280 TCCCTGGGCACATGGAGGCCAGG - Intergenic
1048985022 8:139730593-139730615 TTCCAAGGCCCAGGGAGGGTGGG + Exonic
1049455158 8:142682922-142682944 TCGCAAGGCTCAGAGAGGTCTGG - Intergenic
1049467272 8:142757304-142757326 CAGCAAGGCTCAGGGAGGGCTGG + Intergenic
1049591863 8:143466332-143466354 TCCCTGGGCTCTAGGTGGGCAGG + Intronic
1049662127 8:143824220-143824242 TCCCTGGGCCCAGAGAGGGCTGG - Intronic
1050822850 9:9903718-9903740 ACCCTAGGATCAGGGATGCCAGG + Intronic
1052178299 9:25492693-25492715 TCCCGAAGCTCAAAGAGGGCTGG - Intergenic
1053142297 9:35689659-35689681 GCCCTAGGCGCGGGGAGAGCAGG + Intronic
1053155466 9:35775346-35775368 TCCCTAGGCTGTGGGAAGGAGGG + Intergenic
1053653122 9:40189322-40189344 TTCCCAGGCTAAGGGAGGCCAGG - Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1053903525 9:42818625-42818647 TTCCCAGGCTAAGGGAGGCCAGG - Intergenic
1054531462 9:66186901-66186923 TTCCCAGGCTAAGGGAGGCCAGG + Intergenic
1057272251 9:93657832-93657854 TCCCCTTGCTCAGGTAGGGCTGG + Intronic
1057295072 9:93830029-93830051 TCACTAGGCTAATGGGGGGCAGG - Intergenic
1057861682 9:98645644-98645666 TCCCTGGTCCCAGGCAGGGCTGG - Intronic
1058757636 9:108097917-108097939 TCCCTCTCCTCAGGCAGGGCAGG + Intergenic
1059415492 9:114159810-114159832 TACCAAGGCTCAGGGAAGGCAGG - Intronic
1061193733 9:129096298-129096320 AACCAAGGCTCAGGGAGGGGCGG + Intronic
1061198162 9:129119850-129119872 TCCCCAGAGTGAGGGAGGGCAGG + Intronic
1061621093 9:131811838-131811860 GCCCCGGGGTCAGGGAGGGCTGG - Intergenic
1061878425 9:133556484-133556506 TCCCAAGCCTCAGCAAGGGCTGG + Intronic
1061909411 9:133714854-133714876 TTTCTAGGCCCAGGGAGGGCAGG + Intronic
1061957281 9:133970224-133970246 TCCCTGGGCACAGGAAGGCCTGG + Intronic
1062031425 9:134363754-134363776 TCCCCATGCTCAGGGCGGCCTGG - Intronic
1062249000 9:135584733-135584755 TCCCCAGGCCCACGTAGGGCAGG - Intergenic
1062281675 9:135754683-135754705 TCCCTAAGAGCAGGGAGGTCGGG - Intronic
1062346954 9:136119284-136119306 CCCCCAGGCTCCAGGAGGGCGGG + Intergenic
1062399779 9:136367304-136367326 TCCCCAGGCACAGGGTGGGCAGG + Intronic
1062405258 9:136393189-136393211 TCCTCAGGCTCGGGGAGAGCTGG - Intronic
1062477538 9:136736176-136736198 TCCCTGGGCCCAGGGAAGGGGGG + Intergenic
1062627564 9:137450139-137450161 GCCCTGGGCGCGGGGAGGGCTGG - Intronic
1203744583 Un_GL000218v1:34878-34900 TCCCTAGGGTCTGGGTGGCCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186166020 X:6826897-6826919 TCTGTGGGCTCTGGGAGGGCAGG + Intergenic
1187566240 X:20452208-20452230 CCCGTAGGCTTAGGGAGGGATGG - Intergenic
1189833027 X:44994250-44994272 ACCAGAGGCTCAGGGAGGGTGGG - Intronic
1190314726 X:49143224-49143246 TCTCCAGGCAGAGGGAGGGCAGG - Intergenic
1190314942 X:49144626-49144648 TCTCCAGGCAGAGGGAGGGCAGG + Intergenic
1190641917 X:52488260-52488282 TCCCTAGGCTGGAGGAGGCCCGG + Intergenic
1190645755 X:52524606-52524628 TCCCTAGGCTGGAGGAGGCCCGG - Intergenic
1190737791 X:53267062-53267084 TCCCTGGGGCCAGGAAGGGCGGG + Intronic
1191094416 X:56659368-56659390 TCCCTTGGCTTGGGGAGGGAAGG + Intergenic
1192214012 X:69145402-69145424 TCCCTATGCATAGGCAGGGCTGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193404411 X:81083842-81083864 TCCCTTGGCTGGGGGAAGGCTGG - Intergenic
1193716119 X:84936164-84936186 TCTCTAGGCAAAGGGTGGGCAGG - Intergenic
1195079860 X:101360534-101360556 GCACCAGGCTCAGGAAGGGCTGG + Intronic
1200136122 X:153875624-153875646 TTCCTGGGCACAGGGTGGGCAGG - Intronic
1200259014 X:154602218-154602240 TGCCTACCCGCAGGGAGGGCCGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic