ID: 1083303018

View in Genome Browser
Species Human (GRCh38)
Location 11:61748608-61748630
Sequence AGGCCAGGAGAGTCCCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083303007_1083303018 27 Left 1083303007 11:61748558-61748580 CCTCTTCCTCTGCGAAATGGCCT 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1083303018 11:61748608-61748630 AGGCCAGGAGAGTCCCACGGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
1083303012_1083303018 0 Left 1083303012 11:61748585-61748607 CCAGTGCTGTGTGGGTCCACAGG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1083303018 11:61748608-61748630 AGGCCAGGAGAGTCCCACGGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
1083303011_1083303018 7 Left 1083303011 11:61748578-61748600 CCTGATGCCAGTGCTGTGTGGGT 0: 1
1: 0
2: 1
3: 14
4: 180
Right 1083303018 11:61748608-61748630 AGGCCAGGAGAGTCCCACGGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
1083303005_1083303018 30 Left 1083303005 11:61748555-61748577 CCTCCTCTTCCTCTGCGAAATGG 0: 1
1: 0
2: 3
3: 25
4: 318
Right 1083303018 11:61748608-61748630 AGGCCAGGAGAGTCCCACGGTGG 0: 1
1: 0
2: 2
3: 13
4: 219
1083303008_1083303018 21 Left 1083303008 11:61748564-61748586 CCTCTGCGAAATGGCCTGATGCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1083303018 11:61748608-61748630 AGGCCAGGAGAGTCCCACGGTGG 0: 1
1: 0
2: 2
3: 13
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083303018 Original CRISPR AGGCCAGGAGAGTCCCACGG TGG Intergenic
900119495 1:1042403-1042425 AGGCCAGAGGACTCCCAGGGAGG - Intronic
900415562 1:2532942-2532964 AGGCCAGGCGTGTGCCTCGGAGG - Intergenic
900793203 1:4692729-4692751 AGGACAGCAGAGTGCCAGGGTGG - Intronic
901151399 1:7105449-7105471 AGGGCATGACAGGCCCACGGTGG + Intronic
901472536 1:9467710-9467732 AGCCCAGGAGAGACACACGCAGG - Intergenic
901530315 1:9848889-9848911 AGCCCTGGAGAGCCCCATGGTGG - Exonic
901703736 1:11059097-11059119 AGGCCAGGGGCGTCCCGCGGAGG - Intronic
905892335 1:41525260-41525282 AGGCCACCAGAGTCCCAGAGAGG + Intronic
906193344 1:43913220-43913242 AGGCCAGGAGAGTGAAGCGGAGG - Intronic
907444947 1:54501498-54501520 AGGCCAGGAGTCTCCCTCAGTGG - Intergenic
914344559 1:146787603-146787625 AGGGCAGGTGAGCCCCACAGTGG + Intergenic
915007222 1:152649929-152649951 AGGCCAGGAGAAACCAAAGGAGG - Intergenic
915662502 1:157415882-157415904 TGGCAAGGAGAGTCAGACGGAGG - Intergenic
924582650 1:245335565-245335587 GGGAAAGGAGAGTCCCACGCGGG + Intronic
924582660 1:245335607-245335629 GGGAAAGGAGAGTCCCACGAGGG + Intronic
924582666 1:245335628-245335650 GGGAAAGGAGAGTCCCACGAGGG + Intronic
924582706 1:245335749-245335771 ACGCAGGGAGAGTCCCACGCAGG + Intronic
924582711 1:245335770-245335792 GGGAAAGGAGAGTCCCACGCAGG + Intronic
924582762 1:245335953-245335975 GGGAAAGGAGAGTCCCACGCAGG + Intronic
924582774 1:245335995-245336017 GGGAAAGGAGAGTCCCACGCAGG + Intronic
924582778 1:245336011-245336033 ACGCAGGGAGAGTCCCACGCAGG + Intronic
924582790 1:245336053-245336075 GGGAAAGGAGAGTCCCACGCAGG + Intronic
