ID: 1083308159

View in Genome Browser
Species Human (GRCh38)
Location 11:61771546-61771568
Sequence ATCTGGGCATTGAGGGTGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083308159_1083308167 7 Left 1083308159 11:61771546-61771568 CCCAGCACCCTCAATGCCCAGAT 0: 1
1: 0
2: 0
3: 28
4: 205
Right 1083308167 11:61771576-61771598 GGAATGATCAAACAGGAGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 184
1083308159_1083308168 8 Left 1083308159 11:61771546-61771568 CCCAGCACCCTCAATGCCCAGAT 0: 1
1: 0
2: 0
3: 28
4: 205
Right 1083308168 11:61771577-61771599 GAATGATCAAACAGGAGCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 139
1083308159_1083308166 0 Left 1083308159 11:61771546-61771568 CCCAGCACCCTCAATGCCCAGAT 0: 1
1: 0
2: 0
3: 28
4: 205
Right 1083308166 11:61771569-61771591 GCTGAATGGAATGATCAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083308159 Original CRISPR ATCTGGGCATTGAGGGTGCT GGG (reversed) Exonic
900750521 1:4394069-4394091 ATGTGGGTATGGAGGGTACTTGG + Intergenic
901416379 1:9119682-9119704 ATCTGGGCATTGTGGGGGTAGGG - Intronic
902658914 1:17887819-17887841 ACCTGCACATTGAGGGTGTTGGG + Intergenic
903265816 1:22157292-22157314 TTCTGGGCAATCAGGGTCCTGGG - Intergenic
904580963 1:31544069-31544091 ATGTGGCCATAGAGGGTGCAAGG - Intergenic
904763264 1:32820471-32820493 ATCGGGGCAATGATGGTGGTGGG + Intronic
904872028 1:33625015-33625037 ACCCGGGCGTTGAGGGTGCGGGG - Intronic
906923181 1:50086753-50086775 ATCTGGGGGTGGAGGGTGCGGGG - Intronic
907267837 1:53273592-53273614 ATCTGGGTGTTGGGGGAGCTAGG + Intronic
908110142 1:60888585-60888607 AACTGTGCATTGAGGGATCTAGG - Intronic
910360697 1:86411581-86411603 CTCTGGCCATTGAGAGTGATAGG - Intergenic
910750426 1:90623379-90623401 TTCTGGGCTTTGACGGGGCTGGG - Intergenic
911219511 1:95232908-95232930 ATCTGGGAATTTAGGTTGTTAGG - Intronic
912484579 1:110015380-110015402 CTATGGGCATTCAGGCTGCTAGG - Intronic
915973981 1:160372902-160372924 GGGTGGGCATTGAGGGTCCTAGG + Intergenic
916211081 1:162360447-162360469 ATCTGGGCACTGTGGCTGATTGG + Intronic
917693444 1:177492547-177492569 ATCTGATCTTTGATGGTGCTGGG - Intergenic
917795664 1:178531093-178531115 TACTGGGCACTGAGGGTTCTGGG + Intronic
919736735 1:200957294-200957316 ATCTGGGCACTGAAGCAGCTGGG - Intergenic
920079477 1:203361921-203361943 ATCCGGGAATTGAGTGGGCTTGG + Intergenic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
920971005 1:210743851-210743873 ATCTGGGCACTGAGCTAGCTGGG + Intronic
921613492 1:217239343-217239365 ATCTGGGCATTGAGTTTTCTGGG - Intergenic
923073687 1:230590103-230590125 ATCAAGGCACTGAGGGTGCCAGG + Intergenic
923472124 1:234301037-234301059 ATCTCGGGATTGAGGATGCAGGG + Intronic
1062830068 10:599641-599663 CTCTGTCCACTGAGGGTGCTGGG - Intronic
