ID: 1083301068

View in Genome Browser
Species Human (GRCh38)
Location 11:61739841-61739863
Sequence CCTGGAGTCCTGCTCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083301068_1083301076 26 Left 1083301068 11:61739841-61739863 CCAGCCCTGAGCAGGACTCCAGG 0: 1
1: 0
2: 8
3: 48
4: 364
Right 1083301076 11:61739890-61739912 CTCCAGTGTCAGCCCTTCCCTGG 0: 1
1: 0
2: 3
3: 99
4: 341
1083301068_1083301073 -3 Left 1083301068 11:61739841-61739863 CCAGCCCTGAGCAGGACTCCAGG 0: 1
1: 0
2: 8
3: 48
4: 364
Right 1083301073 11:61739861-61739883 AGGCGTCTCTCTCCATAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083301068 Original CRISPR CCTGGAGTCCTGCTCAGGGC TGG (reversed) Intronic
900165505 1:1242888-1242910 CCTGGAGGCCGTCTCAGGCCTGG - Exonic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
900190177 1:1349822-1349844 CCTGGGGTTCTCCGCAGGGCAGG + Intergenic
900513685 1:3071561-3071583 CCTGCCTTCTTGCTCAGGGCAGG - Intronic
900579604 1:3402567-3402589 CCTTTGGTCCTGCCCAGGGCTGG + Intronic
900605966 1:3523654-3523676 CGAGGAGGCCTGGTCAGGGCAGG - Intronic
900687853 1:3959975-3959997 CCTGGATTCTAGCACAGGGCTGG + Intergenic
901607304 1:10469421-10469443 CCAGGAGTTCTGCTCAGCTCTGG - Intronic
901628311 1:10635865-10635887 CCTGGAGTCCAGCTCAGGGAGGG + Intergenic
902236586 1:15061470-15061492 CCTGGGGCCCTGCTCAGGCCTGG + Intronic
902709770 1:18230768-18230790 CCAGGAGTCAAGGTCAGGGCAGG + Intronic
902982961 1:20138824-20138846 CCAGGATTCCTGCTGAAGGCAGG - Intergenic
903182411 1:21611616-21611638 CATGGAGGCCTGGCCAGGGCTGG - Intronic
903212994 1:21829074-21829096 CCTGGCATCCTCCCCAGGGCTGG - Exonic
903285215 1:22272748-22272770 CCTTGGGTCCTGCGTAGGGCAGG + Intergenic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
904009781 1:27383022-27383044 CCTGGAGGCCTGCACTTGGCCGG + Intronic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
904385458 1:30138987-30139009 CCTGGAGGTCTTCTCAGGGGAGG + Intergenic
904515592 1:31052485-31052507 CCTGTAGTCCTACTCAAGGGAGG - Intronic
904600744 1:31671385-31671407 CCTGCGGTCCTGCTTAGGGGAGG - Intronic
904980535 1:34497294-34497316 CCTGGAGGCCTGCTGAATGCAGG - Intergenic
905199390 1:36306211-36306233 CCTGGAGTCCTCCTCACCCCGGG + Intergenic
905878218 1:41447091-41447113 CCTTGACTCCTTCTCTGGGCTGG + Intergenic
910245900 1:85137795-85137817 CTTGGAGTGCTGCCCAGGGTCGG + Intergenic
910291658 1:85605804-85605826 CCTGCAGCCCTGCCCAGGGCTGG - Intergenic
912346048 1:108964083-108964105 ACTGTAGTTCTACTCAGGGCAGG + Intergenic
912474616 1:109927681-109927703 CCTGGAGACCACCTTAGGGCTGG - Intronic
915093507 1:153443335-153443357 CCTGGCCTCCTGCTCAGTTCTGG - Intergenic
915325728 1:155080442-155080464 CTTGGAGTCCCGCTCCGGGGGGG - Intronic
917695674 1:177520766-177520788 CCTCAAGTCCTGATCAGAGCAGG - Intergenic
918090754 1:181292168-181292190 CCTGGAGCCATGATCAAGGCTGG + Intergenic
918209469 1:182338217-182338239 CCTGAGTTCCTGCTCAGAGCAGG + Intergenic
918459779 1:184764739-184764761 TCTGAAGTTCTGCTCATGGCTGG - Intergenic
922240986 1:223755431-223755453 CATGCATTCCTGCTCAGGGCTGG + Intronic
922784283 1:228275480-228275502 CCTGGCGTCTTGTTCAGAGCAGG + Intronic
923297614 1:232610401-232610423 CCTGGCGTCCAGCCCAGTGCTGG - Intergenic
923591810 1:235327258-235327280 CCCGGCGTCCGGCGCAGGGCCGG + Intronic
1063010023 10:2012442-2012464 CCTGGAGTCCTGCTGGGGGACGG + Intergenic
1063106111 10:2993768-2993790 CCTGGTGACTTCCTCAGGGCGGG + Intergenic
1063535130 10:6876062-6876084 CCTGAGCTCCTCCTCAGGGCAGG - Intergenic
1063704686 10:8419482-8419504 CCTGCAGTGCTGGTCAGGGCAGG + Intergenic
1063933193 10:11050125-11050147 ACTGGCCTCCTGCTAAGGGCAGG + Intronic
1067794317 10:49309720-49309742 CCTGGAGCCCTGCTCACAGATGG - Intronic
1067849377 10:49745101-49745123 CCCGCACTCCTGCTCAAGGCTGG + Intronic