924582822 1:245336173-245336195 GGGAAAGGAGAGTCCCACGCAGG + Intronic
1064006398 10:11702659-11702681 TGGCCAGGAGGGTCCCCTGGAGG + Intergenic
1065493784 10:26308617-26308639 AGGCCAGCAGCGTCCCTCAGTGG - Intergenic
1067238773 10:44473023-44473045 AGGCCAGGTGAGCTCCCCGGAGG + Intergenic
1068470011 10:57448628-57448650 AGACCAGGAGATTCCCTCAGGGG - Intergenic
1068931420 10:62594256-62594278 AGGCCAGGAGAGAGTCAAGGAGG + Intronic
1069772254 10:70907390-70907412 AAGCCTGGGGAATCCCACGGTGG + Intergenic
1070538746 10:77400853-77400875 TTGCCAGGAGAGTCTCAAGGTGG + Intronic
1070891326 10:79943985-79944007 AGGCCATGAGAGCACCAGGGTGG + Intronic
1072397200 10:95056830-95056852 AGGGCAGGCGAGTCCCAATGTGG + Intronic
1072493752 10:95934546-95934568 AGACCAGGAGATTCCCTTGGGGG - Intronic
1076141047 10:128078649-128078671 AGGCCAGGAGTGCACCCCGGTGG - Intronic
1076197964 10:128533737-128533759 AGGCCCAGAGAGTCCCAGGTGGG - Intergenic
1076590411 10:131578469-131578491 TGGCCAGTGGACTCCCACGGAGG - Intergenic
1076738525 10:132469267-132469289 GGGCAAGGAGAGTCCCAAGCAGG - Intergenic
1077032330 11:474167-474189 AGGCCTGGAGAGACCCTCGGTGG - Intronic
1077342701 11:2033090-2033112 AGGCCAAGAGACACCCAAGGGGG + Intergenic
1078273827 11:9823365-9823387 AGACCAGGAGAGACACACAGTGG + Intronic
1079124615 11:17709694-17709716 AGTCCAGGAGAGCTTCACGGAGG + Intergenic
1079352018 11:19699793-19699815 AGGCCAGGAGAGGCACAGAGGGG - Intronic
1083169449 11:60914355-60914377 AGGCCTGGAGAGTCCGAGTGGGG + Intronic
1083303018 11:61748608-61748630 AGGCCAGGAGAGTCCCACGGTGG + Intergenic
1083942387 11:65903399-65903421 AGGCCAGGAGAGAACCCCAGGGG + Intergenic
1085472398 11:76766715-76766737 CGGGCAGGAGGGTCCCAGGGAGG - Intergenic
1088480912 11:110296166-110296188 AGGAAAGGAGAATCCCGCGGCGG + Intronic
1089389865 11:118093392-118093414 AGGGCAGGCGAGTCCCTGGGTGG + Intronic
1091170909 11:133518928-133518950 AGGCCAGGAGCAGCCCACAGAGG + Intronic
1202825687 11_KI270721v1_random:88279-88301 AGGCCAAGAGACACCCAAGGGGG + Intergenic
1091691063 12:2597859-2597881 AGGGAAGGAGAGTCCTACGTGGG - Intronic
1091975269 12:4819565-4819587 AGGCCAGGGGAGACCCACAAGGG - Intronic
1095701987 12:45200150-45200172 TGGCCAGGAGAGTTCAACAGAGG - Intergenic
1096241164 12:49961250-49961272 AGGCCGGGAGCGGCCCACGTCGG + Intergenic
1096533461 12:52256367-52256389 AGGCCAGGAGAGACCAGCAGGGG - Intronic
1097119550 12:56720866-56720888 AGGCCATGGGAGTCACACAGTGG + Exonic
1101752017 12:107589665-107589687 AGGCTAGGAGAGACACAAGGGGG + Intronic
1102245503 12:111353301-111353323 AGGCCAGGACAGCCCCCAGGAGG + Intergenic
1104847785 12:131855465-131855487 AGGCCAGGAGGGTGGCAGGGAGG - Intergenic
1106196444 13:27498074-27498096 AGGCCAGGGGCGTCCTATGGGGG + Intergenic
1108503313 13:51087300-51087322 AGGGCAGGAGAGGCCCACGGTGG - Intergenic
1110263841 13:73516060-73516082 AAGCCTGGAGGGTCTCACGGCGG - Intergenic
1112750981 13:102583109-102583131 AGGCCAACTGAGTCCCAAGGGGG - Intergenic
1118339073 14:64879776-64879798 AGGGCAGGTGAGTCCCAGGAGGG - Exonic
