ID: 1083302447

View in Genome Browser
Species Human (GRCh38)
Location 11:61746067-61746089
Sequence TCTCTTGGTCGGGGGAGCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083302447_1083302458 6 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302458 11:61746096-61746118 TCTCATGATCACTGGTACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1083302447_1083302460 8 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302460 11:61746098-61746120 TCATGATCACTGGTACCTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 121
1083302447_1083302453 -2 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302453 11:61746088-61746110 GACCTCCCTCTCATGATCACTGG 0: 1
1: 1
2: 0
3: 15
4: 131
1083302447_1083302461 20 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302461 11:61746110-61746132 GTACCTGGGGGCCTGAATTCTGG 0: 1
1: 0
2: 0
3: 5
4: 132
1083302447_1083302463 27 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302463 11:61746117-61746139 GGGGCCTGAATTCTGGCCCCCGG 0: 1
1: 0
2: 3
3: 29
4: 281
1083302447_1083302459 7 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302459 11:61746097-61746119 CTCATGATCACTGGTACCTGGGG 0: 1
1: 0
2: 2
3: 10
4: 117
1083302447_1083302457 5 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302457 11:61746095-61746117 CTCTCATGATCACTGGTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083302447 Original CRISPR TCTCTTGGTCGGGGGAGCCT AGG (reversed) Exonic
901202326 1:7473700-7473722 TCTGTTGGCTGGGGGTGCCTGGG - Intronic
901427001 1:9188395-9188417 TCTTTAGGTGGGGGGATCCTTGG - Intergenic
902204757 1:14860034-14860056 TCTCTTGGCCTGGGGAGCAGGGG - Intronic
907235312 1:53041037-53041059 TCTCTTGTTGGAGAGAGCCTAGG + Intronic
909561368 1:77012604-77012626 TCTCTTGGTGGGAGAGGCCTTGG + Intronic
910939493 1:92517902-92517924 TTTTTTGGTCGGGGGAGACACGG + Intronic
912520268 1:110240294-110240316 TCTCCTGCTCCGGGCAGCCTGGG - Intronic
912734038 1:112134245-112134267 TTTCTTGGTCTGGGGTCCCTGGG + Intergenic
916240197 1:162631914-162631936 TTTCTTGGTGGGGGGAGCCGTGG + Intronic
917518079 1:175724764-175724786 TGGCTTGGTCTGGGGAGCCAGGG + Intronic
920284810 1:204871717-204871739 TTTCTGGGTCAGGAGAGCCTTGG + Intronic
920701469 1:208220874-208220896 TCACTGGGTCGGGGAGGCCTAGG - Intronic
921935758 1:220795158-220795180 TAACTTGGTTGGGGGACCCTGGG + Intronic
1065474443 10:26118942-26118964 TCTGTTGGCCCAGGGAGCCTGGG + Intronic
1068008402 10:51417847-51417869 TCTCTTGGTTGGATGAGACTTGG + Intronic
1069058344 10:63867621-63867643 TCTCTGGGTGGGGGCAGCTTTGG + Intergenic
1069890342 10:71648605-71648627 TCCCTTGGTCGGTGGTGCCAAGG + Intronic
1070916495 10:80158432-80158454 TCTCATGGCCTGGGAAGCCTAGG - Intronic
1071486059 10:86103505-86103527 ACGCTTGCTTGGGGGAGCCTAGG - Intronic
1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG + Intronic
1076032170 10:127168736-127168758 GCTCTTGGAGGGGTGAGCCTGGG + Intronic
1079320288 11:19446414-19446436 TCTCTGTGTCGGCTGAGCCTTGG - Intronic
1083302447 11:61746067-61746089 TCTCTTGGTCGGGGGAGCCTAGG - Exonic
1083939065 11:65885387-65885409 TCTATGGGCAGGGGGAGCCTGGG + Intronic
1089209356 11:116790078-116790100 GCTCCTTGTCTGGGGAGCCTTGG - Exonic
1089865227 11:121626010-121626032 TCTCTTAGTGGGGGGTGCCAAGG - Intronic
1092147354 12:6223747-6223769 GCTCTTGGTCGGGGAACCCATGG + Intronic