1069254584 10:66316499-66316521 AATGGTGTCCTGTTCAGGGCTGG - Intronic
1069897754 10:71689497-71689519 CCTGTCCTCCTGCTCAAGGCAGG + Intronic
1070544205 10:77439873-77439895 CCTGGAGTCCTGCAGAGTGGTGG + Intronic
1070820836 10:79353188-79353210 CCTGCAGTTCTGCTCTTGGCTGG + Intronic
1070832225 10:79425057-79425079 TCTGGAGTCCTGCTCTGTCCTGG + Intronic
1072620538 10:97076264-97076286 CCTGGCTCCCTGCTCAGGCCAGG + Intronic
1072923714 10:99597857-99597879 CCTGGAGTGGTGCTCACGGGAGG - Intergenic
1073469706 10:103714995-103715017 CTGGGAGTCCTGGCCAGGGCTGG - Intronic
1074752062 10:116596301-116596323 CCTGTAATCCTGCTCAGGCCTGG - Exonic
1074974280 10:118567681-118567703 CCTGCAGGCCAGCTCAGAGCAGG - Intergenic
1075397869 10:122141018-122141040 CCAGGAGTCCTGCTCAGAGAGGG + Intronic
1076280356 10:129241716-129241738 CCTGCTGTCCTGCACTGGGCAGG - Intergenic
1076394527 10:130129112-130129134 CCAGGGGTTCTGCTCTGGGCTGG + Intergenic
1076507352 10:130986950-130986972 CCTGGGTCCCTGCCCAGGGCAGG + Intergenic
1076749613 10:132536239-132536261 GCTGGAGTCCTGCTCAGCGGTGG + Intergenic
1076856437 10:133117545-133117567 CCCGGGCACCTGCTCAGGGCTGG + Intronic
1076904519 10:133355454-133355476 CCTGCAGCCCAGCTCAGTGCTGG - Exonic
1076922564 10:133462176-133462198 CGTGGAGCCCTGCTCAGCTCTGG + Intergenic
1076999084 11:313622-313644 GCTGCAGTCCTGCTCTGTGCGGG - Intronic
1077010597 11:377549-377571 CCTGGAGCCCCACCCAGGGCTGG + Intronic
1077115061 11:880403-880425 CCTGGGGTCCAGCACAGGCCTGG - Intronic
1077474864 11:2781543-2781565 CCTGAAGTCCCACACAGGGCTGG + Intronic
1077487485 11:2845750-2845772 CCTGGGCTCCTGCTCTGGGCAGG + Intronic
1078440640 11:11363861-11363883 CCTGGAACCCTCCTCATGGCAGG + Intronic
1078466675 11:11555175-11555197 CCTGATGGGCTGCTCAGGGCGGG + Intronic
1079743972 11:24101587-24101609 CCTGGATTTCTGCACAGGGAGGG - Intergenic
1081676779 11:44974571-44974593 CCTGGAGTCTGGCTCAGCCCTGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083412829 11:62505765-62505787 CCAGGGGTCCTGCTGGGGGCGGG - Intronic
1083629346 11:64087784-64087806 GCTGGACGCCTGCCCAGGGCTGG + Intronic
1084721104 11:70906214-70906236 CCTGCCTTCCTGCTCAGGGCTGG + Intronic
1085516888 11:77116715-77116737 CCTGGAGGCAGGCTGAGGGCAGG - Intronic
1085579402 11:77637477-77637499 CCTGGAGGCCTGCTGGGAGCGGG - Intronic
1086605623 11:88692850-88692872 CCTGGAGGCCTGCACAGGGTGGG + Intronic
1087199875 11:95334697-95334719 CCAGGAGTCATGGTGAGGGCAGG + Intergenic
1088427288 11:109717985-109718007 GATGGTGTCCTGTTCAGGGCTGG - Intergenic
1088688902 11:112308156-112308178 CCTAGAGCCTTGCTCATGGCTGG - Intergenic
1088979169 11:114846227-114846249 GCTGGTGTCATTCTCAGGGCTGG + Intergenic
1089733759 11:120535470-120535492 CCTGGAGCAGTGCTGAGGGCAGG + Intronic
1091252853 11:134158296-134158318 CCTGGAGGCCACATCAGGGCTGG - Intronic
1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG + Intronic
1091724363 12:2835121-2835143 GCTGGGGTCCTGGTCAGAGCGGG + Intronic
1091825586 12:3510193-3510215 CCTGGGGTCCTGCTCTGGGGTGG + Intronic
1092296367 12:7202282-7202304 CCTGGAGTCCGGTGCAGGGTCGG + Exonic
1092721840 12:11448932-11448954 TCTGGAGTCCTGATAAAGGCAGG + Intronic
1094209213 12:27873069-27873091 CCTAGAGTCTTGTACAGGGCTGG + Intergenic
1094443513 12:30505415-30505437 CCTGGAGTCCTGCTGAGGAAGGG - Intergenic
1094445400 12:30524231-30524253 CTTGAAGCCCTGCTCAGTGCTGG - Intergenic
1096516306 12:52157407-52157429 CCAGGTGTCCAGCTCAGGCCTGG + Intergenic
1097976911 12:65696345-65696367 CCTGGAGTATTCCTCAGGGCAGG + Intergenic
1098867929 12:75783653-75783675 CTTGGAGTCCTGCCCACGGGTGG - Intergenic
1101399445 12:104375068-104375090 GCTGGTGTCCTGCCCAGGGAGGG + Intergenic
1102043906 12:109817731-109817753 TCTGGAGTCATGATGAGGGCTGG - Intronic
