ID: 1083307332

View in Genome Browser
Species Human (GRCh38)
Location 11:61768205-61768227
Sequence TCCTCTACTTGGAGATGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083307332_1083307339 27 Left 1083307332 11:61768205-61768227 CCAGTACATCTCCAAGTAGAGGA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1083307339 11:61768255-61768277 GGAGAGAACACAAGGTGCTGTGG 0: 1
1: 0
2: 0
3: 35
4: 327
1083307332_1083307336 6 Left 1083307332 11:61768205-61768227 CCAGTACATCTCCAAGTAGAGGA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1083307336 11:61768234-61768256 AGGTGCCAGAGGAACTTAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 175
1083307332_1083307338 19 Left 1083307332 11:61768205-61768227 CCAGTACATCTCCAAGTAGAGGA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1083307338 11:61768247-61768269 ACTTAAGAGGAGAGAACACAAGG 0: 1
1: 0
2: 0
3: 27
4: 322
1083307332_1083307335 -5 Left 1083307332 11:61768205-61768227 CCAGTACATCTCCAAGTAGAGGA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1083307335 11:61768223-61768245 GAGGAATAATCAGGTGCCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083307332 Original CRISPR TCCTCTACTTGGAGATGTAC TGG (reversed) Intronic
902423615 1:16301729-16301751 TCGTCTACTTGAAGATAGACAGG - Intronic
906748929 1:48241634-48241656 TCCTCCAAGTGGAGATGTTCAGG - Intronic
911525159 1:98975405-98975427 TCATGTCCTTGGAGATGTACAGG + Intronic
915154804 1:153866402-153866424 TCCTCTACTTACAACTGTACAGG + Intronic
918306615 1:183252371-183252393 TGCAGTCCTTGGAGATGTACTGG - Exonic
918947128 1:191081414-191081436 TCCTCTACTTGGATGTGGGCTGG + Intergenic
924783705 1:247174842-247174864 TCCTCTGTTTGGAGATGGAGTGG + Intergenic
1063891903 10:10638932-10638954 TCCTCTGATTGGGGATCTACTGG - Intergenic
1079357245 11:19739970-19739992 TCCTCTCCTTGGAGAGGGAAAGG + Intronic
1082819511 11:57535196-57535218 TCCTCTATGTGGAGACCTACAGG + Intergenic
1083307332 11:61768205-61768227 TCCTCTACTTGGAGATGTACTGG - Intronic
1087389651 11:97516866-97516888 TCCTCTAGGGGGAGATTTACAGG - Intergenic
1088754516 11:112874767-112874789 ACTACGACTTGGAGATGTACAGG - Intergenic
1093593047 12:20929575-20929597 TCCACTCCTTGGAGAGGAACAGG - Intergenic
1094279889 12:28724572-28724594 TTATCTTCTTGGAGATGTTCTGG - Intergenic
1097763735 12:63499285-63499307 TTCTCAAGTTTGAGATGTACTGG - Intergenic
1098724345 12:73944017-73944039 TTCTCTACTTGAAAATATACAGG + Intergenic
1098737726 12:74127790-74127812 TCCTCAACTTGCAGATGGCCTGG + Intergenic
1102298320 12:111754018-111754040 ACCTCTACTTGGAGCTGTTTGGG + Intronic
1103610792 12:122123076-122123098 TCCTCTCCTTGAAGATTGACGGG + Intronic
1104381344 12:128310593-128310615 TCATCTCCTTGGTGATGAACAGG - Intronic
1107849769 13:44559447-44559469 TCCTCAACAGGAAGATGTACTGG + Intronic