1063881910 10:10540315-10540337 ATAAGGGTAATGAGGGTGCTAGG - Intergenic
1064227967 10:13504148-13504170 ATCTGGGGACAGTGGGTGCTGGG + Intronic
1064262064 10:13793955-13793977 CTCAGGGTAGTGAGGGTGCTGGG + Intronic
1066049303 10:31619788-31619810 GTCTGGGCAGTGAGGGCTCTGGG + Intergenic
1066333974 10:34457565-34457587 ATTTGGGCATTGAGGTGGGTAGG - Intronic
1068549128 10:58385944-58385966 ATCTAGGCATTGAGGAGGCGGGG + Intronic
1068777301 10:60881834-60881856 TTGAGGGCATTGAGGGTGTTTGG - Intronic
1069336399 10:67356493-67356515 ATCTGAGGATTGAGGGTACTGGG - Intronic
1069858182 10:71453284-71453306 AGCTGGGCATTGATGGAGTTTGG - Intronic
1070790650 10:79187376-79187398 AGCTGGGCAGTGAGGTTGCTGGG - Intronic
1073147595 10:101291219-101291241 AACTTGCCATTGAGGGTGTTGGG + Intergenic
1074183392 10:111082079-111082101 ATCTGGGCACTGAGGGGCCTGGG + Intergenic
1075234259 10:120712151-120712173 ACCTGGGCAGTGAGCTTGCTTGG + Intergenic
1076132038 10:128019853-128019875 ATCTGGGCAGTGAGGATGGTTGG + Intronic
1076757070 10:132578241-132578263 ATCTGGGCATTGAAGGTTCAAGG + Intronic
1077452161 11:2654726-2654748 ATCTGGGCAGGGAGGGGTCTGGG + Intronic
1077490874 11:2860386-2860408 ATGTGGGCAAGGAGGGTTCTGGG - Intergenic
1079006272 11:16793535-16793557 ACCTGGGCATTGTGTGTGCCTGG - Intronic
1080251035 11:30233948-30233970 CTCTGGGAATTGAGAGTGCTGGG + Exonic
1080334109 11:31175667-31175689 ATGTGGGCATGGAGGTTGATAGG - Intronic
1081371646 11:42311582-42311604 AACTGAGCAGTGAGGGAGCTGGG + Intergenic
1081645621 11:44788186-44788208 ATCTGGGGACTGAGGGTCCTGGG - Intronic
1083308159 11:61771546-61771568 ATCTGGGCATTGAGGGTGCTGGG - Exonic
1083961009 11:66015136-66015158 ATATGGGCCTTGGGGGTGCTAGG + Intergenic
1084673561 11:70621599-70621621 ATCTGGGAAATGAAGGAGCTGGG - Intronic
1084673955 11:70623587-70623609 ATCTGGGAAATGAAGGAGCTGGG - Intronic
1084729232 11:71062564-71062586 ATCTGGGTTTTGCTGGTGCTGGG - Intronic
1084992256 11:72938080-72938102 ATTCTGCCATTGAGGGTGCTGGG - Intronic
1085381183 11:76120204-76120226 ATCTGGGCTTTGTGGTTCCTTGG + Intronic
1087084447 11:94202383-94202405 ATCTGTGCCTTTAGGTTGCTAGG + Intergenic
1087139080 11:94748079-94748101 ATTTGGGCCATGTGGGTGCTTGG + Intronic
1087282645 11:96228845-96228867 ATATGGGCATTGAGAGCACTAGG + Intronic
1089387006 11:118074999-118075021 GTCTGGGCATGAAGGCTGCTGGG - Intergenic
1090922143 11:131215887-131215909 TTCTTGGCATGGAGGATGCTGGG - Intergenic
1092260488 12:6951111-6951133 ATCTGGGCCTGGAGTGTGCAAGG + Intronic
1094390971 12:29950062-29950084 TTCTGTGCAGTGAAGGTGCTGGG - Intergenic
1096023184 12:48339053-48339075 ATATGGGCACTGAGGATACTTGG - Exonic
1097507125 12:60487989-60488011 AGCTGGGGATTGAGGGTGGTTGG - Intergenic
1098976912 12:76912431-76912453 ACCTGGGCAGTGGAGGTGCTGGG + Intergenic
1102543019 12:113635951-113635973 ATCTGGGCTTCAGGGGTGCTGGG + Intergenic