1103209647 12:119156997-119157019 CCTGGGGCCCAGCTCAGGCCTGG + Exonic
1103648169 12:122411740-122411762 CCTGGCCTCCTGCCTAGGGCTGG + Intronic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1103932936 12:124460158-124460180 CATGGAGTCCTCATCAGGGGAGG - Intronic
1104439292 12:128781900-128781922 CCTGGAAACCTGCTCAGCACTGG + Intergenic
1104546104 12:129714225-129714247 CATGGAGTGCTGCTCTGGGGAGG - Intronic
1104643780 12:130483491-130483513 GCTGCAGTCCTGCTGGGGGCTGG + Intronic
1104723445 12:131060101-131060123 CTTGGAGTCCTGGTGAGGGCTGG + Intronic
1106178868 13:27354152-27354174 CCTGGAGGGCTGCTCTGAGCAGG - Intergenic
1107313949 13:39110899-39110921 TCTCCACTCCTGCTCAGGGCAGG + Intergenic
1107416488 13:40206058-40206080 CCTGGAATCGTGCTCAGGCCAGG - Intergenic
1107889904 13:44905213-44905235 GCTGGAGTCCTGCCCTGAGCTGG - Intergenic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1114403034 14:22427518-22427540 CCTGGCATCCAGCTCAGTGCAGG - Intergenic
1114873425 14:26686115-26686137 CATGGTGTCTTGCACAGGGCAGG + Intergenic
1119193077 14:72697447-72697469 GCTGAAGTCCTGCTCATGTCAGG - Intronic
1119228540 14:72962286-72962308 CCTGGGGTCCTGCTGATAGCTGG - Intergenic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119410592 14:74427558-74427580 CCTGGGGTCTGTCTCAGGGCTGG + Intergenic
1119473261 14:74912184-74912206 CCCGGAGCCCTGCACAGTGCAGG + Intronic
1119711917 14:76828571-76828593 CCTGGAGTCCTCCTCCGGGCTGG + Intronic
1119920226 14:78439914-78439936 CCTGGGGTCCAGATCAGGGTAGG - Intronic
1121043987 14:90774692-90774714 CCTGGAGTGCGGCTTAGGGAAGG - Intronic
1121125059 14:91400495-91400517 CCGGGAGTCCAGCTCTGGCCTGG - Intronic
1121274688 14:92659528-92659550 TCTGGAGTCCTGGTCAGGGTGGG - Intronic
1121330209 14:93044937-93044959 CCAGGACTCCTGGCCAGGGCAGG + Intronic
1121562587 14:94886100-94886122 CCTGGAGTGCTCCCCAGGGGTGG + Intergenic
1121761149 14:96446164-96446186 ACTGGGGTCCTGCTGGGGGCCGG + Intronic
1122355928 14:101122806-101122828 CCTGGAGGCCTCCTGAGGACAGG - Intergenic
1122865618 14:104602722-104602744 GCTGGAGCCCTGCTCAAGGTGGG - Intronic
1122893886 14:104745814-104745836 CACAGAGTCCTGCACAGGGCCGG + Intronic
1123125846 14:105945410-105945432 ACTGGAGTCATGCCCAGGGCTGG - Intergenic
1123168584 14:106349548-106349570 GCAGGAGTCCGGCTCAGGACTGG - Intergenic
1202862074 14_GL000225v1_random:89486-89508 CCTGGAGGCCTCCACATGGCAGG - Intergenic
1123406429 15:20021828-20021850 ACTAGAGTCATGCCCAGGGCTGG - Intergenic
1123515759 15:21028476-21028498 ACTAGAGTCATGCCCAGGGCTGG - Intergenic
1125333323 15:38603425-38603447 CCTGGAGTGCTGCCCTCGGCTGG + Intergenic
1125554616 15:40573801-40573823 CCTGGGGTCCTTCTCGAGGCCGG + Exonic
1128765938 15:70251136-70251158 CCAGGAGTCCTGCATAGGCCGGG + Intergenic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1129836305 15:78709513-78709535 CCTGGAGACCCGAGCAGGGCGGG - Intronic
1130228155 15:82075739-82075761 CCTGGAGAAGGGCTCAGGGCTGG + Intergenic
1130510884 15:84588188-84588210 CCTGGAGACCCGGGCAGGGCGGG + Intergenic
1130601887 15:85281188-85281210 CCAGGAGGCAGGCTCAGGGCTGG + Intergenic
1130767020 15:86880979-86881001 CCAGGAGGCAGGCTCAGGGCTGG - Intronic
1131080042 15:89527091-89527113 GCTGCTGTCCTGCCCAGGGCAGG - Intergenic
1131622186 15:94080098-94080120 GATGGTGTCCTGCCCAGGGCTGG - Intergenic
1132663699 16:1072504-1072526 CCTGGACTCCTGCTGGCGGCAGG + Intergenic
1132731959 16:1367071-1367093 GCGTGAGTCCTGCTCTGGGCAGG - Intronic
1132764404 16:1526935-1526957 CCTGCAGTCTTGCCCAGGGGCGG - Intronic
1132803946 16:1767115-1767137 CCCGGACACCTGCTCAGGCCTGG - Intronic
1132941408 16:2510224-2510246 CCTGGGGTCCTGCCCGGTGCTGG + Intronic
1133116960 16:3582907-3582929 CCAGGAGGCCTGCGCAGGGCTGG + Intronic