1095968449 12:47884795-47884817 TCCCTTGGCCTGGGGATCCTTGG - Intronic
1102733476 12:115135998-115136020 TCTCTTCGTCGGCAGATCCTGGG - Intergenic
1103478093 12:121233132-121233154 TCTCTTGGGTGTGGGAGCCCTGG + Intronic
1105051371 12:133054298-133054320 TCTCTTGAGCCTGGGAGCCTGGG + Intronic
1107174202 13:37380724-37380746 TCTCTTTGAGGGGGGAGACTGGG + Intergenic
1113060288 13:106315070-106315092 TCTCTTAGTCCAGGGATCCTGGG + Intergenic
1114218244 14:20673869-20673891 TCTCTTCCTGGGAGGAGCCTGGG - Intergenic
1118645117 14:67830958-67830980 TCACTTGAACGTGGGAGCCTGGG - Intronic
1125499110 15:40227258-40227280 TCTCTTGGTGGGGGGATGCGGGG - Intergenic
1129288561 15:74545460-74545482 TATCTTGGAGGGTGGAGCCTAGG + Intronic
1134060585 16:11197361-11197383 TGTCTTGGTTAGGGCAGCCTAGG + Intergenic
1134062562 16:11207936-11207958 ACTCTTTCTGGGGGGAGCCTGGG + Intergenic
1136489863 16:30600262-30600284 TCTCTAGATCTGGGGAGGCTGGG - Intergenic
1136554260 16:30998400-30998422 TCACTCAATCGGGGGAGCCTTGG - Intronic
1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG + Intergenic
1138528730 16:57623380-57623402 TCCCTTGGTGAGTGGAGCCTCGG - Intronic
1141474589 16:84264228-84264250 CCTGTGGGTCGTGGGAGCCTTGG + Intergenic
1141496363 16:84413119-84413141 TCTCATGGTCTGGGGTGTCTGGG + Intronic
1141755548 16:85988311-85988333 TCTGTTGGACGTGGGAACCTTGG - Intergenic
1141755699 16:85989284-85989306 TCTGTTGGATGTGGGAGCCTCGG + Intergenic
1143646374 17:8232838-8232860 TCTCATAGCCAGGGGAGCCTGGG - Intronic
1145907405 17:28524068-28524090 TCTGTGGGGCAGGGGAGCCTGGG - Exonic
1146461898 17:33052655-33052677 TCTTTGGGTCGGGGGTGGCTAGG + Intronic
1148179297 17:45592053-45592075 TCTCTTGAGCCTGGGAGCCTGGG + Intergenic
1148269871 17:46254461-46254483 TCTCTTGAGCCTGGGAGCCTGGG - Intergenic
1152598984 17:81252135-81252157 CCTCTTGGGCTGGGGAGGCTGGG - Intronic
1152786293 17:82249663-82249685 TCACGTGGCCGGGGCAGCCTAGG - Intronic
1152840250 17:82562816-82562838 TTTTTTGGTCGGGGGAGACAGGG + Intronic
1153712874 18:7818010-7818032 TCCCTGGGTCAGGGCAGCCTAGG + Intronic
1160681549 19:413713-413735 TCTCTGGGTTGGAAGAGCCTGGG - Intergenic
1161024333 19:2028643-2028665 TCCCTGTGTCGGGGAAGCCTGGG - Intronic
1161395564 19:4043245-4043267 TGTTTTGTTCGGGGGAGGCTGGG - Intergenic
1161953274 19:7479166-7479188 TCTGTGGGTCTGGGGAGCCCAGG - Intronic
1162094390 19:8302082-8302104 TCCCTTGGCCTGGGCAGCCTGGG - Intronic
1164053727 19:21604773-21604795 TCTCTTTCTCGGGTGAGACTGGG - Intergenic
1166458758 19:42967429-42967451 TCTTTTGGTAGGGGCAGACTTGG + Intronic
1167693439 19:51001101-51001123 GCTCTTGCTGGGGGGAGCCTGGG - Exonic
1168258584 19:55180229-55180251 TCTCCGGGGCGGGGGAGCCGCGG + Exonic
925579539 2:5396707-5396729 TCTCTTAGTCGGGTGAGACTGGG + Intergenic
925822064 2:7809087-7809109 TCTCTTCTTCAGGAGAGCCTCGG + Intergenic
928994530 2:37272976-37272998 TCTCTTGGTGGGGGGAGGGGGGG + Intronic
934521851 2:95024959-95024981 TCTCTTGGTCTGGGCAGCCCGGG - Intergenic
934558862 2:95301963-95301985 TCGCCTTGTCGGGGGAGCCGAGG - Intronic
934766555 2:96883206-96883228 AGTCTTGGCTGGGGGAGCCTGGG - Intronic
935268350 2:101413460-101413482 TCCCTTCCTCGTGGGAGCCTTGG + Intronic
937892399 2:126948593-126948615 ATGCTTGGTAGGGGGAGCCTGGG - Intergenic
946656621 2:221955392-221955414 TGTCTTGGCCGGTGGAGCATGGG + Intergenic
1180847050 22:18989214-18989236 TGTCTGGGTCGGGGGAGGCAGGG + Intergenic