1103867343 12:124063632-124063654 AGCTGAGCATGGAGGGTGCTGGG - Intronic
1103966244 12:124641722-124641744 CTCTGGGCAAGGAGGGAGCTAGG - Intergenic
1107878060 13:44807915-44807937 ATCTGGGGACAGAGGGAGCTGGG - Intergenic
1109964678 13:69676530-69676552 CCCTGGACATTGAGGGTGATAGG - Intergenic
1113885877 13:113658175-113658197 GTCTGGGCGTAGAGGGTGCAGGG - Exonic
1114660444 14:24340127-24340149 TGCTGGGCATTGAGGATGTTAGG + Intergenic
1117190114 14:53281066-53281088 ATCTGAGCATTGAGGTGGCAAGG + Intergenic
1119981313 14:79084633-79084655 ATTTTGGCATTCAGGGTGATAGG + Intronic
1121233417 14:92375124-92375146 CTCTGGGGATTGAGCCTGCTAGG + Intronic
1122138162 14:99646295-99646317 ATCTGGGCAGTGAGAGGCCTGGG + Intronic
1123030705 14:105449812-105449834 GTCTGGGCCTTTAGGGTGCCTGG + Intronic
1124100351 15:26687077-26687099 CTCTGGGAAGTGAGGGTGCAGGG + Intronic
1125976195 15:43954103-43954125 ATCTGGGCATCGACAGGGCTTGG - Intronic
1126316438 15:47374825-47374847 ATCTGGGCACTGAGGCTGAGTGG + Intronic
1129658655 15:77541127-77541149 AGCTGGGTATTGAAAGTGCTGGG - Intergenic
1130519017 15:84648085-84648107 ATCTGTGAAATGAGGGTGGTTGG - Intronic
1130797312 15:87223582-87223604 AGCTGAGCGTTGAAGGTGCTTGG + Intergenic
1130987432 15:88853945-88853967 CCCTGAGCACTGAGGGTGCTGGG - Intronic
1131315933 15:91337498-91337520 ATCTGGGAAATGAGACTGCTCGG + Intergenic
1132107613 15:99074611-99074633 ATCTAAGCAGTGAGGGAGCTGGG + Intergenic
1133921180 16:10154520-10154542 TTCAGGGCACTGAGGATGCTGGG - Intronic
1136354996 16:29738762-29738784 ATCTTGGCATTGAAGGGCCTAGG + Intergenic
1138224274 16:55279224-55279246 AGCTGGGCAGTGAGGCTTCTGGG - Intergenic
1139186576 16:64812705-64812727 GTCTGGGGATTGGGGGTACTGGG + Intergenic
1140467817 16:75196417-75196439 TGCTGGGCAGTGAGGGTGCTGGG - Intergenic
1140848890 16:78915933-78915955 TTCTGGGCATTGATTGAGCTTGG - Intronic
1141640450 16:85337972-85337994 CTCTGAGCTTTGAGGGTGCTGGG + Intergenic
1144170997 17:12659789-12659811 GTATGGGCCTTGTGGGTGCTGGG + Intergenic
1146372028 17:32270664-32270686 ATCGGGGGAGTGAGGGTGCGTGG - Intronic
1146955646 17:36935163-36935185 CTGTGGGCCTTGAGGTTGCTGGG + Intergenic
1152444560 17:80333994-80334016 ATCTAGGCATTGAGGGAGGGTGG + Intronic
1153020452 18:623985-624007 ATCTCGGCATGGAGGGGGCTGGG + Intronic
1153022873 18:647196-647218 ATCTAGGTACTGAGGGTGCTGGG + Intronic
1153022880 18:647255-647277 ATCTAGGTACTGAGGGTGCTGGG + Intronic
1153358762 18:4169568-4169590 ATCGGAGCATTGAGGGAGCTGGG - Intronic
1155699557 18:28726832-28726854 TGCTGGGCATTGAGGATGCAAGG + Intergenic
1156774408 18:40769894-40769916 CTCTGGGCATGGAGCTTGCTAGG - Intergenic
1159418592 18:68184926-68184948 TTCTGGGCATGGAGGGTGACAGG + Intergenic
1160187395 18:76686208-76686230 ATCTGGTCCTTGGGGTTGCTGGG + Intergenic