1134290322 16:12899408-12899430 CCTGGAGTTGCGCACAGGGCTGG + Intergenic
1135762338 16:25147365-25147387 CCAGGAGGCCTGCTTAGGGTAGG + Intronic
1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG + Intergenic
1137558843 16:49490183-49490205 CCTGGAGTCCTGGCAAGGGAAGG + Exonic
1137718061 16:50611050-50611072 CCTGGAGTCCTGCCCAGCTGTGG - Intronic
1138432966 16:56981282-56981304 CTTGGAGTCAGGCACAGGGCGGG + Intronic
1138525892 16:57607059-57607081 GCTGGGTTCCTGCTGAGGGCTGG + Intergenic
1138534785 16:57654085-57654107 CCTGGAGGCCGGCTGTGGGCTGG - Exonic
1138651508 16:58463884-58463906 GCTGGGGTCGTGCTCGGGGCTGG - Intronic
1146637245 17:34515445-34515467 CCTGGTGTCCTGCACAGAGTGGG + Intergenic
1147557513 17:41488843-41488865 CCTGGGGTGTGGCTCAGGGCTGG - Intronic
1147768876 17:42854434-42854456 TCTCCAGTCCTGCTCAGGGTGGG - Exonic
1147771679 17:42872391-42872413 TCTCCAGTCCTGCTCAGGGTGGG - Intergenic
1148123475 17:45225264-45225286 CCTGGAGTCCTGCTTGCAGCTGG + Intronic
1148218506 17:45846886-45846908 TGTGGAGTCCCGCCCAGGGCAGG - Exonic
1148441172 17:47712296-47712318 TCAAGAGGCCTGCTCAGGGCTGG - Intergenic
1149439715 17:56664054-56664076 CCTGGCCTCCTTCTCTGGGCAGG - Intergenic
1149535767 17:57432260-57432282 CCAGGAGACTTGCTCAGGGTCGG + Intronic
1149600562 17:57890618-57890640 CCTGGATTCCTTCACAGGGGAGG - Intronic
1149994321 17:61399092-61399114 CCTGGAGTTCTCCGCAGGCCCGG - Intergenic
1150437449 17:65165045-65165067 CCTGGAGCCCAGCCCAGTGCTGG - Intronic
1150447454 17:65238137-65238159 CCTGAAGGGCTGCCCAGGGCAGG - Intergenic
1151084386 17:71364043-71364065 ACTGGTGTCCTGCTGAGGGAGGG - Intergenic
1152000868 17:77644635-77644657 CCTGGGATCCTGGGCAGGGCAGG + Intergenic
1152016958 17:77757065-77757087 CCTGGAGTCCCACTCAGGGTGGG + Intergenic
1152157894 17:78646802-78646824 CCTGGGGTCCAGCCCAGGGTTGG - Intergenic
1152413557 17:80144140-80144162 CCTGGGGTGCGGCGCAGGGCTGG - Intronic
1152872825 17:82767116-82767138 CCTGGATACCAGCCCAGGGCCGG + Intronic
1152888807 17:82868177-82868199 CCTTGGGTGCAGCTCAGGGCCGG - Intronic
1154171671 18:12056997-12057019 ACTGGAGTCCTGGCCAGGGATGG - Intergenic
1156457039 18:37300587-37300609 CCTGAGCTCCTGCTCTGGGCAGG + Intronic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1158436913 18:57440480-57440502 ACTGGAGACCAGCTCCGGGCAGG - Intronic
1159010760 18:63057173-63057195 CCTGGAGTCCAGGTCAGGGTTGG + Intergenic
1159932137 18:74323958-74323980 AATGGAGTCCTGTGCAGGGCTGG + Intronic
1160742679 19:694750-694772 CCTGGAGTCCCCCTCATGTCGGG + Intronic
1160856422 19:1219993-1220015 CCAGGAGATCTGGTCAGGGCAGG - Intronic
1160993642 19:1871968-1871990 CCTGCAGTCCTGCTGAGGAGGGG - Intergenic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1161964708 19:7541571-7541593 CTTGGAGCCCCGCACAGGGCTGG - Exonic
1163241085 19:16064340-16064362 CCAGGAGCCCTGGTCAGGGCCGG - Intergenic
1163294205 19:16401722-16401744 CCTGGAGTTGTGATCAGGCCTGG - Intronic
1163386702 19:17004475-17004497 CCTGGGGGGCTGCTCAGGGAAGG - Intronic
1163832026 19:19551669-19551691 CCTGGAATCCTGGCCAGGCCGGG + Intergenic
1164042855 19:21509036-21509058 AATGGAGTCTTGCTCAAGGCTGG + Intronic
1165039369 19:33058232-33058254 CCTGGAGTGCTGAGCAGTGCTGG - Intronic
1165062746 19:33212773-33212795 TCTGTCCTCCTGCTCAGGGCAGG + Intronic
1165473531 19:36016808-36016830 TCTGGAGCTCTGGTCAGGGCTGG - Intronic
1166901676 19:46068660-46068682 CCTGGAGGCCTACCCAGGGAGGG - Intronic
1168169600 19:54576703-54576725 CTGGGAATCCTGCTCAGGGAGGG - Intronic
1168172426 19:54597390-54597412 CCTGGAATCCTGCTCGGGGAGGG - Intronic
1168683790 19:58335805-58335827 CCTGGAGGCCAGCCCAGGGTGGG - Intronic
925278002 2:2663882-2663904 CCGGGACTCCTGCTCAGGGAGGG + Intergenic
925708727 2:6716227-6716249 TCTGAACTCCTGCTCAGGGATGG - Intergenic