1118843450 14:69528818-69528840 AGGGCAGCAGAGTCCCAGAGAGG - Exonic
1120709020 14:87773933-87773955 AGGCCAGGAAAGTCTCAGAGGGG + Intergenic
1121757384 14:96414427-96414449 TGGCCAGGAGACTCCCAGGAAGG + Intronic
1122034213 14:98935766-98935788 AGGCCTGGAGAGCCACAGGGAGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1129207076 15:74043756-74043778 AGGCCAAGAGCCTCCCACTGAGG - Intronic
1130889428 15:88120644-88120666 AGGCCAGGAGTGCCCCAGGTTGG + Intronic
1131286544 15:91063763-91063785 AAGCCAGGAGCTTCCCACAGTGG - Intergenic
1132156358 15:99498379-99498401 AGGCCAAGAGAGGATCACGGTGG - Intergenic
1132425098 15:101709458-101709480 ACACCAGGACAGTCCCACAGAGG + Intronic
1132870438 16:2113372-2113394 CGGGCTGGAGAGTCCCACGCGGG + Intronic
1133603371 16:7361521-7361543 AGACCAGGTGAGTCCGAAGGTGG + Intronic
1134522102 16:14923553-14923575 CGGGCTGGAGAGTCCCACGTGGG - Intronic
1134709771 16:16322204-16322226 CGGGCTGGAGAGTCCCACGCGGG - Intergenic
1134949832 16:18346441-18346463 CGGGCTGGAGAGTCCCACGCGGG + Intergenic
1136124118 16:28164175-28164197 AGGGCAGGAGAGCCCCACAGGGG + Intronic
1136291659 16:29276257-29276279 AGGAGAGGGAAGTCCCACGGAGG - Intergenic
1136367376 16:29814972-29814994 AGGCCAGGAGAGATGCAGGGAGG - Intronic
1136861554 16:33707249-33707271 AGGCGCGGAGAGGCCCACGGCGG - Intergenic
1138451812 16:57097792-57097814 AGGGCAGGGGACTCCCATGGAGG - Intronic
1139475034 16:67198943-67198965 AGTCCAGCACAGTCCCAAGGAGG - Intergenic
1139989433 16:70927703-70927725 AGGGCAGGTGAGCCCCACAGTGG - Intronic
1142097540 16:88250198-88250220 AGGAGAGGGAAGTCCCACGGAGG - Intergenic
1142114508 16:88349216-88349238 AGGCCATGAGAGACAGACGGAGG + Intergenic
1142508181 17:379159-379181 AGGCCTGGAGTATCCCAGGGAGG - Intronic
1142559083 17:799321-799343 AGGACAGCAGAGGCCCAGGGTGG + Exonic
1142563582 17:825531-825553 AGGCCAGGAGAGTGACACGGGGG + Intronic
1146229327 17:31094752-31094774 AGTCTAGGTGAGCCCCACGGCGG + Intergenic
1146453503 17:32992645-32992667 ATGCCAGGAGACTCTCACTGGGG + Intronic
1147312159 17:39601817-39601839 TGGCCAGGAGAGCCACATGGAGG + Intergenic
1149258899 17:54857995-54858017 AGGCTAGGGAAGTCCCACGCTGG + Intergenic
1151625086 17:75271291-75271313 AGGCCAGGGCAGTGCCCCGGGGG - Intergenic
1152140482 17:78533612-78533634 AGGACTGGAGAATCCCAAGGTGG + Intronic
1152229602 17:79107847-79107869 GGTACAGGAGAGTCCCTCGGTGG + Intronic
1152238081 17:79148794-79148816 AGGCCCGCAGAGGCCCTCGGAGG - Intronic
1152569727 17:81116382-81116404 GGCCCAGGAGAGCCCCACCGAGG - Exonic
1152601115 17:81262675-81262697 AGGACAGGAGACTCCCCAGGTGG + Intronic
1152623856 17:81379531-81379553 TGGCCAGGAGACTCCCAGGAAGG + Intergenic
1152760707 17:82105747-82105769 AGGCCCGGAGTGTCCCCCTGTGG - Intronic
1156464847 18:37342366-37342388 AGGCCTGGAGAGTGCAAGGGTGG + Intronic
1157304571 18:46507728-46507750 AGGACAGGGCATTCCCACGGTGG - Intronic
1162022469 19:7874110-7874132 AGGCCAGGGGAGGCCGATGGGGG - Intronic
1162100010 19:8333818-8333840 AGGCCAGGAGAGACTCAGGATGG + Intronic