1160562539 18:79767812-79767834 AACTGGCCTTTCAGGGTGCTGGG - Intergenic
1163452274 19:17385487-17385509 TTCTGGGGATGGAGGGTGATAGG - Intergenic
1165774669 19:38397507-38397529 ATCTGGGGTCTGAGGGTGCTGGG - Intergenic
1166944169 19:46387011-46387033 TTCTGGGCCTTGAGGGTGCCAGG + Intronic
1167023719 19:46898751-46898773 ATCTGTGCATGGAGGCTCCTGGG - Intergenic
1167477869 19:49711475-49711497 ATCTGGGCAGAGAGGGTACAGGG - Intronic
1167612606 19:50514640-50514662 CTCTGTGCCTTGAGGGTGCCTGG + Intronic
1167699025 19:51031562-51031584 ATATGGGCATTGTGGGTCATGGG - Intronic
1168349551 19:55668330-55668352 ATCTGACCAGTGAGGGTCCTGGG - Intronic
929234778 2:39594216-39594238 ACCTGGGCTTTGGGGTTGCTAGG - Intergenic
929828483 2:45328948-45328970 CTCTGGGCAGTCATGGTGCTTGG + Intergenic
935199510 2:100844190-100844212 AGCTGGGCATGGTGGTTGCTGGG - Intronic
935247084 2:101228121-101228143 ATCTTACCATTGAGGGAGCTGGG - Intronic
937269361 2:120638209-120638231 ATTTGGGCTCTGAGTGTGCTTGG - Intergenic
938375387 2:130801969-130801991 ATCTGGGCGTGGTGGGTGGTGGG + Intergenic
938403882 2:131016463-131016485 ATCTGGGCATGGGGGGCACTGGG - Intronic
943210531 2:184959299-184959321 ATCTAAGCATTGAGTGTGCATGG + Intergenic
944430106 2:199623991-199624013 AGCTGAGCATTGATGGAGCTTGG + Intergenic
944747931 2:202676873-202676895 ATCTGGACTTTGAGGAAGCTGGG + Intronic
946449991 2:219771619-219771641 ATCTGGGCATTGCAAGGGCTGGG + Intergenic
946547893 2:220765822-220765844 ATGTGGGACTTGCGGGTGCTTGG + Intergenic
948752032 2:240138466-240138488 CTCTAGGCTTTGAGGATGCTGGG - Intergenic
948931521 2:241135334-241135356 CTGTGGGACTTGAGGGTGCTCGG - Intronic
1170723559 20:18905015-18905037 ATATGGTTATGGAGGGTGCTAGG - Intergenic
1170780806 20:19423743-19423765 CTCTGGACATTGAGGGTGCCAGG + Intronic
1171265726 20:23771063-23771085 AACTTGGCATTGGGGGTACTGGG - Intergenic
1173166647 20:40690625-40690647 ATCTGGGTAGGGAGGGTGCGCGG - Intergenic
1173306871 20:41858830-41858852 ATCTGGTGATTGAGGGTGGCAGG + Intergenic
1173385792 20:42586951-42586973 ATCAGGGCATTCAGGGAGCCAGG - Intronic
1174134856 20:48372501-48372523 ATCGGGGGATTGTGGGGGCTGGG - Intergenic
1175900297 20:62357387-62357409 CTCTGGGCATCGAGGGGGCTGGG - Intronic
1179005110 21:37507242-37507264 ATCAGGGCAATGAGTGGGCTTGG - Intronic
1179444931 21:41424498-41424520 TTCTGGGCCTTGAGGTTGGTTGG + Intronic
1180143989 21:45909680-45909702 ATCTGGGCAGTGGGTGGGCTGGG - Intronic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181929485 22:26388624-26388646 CTCTGAGCAGTGAGGGAGCTGGG + Intergenic
1182474379 22:30568465-30568487 ATCTGGGCATGGGCGGAGCTGGG + Intronic
1184110241 22:42389895-42389917 TCCTGGGCATTGGGGGTGATGGG + Intronic
1184641693 22:45876398-45876420 CTCTGGACATTGAGGCTCCTTGG + Intergenic