926680075 2:15656234-15656256 CCTAGATCCCAGCTCAGGGCAGG + Intergenic
927717168 2:25360296-25360318 CCATGGGCCCTGCTCAGGGCTGG - Intergenic
929281802 2:40087961-40087983 CTTTGAGTCCAGCTCAGCGCCGG + Intergenic
929826352 2:45311717-45311739 CCAGGTCTCCTGCCCAGGGCAGG - Intergenic
930919000 2:56728220-56728242 CCTTGCTTCCTGCTCATGGCAGG + Intergenic
931637068 2:64350513-64350535 TCTGGAGTCCTCCTCAGGAATGG + Intergenic
932281005 2:70491781-70491803 CATGGAATCTTGCACAGGGCAGG - Intronic
932707994 2:74041469-74041491 GCTGTAGTCCTGTTCAGGTCAGG + Intronic
932961886 2:76422009-76422031 CCTCTAGTGCTGCTCATGGCTGG + Intergenic
933354473 2:81195870-81195892 CCTGGGGTCCTTCTCACTGCCGG - Intergenic
933740618 2:85531107-85531129 CCTGGAATCCTGCCCATGCCAGG - Intergenic
933800828 2:85959053-85959075 GCTGGCGTCCTGTCCAGGGCGGG + Intergenic
935526219 2:104171347-104171369 CATGGCGTCCTGTTCAGGGTTGG - Intergenic
937236090 2:120432666-120432688 CCTTGACACCTGCTGAGGGCTGG - Intergenic
937333696 2:121047562-121047584 CCTGGAGCTCTGCCCAGGACCGG + Intergenic
946015683 2:216602360-216602382 ACTGGAGTCCTGGGCAGGGTTGG - Intergenic
947082842 2:226418516-226418538 GCAGGAGTCCTGCCCTGGGCAGG + Intergenic
947082844 2:226418524-226418546 CCCTGTGTCCTGCCCAGGGCAGG - Intergenic
947445817 2:230161781-230161803 CCTGGAGTCCTGTGCTGGGAGGG + Intergenic
948152416 2:235754873-235754895 CCTTGTGTCTTGCTCAGGGGTGG + Intronic
948468403 2:238162954-238162976 CCTTGAGTCCAGCCCAGAGCAGG - Intronic
1168789833 20:568537-568559 CCTGGGGCCCCGCTCAGGGGTGG - Intergenic
1169043996 20:2521275-2521297 ACTGGAGTCATAATCAGGGCAGG + Intronic
1169226866 20:3862319-3862341 CCTGGAGTCCTCCTCTGACCTGG + Exonic
1170573665 20:17647111-17647133 CCAGCAGCCCTGATCAGGGCAGG + Intronic
1172056408 20:32157600-32157622 CTGGGAGTCCAGATCAGGGCTGG + Intronic
1172092855 20:32446149-32446171 CCTGGGGGCCTGCTGAGGTCTGG + Exonic
1172784760 20:37460511-37460533 TCTGGAGTCCTGACCAGAGCTGG + Intergenic
1172838630 20:37888660-37888682 GCTGGACTCCAGCTCAGGGATGG - Intergenic
1172869356 20:38126286-38126308 CCTGGACTCCGGATCAGAGCTGG - Intronic
1173530005 20:43762102-43762124 CCTGGAGCACTGCCCAGGTCTGG - Intergenic
1173601417 20:44298130-44298152 ACTGTAGACCTGCTGAGGGCAGG + Intergenic
1173618483 20:44418525-44418547 CCTGGAGCCCTGGCCAGGGCAGG - Intronic
1174412466 20:50344805-50344827 CCTGGAGTCCTCGTCAGGTCAGG + Intergenic
1174543406 20:51307041-51307063 CTTCGAGGCCTGCGCAGGGCTGG - Intergenic
1174778876 20:53370294-53370316 CCTGGGGAGCTGCTCTGGGCAGG + Intronic
1175178069 20:57125651-57125673 CCTGGTCTCTTGCTCAAGGCAGG + Intergenic
1175271160 20:57735072-57735094 CAAGGAGGCCTGCTCTGGGCTGG + Intergenic
1175515554 20:59567604-59567626 CCTGGAGAGCTGATGAGGGCTGG - Intergenic
1175676162 20:60948561-60948583 CCTGCAGTCCCGCTCAAGCCTGG - Intergenic
1176039570 20:63058063-63058085 CCTTGAGTCCTGCTTAGACCAGG - Intergenic
1176143357 20:63554577-63554599 CCTGGGGTCCTGCTCTCAGCTGG + Exonic
1176220665 20:63968018-63968040 CCTGGAGCCCTGCCCTTGGCAGG + Intronic
1176245023 20:64093373-64093395 CCAGGGCTCCTGCTCATGGCAGG + Intronic
1176286592 21:5022145-5022167 CCCGGACTCCTGCTCGGGGAGGG + Intergenic
1176376222 21:6088088-6088110 CCTGGCCTCCTCCTCAAGGCTGG - Intergenic
1176383489 21:6125665-6125687 CCTGGAGCCCTGCTCAGACAGGG + Intergenic
1178843541 21:36156697-36156719 CCTGGAGGCGGGCTCAGGGGCGG - Intergenic
1179477398 21:41656333-41656355 CATGGGTTCCTGCTCAGGTCTGG + Intergenic
1179480365 21:41673043-41673065 CCTGCTGTCCTCCCCAGGGCCGG + Intergenic
1179739979 21:43412573-43412595 CCTGGAGCCCTGCTCAGACAGGG - Intergenic
1179747253 21:43450156-43450178 CCTGGCCTCCTCCTCAAGGCTGG + Intergenic
1179823594 21:43951588-43951610 GCTGGCGTCCTGCTCTGTGCAGG - Intronic