1109071875 13:57779728-57779750 TTTTCTACTTGGAAATATACAGG + Intergenic
1110242611 13:73285779-73285801 ACCTGTACTTGGAGGTGCACAGG + Intergenic
1114750872 14:25203573-25203595 TACTCTGCTTGAAGATGTAGGGG + Intergenic
1115626073 14:35193144-35193166 TCCTCTAATAGAAGATGTATGGG + Intronic
1117610390 14:57477199-57477221 TCCTATACTTTTACATGTACAGG + Intronic
1121672744 14:95725353-95725375 TCTTCTACTTGGAGGTGTGAAGG + Intergenic
1126542939 15:49842024-49842046 TCCTCTCCTTGGAAATATCCTGG + Intergenic
1130883907 15:88077737-88077759 TCCTGTACTTGGAGCTGTCACGG + Intronic
1133596307 16:7296832-7296854 TCCTCTACTTGGAGGAATACAGG + Intronic
1135158625 16:20074259-20074281 TCCTCTATCCGGAGATGGACTGG - Intergenic
1138257720 16:55581916-55581938 TCCTCTACTTGGAGGTCTTGTGG + Intronic
1138943254 16:61815768-61815790 TCTCCTGCTTGGAGATGTAAAGG + Intronic
1141062996 16:80892212-80892234 TCCTCTACTTTGAGAGTCACTGG - Intergenic
1149491316 17:57086462-57086484 TCCTCTCCTGGGGGATGTCCTGG + Intronic
1157734154 18:50031652-50031674 TCTTATCCTTGGAAATGTACAGG + Intronic
1159122428 18:64186171-64186193 CCCTCTCCTTGTAGATGAACGGG - Intergenic
1164513477 19:28915605-28915627 TCCTTTCCTTGGACATTTACGGG - Intergenic
1164799813 19:31067255-31067277 ACCTGGACTTGGAGATGTTCAGG + Intergenic
1166792956 19:45408706-45408728 TCCTCTTCTTGGTGGTGGACGGG - Exonic
1168192120 19:54746599-54746621 TCCTCTGCATGTAGATGTCCAGG + Intronic
1168196450 19:54777877-54777899 TCCTCTGCATGTAGATGTCCAGG + Intronic
1168204810 19:54842133-54842155 TCCTCTGCATGTAGATGTCCAGG + Intronic
926442418 2:12903797-12903819 TCCTCAACTTGGGGAGGTAATGG + Intergenic
927427312 2:22995597-22995619 TCCTGTGCTGGGAGATGTCCTGG - Intergenic
928276412 2:29904769-29904791 TCCTCTCCTTTCAGAAGTACAGG + Intronic
928875993 2:36040645-36040667 CCCTCTAATTTGAGATCTACTGG - Intergenic
932111943 2:69009986-69010008 TTCTGGACTTGGAGAAGTACAGG - Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
933416688 2:81995538-81995560 TCCTGTGCTTGGAGATTGACGGG - Intergenic
934132616 2:88963553-88963575 TCCTACCCTTGGAGATCTACTGG + Intergenic
935306113 2:101738130-101738152 TTCTCTTCTTGGGGATGTAGCGG - Intronic
937662817 2:124450138-124450160 TCCTCTAGCTGGTGATGTCCAGG - Intronic
938991851 2:136637784-136637806 TCCTCTTCTTGGAGGTGTCAGGG - Intergenic
1172273051 20:33665138-33665160 TTCTCTACTTGAACATGCACAGG + Intronic
1174439783 20:50541443-50541465 TCGGCTCCTTTGAGATGTACGGG + Intronic
1181793265 22:25283724-25283746 TTCTCAACTTGCAGATCTACTGG + Intergenic
1181813903 22:25421997-25422019 TCCTCAACTTGCAGATCTACTGG + Intergenic
1181831873 22:25565824-25565846 TCCTCAACTTGTAGATCTACTGG + Intronic
1183468238 22:37990979-37991001 TCCTCTTTTTAGAGATGTAAGGG + Intronic
954332811 3:49899875-49899897 TCCTCATCTGTGAGATGTACGGG - Intronic