1180917128 22:19497100-19497122 TCACTTGGTAGGGGCAGCCCGGG - Intronic
1181973972 22:26714923-26714945 GCTCTTCTTCTGGGGAGCCTGGG + Intergenic
1182887444 22:33787354-33787376 TGTCTTGGTAGGAGGAGCGTAGG - Intronic
953197691 3:40750007-40750029 TCTCTTGTTCTGGGGGGCCCTGG + Intergenic
953349266 3:42202475-42202497 TCTCCAGGTCGTGGGAGCCTGGG - Exonic
954398029 3:50303310-50303332 CCCCTTGGTCGGGTCAGCCTGGG - Exonic
956070097 3:65439833-65439855 TTTCTTGATCAGGGGAGCATGGG - Intronic
956937022 3:74114333-74114355 TATCTTAGTCTGGGGAACCTTGG + Intergenic
962319062 3:134376067-134376089 TCTCTTCGTAAGGGGATCCTTGG - Intergenic
963298024 3:143568289-143568311 TCTCTTTGTCAGGGGAGGGTGGG + Intronic
966017204 3:175155173-175155195 TCTCTGGGGCGGTGGGGCCTGGG + Intronic
968577447 4:1374493-1374515 TGTCCTGGTCCGGGGACCCTGGG + Intronic
968618821 4:1594340-1594362 TCTCCTTGTGGGGGGACCCTGGG + Intergenic
968871699 4:3245849-3245871 TGTCCTGGTCGGGGGTGTCTGGG + Intronic
984826701 4:183931423-183931445 TTTTTTGGTGGGGGGAGGCTGGG - Intronic
985802682 5:2015623-2015645 TATCATGGCCGGGGCAGCCTCGG + Intergenic
1002521382 5:179794836-179794858 TCTCTTGGTCAGGTGAGGCCAGG - Intronic
1002817560 6:693944-693966 TCTCGAGGTCGGGGGATACTCGG + Intergenic
1003050723 6:2778663-2778685 TCTCTTGGCCTGGGGAATCTTGG - Intronic
1005840291 6:29740745-29740767 CTTCTTGGTCAGGGTAGCCTCGG - Intergenic
1006898623 6:37486054-37486076 TCTCTGGCTGGGGCGAGCCTGGG + Intronic
1014618191 6:123630924-123630946 ACTCTTGGTCTGGGGAGGATGGG - Intronic
1016357210 6:143231510-143231532 TCTCTTGGCTGAGGGAGCATGGG + Intronic
1018419646 6:163630764-163630786 TCTCGTGGGAGGGGGAGCCAGGG + Intergenic
1023873910 7:44276695-44276717 TCTCTCTGTGGGGTGAGCCTCGG + Intronic
1029405887 7:100373809-100373831 TTTCCTGGTGGTGGGAGCCTGGG - Intronic
1031580434 7:123467937-123467959 TCTCTTGGCCTGCGGAGCTTAGG - Intronic
1033423387 7:141222002-141222024 GCTCTTGGTCTGGAGAGCATTGG + Intronic
1034686960 7:152980642-152980664 TCTCTTGGTAGCAGGTGCCTGGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036541540 8:9717840-9717862 TCTGTTGGTGGTGGCAGCCTGGG + Intronic
1038251888 8:25912728-25912750 TAGTTTGGTCGGGGGATCCTTGG - Intronic
1038522271 8:28243710-28243732 TTCCTTGGTCGGGGGATCCAGGG - Intergenic
1039294890 8:36139811-36139833 TCTCTTGGAAGGGAGAACCTAGG + Intergenic
1040589632 8:48778480-48778502 TCTGTAGGTGGGTGGAGCCTAGG - Intergenic
1044274394 8:90283666-90283688 TCTCTTTGCCAGTGGAGCCTGGG - Intergenic
1047372349 8:124266604-124266626 TCTCTTGGCCGAGAGAGCCTGGG - Intergenic
1051694102 9:19750044-19750066 TCTCCTGGTCTGGGAAGCATGGG - Intronic
1053434292 9:38065344-38065366 TCTTCTGGTCAGGGCAGCCTTGG - Intronic
1059954448 9:119501107-119501129 TTTCTTGGTCTTGGGAGGCTTGG - Intronic
1061263645 9:129493648-129493670 TCTGCTGGTCTGGGGAGCCGGGG + Intergenic
1061626533 9:131843873-131843895 TCTCCTGGGCGGGGGGGCCAGGG - Intergenic
1186128641 X:6442927-6442949 TCTCTCTGTTGGTGGAGCCTGGG + Intergenic
1186185307 X:7014499-7014521 TCTTTTGGTAGGGGCAGACTTGG + Intergenic
1189115705 X:38340269-38340291 TCTCTGGGTCTGGGGAAGCTTGG - Intronic
1190436865 X:50434098-50434120 TTTCTTGGTGGTGGGAGCCCAGG - Intronic
1192149562 X:68703743-68703765 TCTCTTGGTCTGGAAAGTCTTGG - Intronic
1198723047 X:139645031-139645053 TCTCTGGGTCTTGGGAACCTGGG + Intronic
1199551623 X:149067664-149067686 TCTCTTGCTTGGAGGAGGCTTGG + Intergenic