1179870589 21:44241330-44241352 CCCGGACTCCTGCTCGGGGAGGG - Intergenic
1179874532 21:44261450-44261472 CCTTGAGCCCCTCTCAGGGCTGG - Intronic
1180834961 22:18925278-18925300 CTTGGAGCCCTCCTGAGGGCAGG - Intronic
1181083228 22:20427488-20427510 CCTGGAGCCACCCTCAGGGCTGG - Exonic
1181365366 22:22372373-22372395 CCTTGCCTCCTTCTCAGGGCGGG + Intergenic
1181852158 22:25757303-25757325 CTTGAAGTCCTGGTCAGGCCAGG + Intronic
1182281539 22:29220333-29220355 CCTGGCCTCCTCCTCAGGGTAGG - Intronic
1182429452 22:30291311-30291333 CCTGGAGCCCTGGTCAGGAGAGG + Intronic
1182691913 22:32170272-32170294 CCAGACCTCCTGCTCAGGGCTGG + Intergenic
1183483032 22:38075280-38075302 CCTGGGCTCCTGCCCAGGACAGG + Exonic
1183679997 22:39322616-39322638 ACTGGAGGCCTGCTCTGTGCCGG + Intergenic
1183800132 22:40156023-40156045 CCTGTGGTTCTGCACAGGGCAGG + Intronic
1184173535 22:42773029-42773051 CCAGGAGGCCTTCTGAGGGCAGG - Intergenic
1184607138 22:45580658-45580680 CCTGGGCTCCGGCTCTGGGCGGG - Intronic
1184841067 22:47052679-47052701 ACAGGAGTCCTGCTCAGGACAGG - Intronic
1184877054 22:47282661-47282683 CCTGGTGCCCAGCTCAGGGCAGG + Intergenic
1184942494 22:47779464-47779486 CCTGGAGACCTTACCAGGGCAGG - Intergenic
1185161705 22:49233911-49233933 GCTGGAGGCCTGCTCACGGCTGG + Intergenic
1185179904 22:49353250-49353272 CCTGGTTTCCTGCACTGGGCAGG + Intergenic
1185278536 22:49960296-49960318 CCAGGAACCCTGCTCGGGGCCGG + Intergenic
1185327411 22:50233774-50233796 CCTGGGGTCCTGGGCATGGCCGG + Intronic
1203285050 22_KI270734v1_random:150577-150599 CTTGGAGCCCTCCTGAGGGCAGG - Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950027757 3:9832513-9832535 CCTGGAGCCCAGCTGAGGGCAGG + Intronic
950188127 3:10957923-10957945 CCAGGATTCCTGCCCAGGTCTGG - Intergenic
950310578 3:11954328-11954350 CATGGAGTCTGGCACAGGGCAGG + Intergenic
950612784 3:14136994-14137016 CCAGCAGTCCTGGTTAGGGCAGG - Intronic
950615129 3:14152180-14152202 CCTTGAATCCTGCTCAAGCCGGG + Intronic
950692311 3:14669642-14669664 GCTGGAGTCCTGGGCTGGGCTGG - Intronic
953036968 3:39220610-39220632 CCTGGAGTTCTAATCTGGGCTGG - Intergenic
953609264 3:44433881-44433903 CCTTGAGACCTGATCAGGACCGG - Intergenic
953814634 3:46144438-46144460 CCTGCAGTGCTGCCCAGGCCAGG + Intergenic
954915081 3:54142036-54142058 CCTGAAGACCTGCTCTGGTCTGG + Intronic
956026015 3:64983905-64983927 CCTGGAGGCCAGCTCAGTCCAGG - Intergenic
956729969 3:72187478-72187500 CCTGGGTTCCTGCCCAGGGCTGG - Intergenic
957195317 3:77060203-77060225 CCTGGAGTCATGCACAGATCAGG + Intronic
958772225 3:98438410-98438432 CCAGGATTCCTGCTGAGGGCAGG + Intergenic
959711359 3:109389246-109389268 ACTAGAGTCCTGCTCAGGCTGGG - Intergenic
961441832 3:126958004-126958026 CCTGTAGACCAGCTCAGGGCAGG - Intronic
962414369 3:135168699-135168721 CCCTGACTCTTGCTCAGGGCTGG + Intronic
967685452 3:192410734-192410756 CCTGGAGTCATCCTCTGTGCAGG - Intronic
967965027 3:194954199-194954221 TCTGGGGCTCTGCTCAGGGCTGG + Intergenic
968612245 4:1562637-1562659 CCTGCTGTCCAGCCCAGGGCTGG + Intergenic
968813992 4:2812422-2812444 CCTCGTGACCTGCTCGGGGCCGG - Intronic
969363956 4:6683094-6683116 CCTGGAGCCCAGCTCAGGACAGG - Intergenic
971066212 4:23035860-23035882 CCTGGAGTTCTGCCTGGGGCCGG + Intergenic
971376742 4:26061819-26061841 GCTGGAGCCCTGCTGAGGCCAGG + Intergenic
972727297 4:41756226-41756248 CCTACAGTCCTGCACAGTGCTGG + Intergenic
973788630 4:54358232-54358254 CATGGAATCCTGGTCTGGGCTGG + Intergenic
988220103 5:28333699-28333721 CCTACAGTTCTGCTGAGGGCAGG + Intergenic
990652816 5:57921888-57921910 CCTGGTGTCCTCTTCTGGGCTGG + Intergenic
992072348 5:73159593-73159615 CCTGGTGTCCAGCACAAGGCGGG - Intergenic
992153128 5:73926098-73926120 CCTGGTGTCCAGCCCAGGGCAGG + Intronic
992835928 5:80641336-80641358 CCAGTAGACCTGCTCAGTGCAGG - Intronic
