ID: 1083302447

View in Genome Browser
Species Human (GRCh38)
Location 11:61746067-61746089
Sequence TCTCTTGGTCGGGGGAGCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083302447_1083302460 8 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302460 11:61746098-61746120 TCATGATCACTGGTACCTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 121
1083302447_1083302457 5 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302457 11:61746095-61746117 CTCTCATGATCACTGGTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 106
1083302447_1083302461 20 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302461 11:61746110-61746132 GTACCTGGGGGCCTGAATTCTGG 0: 1
1: 0
2: 0
3: 5
4: 132
1083302447_1083302458 6 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302458 11:61746096-61746118 TCTCATGATCACTGGTACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 127
1083302447_1083302453 -2 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302453 11:61746088-61746110 GACCTCCCTCTCATGATCACTGG 0: 1
1: 1
2: 0
3: 15
4: 131
1083302447_1083302459 7 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302459 11:61746097-61746119 CTCATGATCACTGGTACCTGGGG 0: 1
1: 0
2: 2
3: 10
4: 117
1083302447_1083302463 27 Left 1083302447 11:61746067-61746089 CCTAGGCTCCCCCGACCAAGAGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1083302463 11:61746117-61746139 GGGGCCTGAATTCTGGCCCCCGG 0: 1
1: 0
2: 3
3: 29
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083302447 Original CRISPR TCTCTTGGTCGGGGGAGCCT AGG (reversed) Exonic