1162516749 19:11152838-11152860 AGGCCTGGAGAGTGCCCAGGAGG - Intronic
1163127977 19:15254655-15254677 AGGCAGGGAGAGACCCCCGGGGG + Intronic
1163536213 19:17878087-17878109 AGACCAGGTGAGTCCCACCCAGG + Exonic
1163675183 19:18652182-18652204 TGTGCAGGAGAGTCCCACTGAGG + Intronic
1165339890 19:35203977-35203999 AGGGCAGGAGAGTCCTAGTGAGG + Intergenic
1165871548 19:38976312-38976334 AGGACAGGGGAGTCCTAAGGTGG - Intergenic
925073268 2:987946-987968 CGGCCTGGAGAGGCCCACGTGGG - Intronic
925306892 2:2854123-2854145 AGGCCTGGAGAGAGCCACTGGGG + Intergenic
925349097 2:3188716-3188738 AGACCAGGGGAGGCCCAGGGCGG + Intergenic
926165234 2:10518834-10518856 AGGCCAGGGGAGTCCAGCCGAGG + Intergenic
926706748 2:15842810-15842832 AGGCCAGGAGAATGCCAGGCTGG + Intergenic
926904361 2:17792231-17792253 ATTCCAGGAAAGTCCCACAGAGG - Intronic
927168835 2:20351242-20351264 ATGCCAGGAGTACCCCACGGTGG - Intronic
927441790 2:23124007-23124029 AGGCGGGGAGAGTCCAACGCTGG + Intergenic
929435353 2:41924702-41924724 AGGCCAGGAGAGGCCAACCCAGG - Intergenic
929602393 2:43212636-43212658 AGGCCTGGACAGTGCCCCGGTGG + Intergenic
930116602 2:47723460-47723482 AGGCCAGGAGAGCTCCATGAAGG - Intronic
931153275 2:59598724-59598746 ATGTCAGGAGAGTCTCACTGAGG + Intergenic
932294702 2:70614781-70614803 AGGACAGGATGCTCCCACGGTGG - Intronic
933248663 2:80003875-80003897 ATGCCAGGAAAGTCCCAGGAGGG + Intronic
934557908 2:95297102-95297124 AGGCCAGGAGAGCCAGACAGAGG + Intergenic
937779721 2:125823149-125823171 ATGCCAGGAAAGTGCCAAGGAGG + Intergenic
938968368 2:136408207-136408229 AGACCAGTAGAGGCCCAGGGAGG - Intergenic
942531083 2:176911117-176911139 AGGCCAGGAGAGTCACGGGTGGG - Intergenic
943985023 2:194607171-194607193 AGATGAGGAGACTCCCACGGGGG + Intergenic
946418420 2:219551982-219552004 GGCCCAGGAGAGCCCCTCGGGGG + Intronic
946516557 2:220417738-220417760 AAGCCAGAGGAGTCCCACAGTGG + Intergenic
946662683 2:222018442-222018464 TGGCCAGGAGAATCCTAGGGGGG - Intergenic
947829573 2:233129485-233129507 AGCCCAGGCCAGTCCCACGAGGG - Intronic
948853184 2:240718264-240718286 CTGCCAGGAAAGTCCCAGGGAGG + Intronic
949047657 2:241879492-241879514 AGGCCAGGGAAGTCCCCAGGAGG + Intergenic
1168976337 20:1968824-1968846 AGCCCAGGAGAAACCCACAGGGG + Intergenic
1172619110 20:36307701-36307723 AGGGCAGGCCAGTCCCCCGGGGG - Intronic
1173569439 20:44067025-44067047 AGGCCAGCAGAGTCCTTCCGGGG - Intronic
1173618499 20:44418576-44418598 AGGCAAGGAGATTCACATGGTGG + Intronic
1174353544 20:49983975-49983997 GCTCCAGGAGAGTCCCAGGGTGG + Exonic
1175218196 20:57402486-57402508 AGTGCAGGAGAGTCCCACCAGGG + Intronic
1175223200 20:57429229-57429251 AGGCCAGGAGGATCCCAGGCAGG - Intergenic
1175766585 20:61596752-61596774 AGTCCAGGGCAGCCCCACGGAGG - Intronic
1176043768 20:63082038-63082060 AGGCCATAGGAGTCCCACGGTGG - Intergenic
1176084609 20:63290263-63290285 TAGCCAGGAGAGGCCCACAGAGG + Intergenic
1176147073 20:63570301-63570323 GGGCCAGGACAGTCCCACCTTGG - Intronic
1176286463 21:5021668-5021690 AAGCCAGGTGAGGCCCAGGGGGG - Intergenic