992956850 5:81918761-81918783 GCTGTAATCCTGGTCAGGGCAGG - Intergenic
993565193 5:89465987-89466009 CCTGTAGTCTTGGTGAGGGCAGG - Intergenic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
997439551 5:133899566-133899588 TCTGGGGTCCTGCTCAGGGGAGG - Intergenic
997698154 5:135877853-135877875 CCTGGAGTGCTTCCCAGGCCTGG - Intronic
998328225 5:141301384-141301406 CCTTGAGTCCTACCCAGGCCAGG + Intergenic
998579052 5:143350863-143350885 CCTGGTGTCTAGCACAGGGCTGG + Intronic
998695052 5:144629586-144629608 CATGGAGCCTTGCTCAGTGCTGG - Intergenic
999088303 5:148912588-148912610 CCTGCTGCCCTGCTCAAGGCAGG + Intergenic
999956501 5:156709016-156709038 CCTAGAGTCTTGCTGAGAGCAGG + Intronic
1001122597 5:168992633-168992655 CCTGGGGTCCTGCTCAGGCCTGG + Intronic
1001671541 5:173478141-173478163 CCTGGAGTTCTGGACACGGCAGG - Intergenic
1001981866 5:176043636-176043658 CCTGGTGTGCTGCTGAGGCCTGG + Intergenic
1002044468 5:176534146-176534168 CCTTGTGTCCAGCTCAGGGCAGG + Intronic
1002068213 5:176663041-176663063 CCTGGAATCATGCTTAGGGTGGG + Intergenic
1002176153 5:177402624-177402646 CCTGGAGCGCTGCTCAGCCCCGG - Exonic
1002235599 5:177800421-177800443 CCTGGTGTGCTGCTGAGGCCTGG - Intergenic
1002375882 5:178788901-178788923 CCTGGAGCCCTGGGCAGAGCCGG + Intergenic
1002594177 5:180311604-180311626 GCTGGTGTCCAGCACAGGGCAGG - Intronic
1003973775 6:11323792-11323814 CCTGGCGTCCTGCTCATTGGTGG + Intronic
1004813887 6:19291437-19291459 GATGGAGGCCTGTTCAGGGCTGG - Intergenic
1005898277 6:30196485-30196507 CCTGGCGCCCTGCCCAGGGACGG + Intronic
1006389967 6:33752413-33752435 CCTGGGGAGATGCTCAGGGCAGG - Intergenic
1006898194 6:37484034-37484056 CCTGCAGAGCTGCTCTGGGCAGG + Intronic
1007343426 6:41208756-41208778 CCTGGAGACCTGCTGAGGTGGGG + Intergenic
1007346885 6:41237430-41237452 CCTGGAGACCTGCTGAGGTGGGG - Exonic
1012318543 6:97813086-97813108 CCTGGACTTCTGCTCACTGCTGG - Intergenic
1013667874 6:112366699-112366721 CCCGGCGTCCTGCTCCTGGCTGG + Intergenic
1014174958 6:118322092-118322114 TCTGGTGTACTTCTCAGGGCAGG - Intergenic
1014323197 6:119957654-119957676 CCTAGAGCCCTGCTCAGGGAAGG + Intergenic
1017646307 6:156542706-156542728 CCTGGAGTCCAAATCAGGGTAGG + Intergenic
1017718221 6:157226895-157226917 CCTGGAGCTATGCTAAGGGCTGG - Intergenic
1018850128 6:167581689-167581711 CATGGAGGCCTGCCCAGTGCTGG - Intergenic
1018853873 6:167662013-167662035 TTTGGACTCATGCTCAGGGCTGG + Intergenic
1019271276 7:150381-150403 CCCGGAGTCCTCCCCAGGGGTGG + Intergenic
1019285896 7:222717-222739 CCTGGAGTGCTGCTTGGTGCTGG + Intronic
1019519655 7:1454910-1454932 TCTGGAGGCGGGCTCAGGGCTGG - Intronic
1021256996 7:18404934-18404956 GATGGCGTCCTGCCCAGGGCTGG - Intronic
1022334544 7:29410008-29410030 TCTGAGGTCGTGCTCAGGGCAGG - Intronic
1023603297 7:41902406-41902428 GATGGCGTCCTGCACAGGGCTGG - Intergenic
1023625503 7:42111517-42111539 CCTGGTGTCCTGTTCATGTCTGG - Intronic
1023863574 7:44228655-44228677 CCTGGAGTCCTGCCCTGGCGGGG - Intronic
1024153631 7:46598351-46598373 AATGGGGTCCTGTTCAGGGCTGG + Intergenic
1024225177 7:47321067-47321089 CCTGGAGTCCTGCCTCAGGCTGG - Intronic
1029124200 7:98285864-98285886 CCTGAAGCCATGCTCAGCGCAGG - Intronic
1029345559 7:99976071-99976093 CCTGGGGCCCTGCCCAGGGGAGG + Exonic
1029605603 7:101597889-101597911 CCTGGAGCTCTGGCCAGGGCAGG - Intergenic
1030150463 7:106399282-106399304 TCTGGAGCCCTGCTCAATGCTGG - Intergenic
1031904627 7:127447094-127447116 CCTGGAGACCTGCTCGGGCATGG - Intergenic
1032509933 7:132464747-132464769 CCTTTAGTCCTGCTGAGGGGAGG - Intronic
1033466327 7:141593332-141593354 CCTGGAGTTCTACTCAGAGTTGG - Intronic
1034964858 7:155384626-155384648 CCTGGATTCTGGTTCAGGGCGGG - Intronic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1036210380 8:6835705-6835727 GGTGGAGTCCAGCTCAGGTCCGG + Intergenic