958823903 3:99007434-99007456 TCCTCTCCCTGGAGCTGAACAGG - Intergenic
958864582 3:99485949-99485971 TCCTCCACTTCCAGATATACAGG - Intergenic
964471396 3:157060655-157060677 TCCTGTACTTGTAGATGTCAGGG - Intergenic
964603652 3:158533597-158533619 TTCTCTATTTGGAGTTGTAAAGG - Intronic
965776339 3:172235625-172235647 TACTCAACTTGTAGCTGTACAGG - Intronic
967330505 3:188284921-188284943 TCCTCTGTTGGGAGATGTATCGG + Intronic
967903088 3:194477210-194477232 TCCTCTGCTAGGAGATGGAAGGG - Intronic
969621986 4:8283311-8283333 GCCTCTCCTTGCAGATGCACAGG + Intronic
973294655 4:48503975-48503997 GCCTCTACTTTGGGATGTAATGG + Intronic
979072632 4:116228721-116228743 TCCTCTACTTAGAGATCTTTTGG - Intergenic
985694927 5:1334881-1334903 TTCTCTCCTTGGAGATGACCTGG - Intronic
987112927 5:14703559-14703581 TCCTCTAGATGGAGATGTCAGGG + Intergenic
987900266 5:24001927-24001949 TCCTCTCTTTGGAGTTTTACTGG - Intronic
995114450 5:108463485-108463507 TCCTCCACTTGAATATGTGCAGG - Intergenic
995432614 5:112098429-112098451 TTCTCAACTCAGAGATGTACAGG - Intergenic
998328467 5:141303319-141303341 TACTCTACTTCAAGAAGTACCGG - Exonic
1001577946 5:172776950-172776972 ACGTCTACTTGGAGATGTAAAGG + Intergenic
1001769871 5:174286264-174286286 TCCTCTACTAGGATATGTTTTGG - Intergenic
1005273445 6:24190942-24190964 TTCTCTTCTTTAAGATGTACAGG + Intronic
1008469426 6:51866580-51866602 TGCTTTACTTTGAGATCTACTGG - Intronic
1012426195 6:99117329-99117351 TCCTCTACTTGCAGGTGTTTGGG + Intergenic
1012588201 6:100948304-100948326 TCCTCTCCTTGGAAATGTCTTGG + Intergenic
1013889172 6:115005437-115005459 TCCTCTACTTGGAGATTCACAGG + Intergenic
1014313317 6:119831598-119831620 TCCTCTACTTGAAAATTCACAGG - Intergenic
1015714681 6:136180415-136180437 ACCTCTACTTCAACATGTACTGG + Intronic
1020698499 7:11447183-11447205 TCCTCTACTTTGACGTGTACTGG + Intronic
1029178919 7:98685368-98685390 TCCTCTACTTGGTCATGAATTGG + Intergenic
1034378838 7:150671210-150671232 TCCTCTACTGTGAGATGTAATGG - Intergenic
1037771742 8:21805113-21805135 TCCTCTATTTGGAGATCTGGGGG + Intronic
1041487536 8:58395668-58395690 TGTTCTACATGGACATGTACAGG + Intergenic
1052465090 9:28820032-28820054 TCATCTACAGGGATATGTACAGG + Intergenic
1052832602 9:33228444-33228466 TCCTGTCCTTGGAGCTGTCCTGG + Intronic
1055777540 9:79782407-79782429 TACTCAACTTGGAAATGTAGGGG + Intergenic
1057702087 9:97370680-97370702 TCCATTTCTTGGAAATGTACGGG - Exonic
1062589565 9:137267288-137267310 TCCTCTGCTTGGTGATGTGCAGG - Exonic
1186315614 X:8366522-8366544 TCCATTTCTTGGAGTTGTACTGG - Intergenic
1186531556 X:10301350-10301372 TCCTCTAGTTGCAGGTCTACAGG - Intergenic
1190595442 X:52048996-52049018 TTCTCTTCTAGGAGATTTACAGG - Intergenic
1190613382 X:52205077-52205099 TTCTCTTCTAGGAGATTTACAGG + Intergenic
1201520928 Y:14872801-14872823 TCCTCTCCTTGGAGATATTTTGG - Intergenic