ID: 1083304480

View in Genome Browser
Species Human (GRCh38)
Location 11:61755344-61755366
Sequence CCGGCTAATCCCCTAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 34}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083304470_1083304480 12 Left 1083304470 11:61755309-61755331 CCTCGAGGCTGGTACAGCCGGGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 34
1083304466_1083304480 14 Left 1083304466 11:61755307-61755329 CCCCTCGAGGCTGGTACAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 34
1083304473_1083304480 -10 Left 1083304473 11:61755331-61755353 CCCCCGTGACCGCCCGGCTAATC 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 34
1083304472_1083304480 -5 Left 1083304472 11:61755326-61755348 CCGGGCCCCCGTGACCGCCCGGC 0: 1
1: 0
2: 3
3: 21
4: 308
Right 1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 34
1083304462_1083304480 29 Left 1083304462 11:61755292-61755314 CCGGGACAGAGCGGCCCCCTCGA 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 34
1083304465_1083304480 15 Left 1083304465 11:61755306-61755328 CCCCCTCGAGGCTGGTACAGCCG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 34
1083304468_1083304480 13 Left 1083304468 11:61755308-61755330 CCCTCGAGGCTGGTACAGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083304480 Original CRISPR CCGGCTAATCCCCTAGAGAG AGG Intronic
901814594 1:11787065-11787087 CCGGCTAGTACCCTATAGAGAGG - Exonic
911238842 1:95442271-95442293 CTTGCTAAGTCCCTAGAGAGAGG + Intergenic
922471873 1:225882007-225882029 CCGACAAATCCCAAAGAGAGGGG + Intronic
1063196917 10:3752285-3752307 CAGAATGATCCCCTAGAGAGTGG + Intergenic
1076620499 10:131784418-131784440 CTGTCTAATCGCCTTGAGAGGGG - Intergenic
1080006362 11:27411826-27411848 TCGGCCACTCCCCTAGAGAATGG - Intronic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1096109850 12:49022045-49022067 CCGGCGAATCCCCAAAGGAGAGG - Exonic
1100337357 12:93643739-93643761 ACGTATACTCCCCTAGAGAGTGG - Intergenic
1106122477 13:26872126-26872148 CCGGCTAATGACCTTGAGTGAGG - Intergenic
1123503481 15:20913758-20913780 CTGGCTTCTTCCCTAGAGAGTGG + Intergenic
1123560728 15:21487423-21487445 CTGGCTTCTTCCCTAGAGAGTGG + Intergenic
1123596967 15:21924719-21924741 CTGGCTTCTTCCCTAGAGAGTGG + Intergenic
1125504276 15:40257958-40257980 CAGGCTGAGCCCCTACAGAGGGG + Intronic
1125857732 15:42966514-42966536 CCGGCTAATTCAGTAGAGACTGG - Intronic
1202969075 15_KI270727v1_random:214587-214609 CTGGCTTCTTCCCTAGAGAGTGG + Intergenic
1132566730 16:626994-627016 CTGACTCATCCCCTAGAGCGGGG - Intronic
1133206722 16:4238451-4238473 CCCGCTTATCCCCCAGAGGGAGG - Intronic
1159095749 18:63899613-63899635 CCGGCTAATCCCCTGGGAACAGG - Intronic
1160895206 19:1399257-1399279 CCGGCTCATCCCCCAGCGGGTGG + Intronic
929871397 2:45762066-45762088 GCAGCTACTCCCCTAGAGAGTGG - Intronic
947225872 2:227839677-227839699 CCGTTTACTCCCCTGGAGAGGGG - Intergenic
1174075087 20:47929576-47929598 CCTCCTTGTCCCCTAGAGAGGGG - Intergenic
954139121 3:48595863-48595885 CCGGCTTATCCCCTACAAAGAGG - Intergenic
956845360 3:73177418-73177440 CCAGCTAATTACCCAGAGAGTGG - Intergenic
958823872 3:99007177-99007199 CAGTCACATCCCCTAGAGAGGGG - Intergenic
966711624 3:182978921-182978943 CCGCATCATCCCCTAGACAGTGG - Intronic
976692373 4:87882690-87882712 CTGGCATATCCCCTTGAGAGTGG + Intergenic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
997217871 5:132129407-132129429 CCGTCCACTCCCCTAGAAAGGGG - Intergenic
1004603131 6:17169985-17170007 CTGGCTCAGCCCCTAGAGGGTGG - Intergenic
1018699113 6:166412923-166412945 CCGGCTCAACCCCTGGAGTGAGG - Intronic
1022408601 7:30118090-30118112 CAGGCTGATCCCCTGGAGAGAGG - Intronic
1022409762 7:30130147-30130169 CTAGCTCATCCTCTAGAGAGAGG - Intronic
1023637905 7:42230834-42230856 CCAGCTAACCCCGTAGAAAGTGG - Intronic
1024524549 7:50337019-50337041 CAGGATAATGCCCTAGAAAGAGG + Intronic
1026110033 7:67451720-67451742 CCACCTCCTCCCCTAGAGAGAGG - Intergenic
1035278070 7:157759856-157759878 CCAGCTCCTCCCCAAGAGAGGGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1059760000 9:117328835-117328857 ATGGCAAATCCCCTATAGAGTGG + Intronic