1176410672 21:6447955-6447977 AGGCCAGGAGAGTCGCTCGCAGG - Intergenic
1179682457 21:43033166-43033188 AGGCCAAGCTAGTCCCTCGGTGG - Exonic
1179686166 21:43056277-43056299 AGGCCAGGAGAGTCGCTCGCAGG - Intronic
1179870718 21:44241807-44241829 AAGCCAGGTGAGGCCCAGGGGGG + Intergenic
1180020851 21:45125631-45125653 AGGACAGGAGAGTCACATTGTGG + Intronic
1180595488 22:16970233-16970255 AGGCCAGGACTGCCCCAGGGAGG + Intronic
1181980414 22:26762005-26762027 AGGGCAGGAGTGGCTCACGGAGG + Intergenic
1182098444 22:27641576-27641598 GGGACAGGAGGGGCCCACGGAGG - Intergenic
1183548334 22:38467335-38467357 AGGACAGGAGAGACCCAGGAGGG - Intergenic
1183899844 22:40996775-40996797 AGGCCAGGAGGCTCCCACAGTGG + Intergenic
1184060169 22:42076829-42076851 AGGCCAGTAGAGGCCCAGGAGGG + Intronic
1185139436 22:49092154-49092176 AGGCCAGGAGCCTGACACGGAGG - Intergenic
949460626 3:4289222-4289244 AGGCCAAGATAGTCCCACTTGGG + Intronic
950461495 3:13124917-13124939 AGGCCAGGATGGTGGCACGGAGG - Intergenic
954154957 3:48680296-48680318 AGGCCTGGAGAGTCCATCTGTGG + Intronic
955069021 3:55556690-55556712 AGGACAGGAGAGACTCAGGGTGG + Intronic
957776445 3:84761015-84761037 AGACCAGGAGATTCCCTCGGGGG + Intergenic
962169733 3:133088255-133088277 AGGGCAGGAAAGGCCCACAGAGG + Intronic
965880400 3:173382157-173382179 AGACCAGGAGATTCCCTCGGGGG + Intergenic
967880212 3:194296672-194296694 AGGCCAGGAATGTGCCACAGCGG + Intergenic
968266521 3:197367419-197367441 GGGCCAGCAGAGTCCCAGCGTGG - Intergenic
968704748 4:2072673-2072695 AGGCCAGGAGAGCCCTCCCGGGG + Intronic
969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG + Intergenic
969524577 4:7697689-7697711 AGGCCAGGAGGGGGCTACGGGGG + Intronic
969630803 4:8334897-8334919 AAGCCAGGAGGGTCCCTGGGAGG - Intergenic
975509323 4:75175811-75175833 AGGCCTGGAGAGTCAGACAGAGG - Intergenic
976363013 4:84202617-84202639 AGACCAGGAGACTCCCTCAGGGG + Intergenic
984704409 4:182837222-182837244 AAGCCAGGAGAGTTGCACAGGGG - Intergenic
984818996 4:183863191-183863213 AGCCCTGGAGAGTCCCAATGTGG + Intronic
990466733 5:56078113-56078135 AGTGGAGGAGACTCCCACGGTGG - Intergenic
994091964 5:95817689-95817711 AGGCCAGGAGTGTTCCACCAAGG + Intronic
998400316 5:141845417-141845439 AGGTCAGGAGACTCCCAGGAAGG + Intergenic
1001257137 5:170192800-170192822 AGGCCTGGAAAGGCCCATGGAGG + Intergenic
1001437550 5:171712040-171712062 AGGACTGGAGAGTCTCACAGTGG - Intergenic
1001759876 5:174198598-174198620 AGGACTGGAGAGACCCAAGGGGG + Intronic
1002080948 5:176737122-176737144 AGGGCAGGAGAGGCCCAGGAAGG + Intergenic
1002342528 5:178526391-178526413 ATGCCAGCAGAGTCCCATAGAGG - Intronic
1004854449 6:19735136-19735158 AGACCAGGACTGTCCCACTGAGG - Intergenic
1009828849 6:68903796-68903818 AGGCCAGGAGAGACCAACCTGGG + Intronic
1009923697 6:70094876-70094898 AAGCCAGGAGATTCCCACAATGG - Intronic
1013097356 6:106957720-106957742 AGGCCAAAAGAGTCCGAGGGAGG + Intergenic
1013589031 6:111604878-111604900 AAGCCAGGATAGTCCCAGAGGGG - Intronic