1037505954 8:19529411-19529433 CCTGGAATCCTACTCAAGGCTGG + Intronic
1038431749 8:27505790-27505812 CCTGGAGTCAGCCTCAGAGCAGG + Intronic
1038937532 8:32268825-32268847 CCTGGAGACTTGCACAGGGCTGG - Intronic
1039455629 8:37704022-37704044 CCTGGAGTCCAGGGTAGGGCAGG + Intergenic
1039840115 8:41286975-41286997 CCTGGAGGCCTGCACTGGGCAGG - Intronic
1043463985 8:80487038-80487060 CCTGGAGGCCTCCGCCGGGCCGG + Exonic
1044473688 8:92601963-92601985 CCTGGAGTCCTTCTAAGTGTGGG + Intergenic
1045054688 8:98358912-98358934 GCTGCAGTCCAGCTCAGGGGTGG - Intergenic
1046961704 8:120120494-120120516 CCTGGAGCTCTGAGCAGGGCTGG + Intronic
1047009916 8:120661149-120661171 CCTGGAGACTTGCTCAAGGCAGG + Intronic
1047182845 8:122605731-122605753 CCTGGTCTCCTGCTCTGGTCTGG - Intergenic
1047404163 8:124571182-124571204 CCTGGAATCTGCCTCAGGGCAGG + Intronic
1048215177 8:132487404-132487426 ACAGGATTCCTACTCAGGGCAGG - Intergenic
1048317855 8:133375379-133375401 CCTGGAGCCCAGCTCAGTGGAGG - Intergenic
1049205604 8:141362058-141362080 CCTGGACTGCTGGGCAGGGCTGG + Intronic
1049214697 8:141402302-141402324 TCTGGCGCCCTGCTCAGGGAGGG + Intronic
1049251464 8:141591380-141591402 CCTGGGGTCCCACACAGGGCAGG - Intergenic
1049554251 8:143274329-143274351 CCTGCAGTGCTGCTCTGGACCGG - Intronic
1049589408 8:143449706-143449728 CATGGAGTCTTGCTCCAGGCTGG - Intronic
1049617341 8:143581382-143581404 CCTGCAGTCCTGAGCATGGCAGG - Intronic
1050295129 9:4196937-4196959 CCTGGAGTTCTGCCTAGGGGTGG - Intronic
1050428764 9:5539774-5539796 CCTGAAGGCCTGGGCAGGGCAGG + Intronic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051843120 9:21420588-21420610 CCTGGAGACCTGCTTGGTGCGGG + Intronic
1051846393 9:21455835-21455857 CCTGGAGACCTGCTTGGTGCAGG + Intergenic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1055925940 9:81509826-81509848 CATGAAGTCCTTCTCAGGGCAGG - Intergenic
1056555512 9:87684246-87684268 CCTGGAGGCATGCTCAGGAGCGG - Intronic
1056649465 9:88445570-88445592 GATGGAGTCTTGCTCTGGGCTGG + Intronic
1056869912 9:90267869-90267891 CCAGGAGTCCTCCTCAGGAGAGG + Intergenic
1056965463 9:91160554-91160576 CCTGGGGACCTGTCCAGGGCAGG + Intergenic
1057040497 9:91844307-91844329 CCTGGGGGCCTCCTCTGGGCCGG + Intronic
1057270369 9:93646982-93647004 GCTGGATCCCGGCTCAGGGCAGG - Intronic
1058946018 9:109857072-109857094 CCTGGAGGCAGTCTCAGGGCAGG - Intronic
1060206505 9:121685544-121685566 GCTGGAGACCTGCTGAGGCCAGG - Intronic
1060812134 9:126615802-126615824 CCCGGAATCCTGCGCTGGGCCGG + Intronic
1061267259 9:129514087-129514109 CCTGGGCTCCTGCTAGGGGCAGG + Intergenic
1061499163 9:130992318-130992340 ACTGGGGTCCTGCTCAGGTGAGG + Intergenic
1061774217 9:132949788-132949810 CCAGGAGGCCTGCTTAGGTCTGG + Intronic
1061782916 9:133006382-133006404 CAGGGAGCCCTGCTCTGGGCTGG + Intergenic
1061909856 9:133716766-133716788 CCTGGAGGCCAGCTCAGCGGGGG - Intronic
1061914593 9:133742853-133742875 CTGGGAGTCCTGGTCAGTGCTGG - Intergenic
1062534677 9:137016225-137016247 GCAGGAGTCCTAGTCAGGGCAGG - Intronic
1185449657 X:275572-275594 CCTGGAGTCCAGCCCGGGGTGGG + Intergenic
1185680560 X:1885379-1885401 CCTGGAGCCCAGCGCAGAGCTGG + Intergenic
1187127755 X:16469923-16469945 CCTGGTGTCCTGGTCTGGGAGGG + Intergenic
1187471137 X:19570577-19570599 CCTGGAGGTCAGGTCAGGGCAGG + Intronic
1189291299 X:39887774-39887796 CCAGGCATCCTGCTCAGGTCTGG - Intergenic
1192189772 X:68983723-68983745 CCTGGCAGCCTGCACAGGGCTGG - Intergenic
1197031663 X:121823785-121823807 CCTGGAGACCTGCTTAGGCATGG - Intergenic
1197278856 X:124511530-124511552 CCTAGAGTCCTGTACAGAGCAGG - Intronic
1197931886 X:131704646-131704668 CCTGCAGTCCTGCCCAGAGGAGG - Intergenic
1199666281 X:150099079-150099101 CCTGAAGTCCTCCCCAGGGAAGG + Intergenic