1184719042 22:46298608-46298630 ATGGAGGCATTGAGGATGCTTGG - Intronic
1185119313 22:48956300-48956322 ATCTGGGCCTTCTGGGAGCTGGG - Intergenic
950937045 3:16849854-16849876 ACCTAGGCATAGAGAGTGCTTGG + Intronic
952791525 3:37204393-37204415 ATCTGGGCAAAGAGGATTCTGGG + Intergenic
954702162 3:52455995-52456017 ATCTGGGGATAAAGGGGGCTTGG + Intronic
954704709 3:52473263-52473285 ATCTGGGTCTTGGGTGTGCTTGG + Intronic
954736754 3:52713938-52713960 ACCTGGCCACTGAGGGTGGTGGG - Intronic
956125986 3:66011352-66011374 ATCTGGGAAGTGGGTGTGCTTGG - Intronic
957580912 3:82072101-82072123 AACTGGGGATTGAGCATGCTAGG + Intergenic
959005751 3:101017928-101017950 ATATGGGCAATGAGGTTGGTGGG + Intergenic
960441751 3:117697281-117697303 AGCTGGGTATTTAGGGTGATTGG + Intergenic
960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG + Intronic
961038605 3:123661217-123661239 AGCTGGGCATCGTGGGGGCTGGG + Intronic
962433955 3:135347409-135347431 ATCTGGGCATTGAAGGAAATGGG - Intergenic
967281955 3:187831518-187831540 ATCTAGGAAGTGATGGTGCTTGG - Intergenic
967651958 3:191996627-191996649 ATTTCGGCATTGAGGGTGAGTGG - Intergenic
968911802 4:3480153-3480175 AGCTGGGCCTTGAGGGTGAATGG + Intronic
968921572 4:3524739-3524761 TTCTGGGCACTCAGGATGCTCGG + Intronic
969083843 4:4640809-4640831 CTCGGGGCTTTGAGGGCGCTGGG + Intergenic
969929235 4:10613965-10613987 GCCTGGGCATTCAGGGTCCTTGG - Intronic
971057967 4:22934966-22934988 ATCATGGCAGTGAGGTTGCTGGG + Intergenic
971250404 4:24969389-24969411 TTCTGGCCATTGAGAGTGATAGG + Intronic
974136834 4:57828496-57828518 ATTTGGACATTAAGAGTGCTTGG - Intergenic
975587596 4:75965935-75965957 ATCTGGGGATTGAGTGTTCCAGG - Intronic
980537515 4:134148080-134148102 CTCTGTGCATTGTGAGTGCTGGG - Intergenic
983611386 4:169649142-169649164 AGCAGGGCATTGGAGGTGCTAGG + Intronic
984343099 4:178484119-178484141 AACTGGGGAATGAGGTTGCTGGG + Intergenic
987412154 5:17625550-17625572 AACTCGGCAGAGAGGGTGCTGGG - Intergenic
987886409 5:23819216-23819238 ATCACTGCATTGAGGGTGATGGG - Intergenic
988629120 5:32910310-32910332 TGCTGGGCATAGAGGGTGATGGG + Intergenic
989124759 5:38041268-38041290 TTCTGGGGGTGGAGGGTGCTGGG - Intergenic
989767675 5:45105762-45105784 ATCTCCACATTGAGGGTGATAGG - Intergenic
990369921 5:55107279-55107301 TGCTTGGCATTGAGTGTGCTTGG - Intronic
990982710 5:61616018-61616040 ATGTGGGCACTGAGGGAGCCGGG - Intergenic
992286126 5:75237073-75237095 CGCTAGGCTTTGAGGGTGCTGGG + Intergenic
992738254 5:79745634-79745656 ATCTGGGCATTGAGGCTTTCAGG - Intronic
992833587 5:80618804-80618826 AGCTGGGCATAGTGGCTGCTTGG + Intergenic
995435017 5:112125916-112125938 ATCTTGGCAAAGAGTGTGCTTGG - Intergenic
997495184 5:134317780-134317802 ATCTGGGCATCCAGGCTACTCGG + Intronic
998286751 5:140870193-140870215 ATCAGGGCAATGACCGTGCTGGG - Exonic
