ID: 1083301068

View in Genome Browser
Species Human (GRCh38)
Location 11:61739841-61739863
Sequence CCTGGAGTCCTGCTCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083301068_1083301076 26 Left 1083301068 11:61739841-61739863 CCAGCCCTGAGCAGGACTCCAGG 0: 1
1: 0
2: 8
3: 48
4: 364
Right 1083301076 11:61739890-61739912 CTCCAGTGTCAGCCCTTCCCTGG 0: 1
1: 0
2: 3
3: 99
4: 341
1083301068_1083301073 -3 Left 1083301068 11:61739841-61739863 CCAGCCCTGAGCAGGACTCCAGG 0: 1
1: 0
2: 8
3: 48
4: 364
Right 1083301073 11:61739861-61739883 AGGCGTCTCTCTCCATAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083301068 Original CRISPR CCTGGAGTCCTGCTCAGGGC TGG (reversed) Intronic