1015531470 6:134225433-134225455 AGGGCAGGAGGGTACCACTGAGG + Intronic
1016701392 6:147058224-147058246 AGGCCAGGAGTGCCCCATGAGGG - Intergenic
1016856047 6:148671526-148671548 AGACCAGGAGATTCCCCCCGGGG - Intergenic
1018896153 6:168018928-168018950 AGGCCAGGAAAGAACCACCGGGG + Intronic
1019016436 6:168883835-168883857 AGGCCGGGTGAGACACACGGTGG - Intergenic
1019094846 6:169570884-169570906 AGGCCAGGAGTCTCCCGTGGCGG + Intronic
1019283071 7:210285-210307 AGGCCACGAGAGGCCCAAGGAGG - Intronic
1019312646 7:370138-370160 GGGCCAGGTGAGCCCCAGGGCGG + Intergenic
1019618976 7:1980299-1980321 CGCCCAGGTGTGTCCCACGGAGG - Intronic
1023649318 7:42352006-42352028 AGGGCAGGGGAATCCCAGGGAGG - Intergenic
1030128864 7:106179892-106179914 AAGCCAGGAGGGTCCCACCCAGG - Intergenic
1032087435 7:128891374-128891396 AGGCCAGGAGAGGCCCGCCCAGG - Intronic
1032711268 7:134462684-134462706 AGCCCAAGAGAGTACCATGGAGG + Intergenic
1033264811 7:139875833-139875855 AGGCCAGCAGAGTCCCCCCGTGG - Intronic
1033281013 7:140006357-140006379 ACTCCAGGAGAGTCACCCGGGGG + Intronic
1035574688 8:697018-697040 AGGACAGGAGATCCCCACCGAGG - Intronic
1035737792 8:1901303-1901325 AGACCAGGAGAGTCACTGGGAGG - Intronic
1037911220 8:22744735-22744757 AGGCCAGGTGAGTCACTTGGGGG + Intronic
1038535059 8:28347737-28347759 TGGCCGGGAGAGACCCAGGGAGG - Exonic
1040315694 8:46259732-46259754 ATGCCAGGAGCCTCCCAAGGAGG + Intergenic
1043059684 8:75484458-75484480 TGGCCAGGAGAATTCCAGGGAGG - Intronic
1043086154 8:75835971-75835993 AGGCAAGGAGGATCCCACAGAGG + Intergenic
1044335871 8:90984861-90984883 GGGCCAGGGGAGCCCGACGGAGG - Intronic
1049210436 8:141384068-141384090 AGGCCAGGCGCGTGCCATGGCGG - Intergenic
1049469411 8:142768790-142768812 AGGCCAGGAGGGTGCCCCTGGGG + Intronic
1050234445 9:3563015-3563037 AGACCAGGAGATTCCTTCGGTGG - Intergenic
1051627702 9:19113990-19114012 AGGTCAGGAGAGGCCAACAGTGG - Intronic
1055629872 9:78212498-78212520 AGGCCCTCAGAGTCCCACGCTGG + Intergenic
1057124821 9:92608869-92608891 AGGTGAGGAGAGGCCCAGGGAGG + Intronic
1057147412 9:92767642-92767664 AGACCATGGGAGTCCCACGCAGG + Intergenic
1057880939 9:98792179-98792201 AGGACAGGAGAGTCCTCTGGTGG - Intronic
1058429611 9:104906561-104906583 AGGCCAGGTCAGTGCCAAGGTGG - Intronic
1059747486 9:117217253-117217275 AGGCAAGGAGATTCCCCCAGGGG - Intronic
1059979798 9:119759081-119759103 AGTCCAGGAGAGACCCAGGCAGG - Intergenic
1060409359 9:123389934-123389956 AGGCCAGGAGAGGGCCACAGAGG - Intronic
1061863316 9:133478870-133478892 AGGTCAGGGGAGGCCCAGGGCGG + Intronic
1062274976 9:135726272-135726294 AGGCCGGGAGTCTCCCCCGGGGG - Intronic
1062577391 9:137215070-137215092 AGGCAAAGAGAGTCTCAGGGTGG - Intronic
1186320805 X:8422642-8422664 AGGACAGGCGAGTCCCAAAGTGG - Intergenic
1190931273 X:54951255-54951277 AGGCCAGGAGAGCCACACATAGG + Intronic
1192018414 X:67357750-67357772 AGACCAGGAGATTCCCTTGGGGG + Intergenic
1200075047 X:153546682-153546704 AGGCCAGCCGTGGCCCACGGAGG + Intronic
1200118047 X:153777744-153777766 AGACCAGGACATTCCCAGGGTGG + Intronic