999921764 5:156329227-156329249 AACTGGGCAGTGAGGGTGGAGGG + Intronic
1000944169 5:167400236-167400258 ATTTGGGCAATGAGAGTGATGGG + Intronic
1002575460 5:180171455-180171477 AGGTGGGCTCTGAGGGTGCTGGG - Intronic
1004419313 6:15453919-15453941 ATCTGGGCACTAGGGATGCTGGG + Intronic
1005160417 6:22854661-22854683 ATTTGGGATTTTAGGGTGCTGGG - Intergenic
1006108260 6:31729388-31729410 ATCTGACCCCTGAGGGTGCTGGG - Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006948334 6:37800560-37800582 ATGTGGACACTGAGGGGGCTGGG - Intergenic
1010723568 6:79309841-79309863 CTCTGGCCATTGAGAGTGATAGG - Intergenic
1011167001 6:84459741-84459763 ATTTGGACCTTGAGGATGCTGGG - Intergenic
1012985555 6:105872391-105872413 AACTGGGGAGTGAGGGTGGTAGG - Intergenic
1015300978 6:131652867-131652889 TTCTGGGCACTGAGACTGCTGGG - Exonic
1017760248 6:157562886-157562908 ACCTGGGCACAGTGGGTGCTTGG - Intronic
1019315039 7:380413-380435 TTCTGAGCATTGAGGGTCCTGGG - Intergenic
1019389664 7:778994-779016 TTCTGGGCCCTGAGGGTGCTGGG - Intronic
1022975278 7:35550567-35550589 ATCTGGGAGTTGAGGCTGCCAGG + Intergenic
1023866913 7:44242718-44242740 AGCTAGGCAGTGAGGGTGCAGGG - Intronic
1024247416 7:47480747-47480769 ACCTGGACAGTGAGGGTGCCTGG - Intronic
1024832402 7:53476540-53476562 AACTGGGGAATGAGGCTGCTAGG + Intergenic
1026106424 7:67424446-67424468 ATAGGGGAATTGAGGGGGCTTGG - Intergenic
1029261445 7:99305466-99305488 ATCTGGGAAATGGGGGTGTTAGG - Intergenic
1029315961 7:99714032-99714054 CTCTGGGAATTGAGGCTGCAAGG - Intronic
1032354110 7:131193761-131193783 AGCTGGGCATTGTGGGTGGGTGG - Intronic
1032690314 7:134279577-134279599 ATCTGGGCAAAGAGTGTCCTGGG - Intergenic
1035014966 7:155757904-155757926 ATCTGGCCATTCAGAGTGCATGG - Intronic
1036222758 8:6934410-6934432 CTCTGGGCATTGTGGGTGGTTGG + Intergenic
1037731032 8:21524207-21524229 ATGTGGGGATTGATGGGGCTTGG - Intergenic
1042157084 8:65855948-65855970 ATGTGGGCAGTGAGGATGGTTGG - Intergenic
1042491272 8:69401253-69401275 ATCTGGGGAATGAGGGAGGTGGG + Intergenic
1044264493 8:90166018-90166040 ACCTGGGCAATGAAGGAGCTGGG - Intergenic
1044540105 8:93399074-93399096 TTCTGGGCATTGCAGGTGCCTGG - Intergenic
1048396888 8:134022429-134022451 ATCTGGACATTGTTGGAGCTGGG + Intergenic
1053103659 9:35392371-35392393 ATTTAGGGATAGAGGGTGCTGGG + Intronic
1057282920 9:93725852-93725874 ATCTGGCCATTCCGAGTGCTGGG - Intergenic
1057532718 9:95866711-95866733 ATCTGGGAATTGACAGTGTTTGG - Intergenic
1058842777 9:108926080-108926102 ATCTGGGCATTAAGGCTGTGGGG - Intronic
1060440494 9:123634176-123634198 ATCTTGGCATTGAGGTTGGTGGG - Intronic
1060789239 9:126474725-126474747 TACTGGGCTCTGAGGGTGCTGGG + Intronic
1060983023 9:127804263-127804285 ATCTGGGCACTGTGGTTGCCAGG + Exonic
1060983771 9:127808403-127808425 ATCTGTGCAGTGAGGACGCTGGG + Intronic
1061316793 9:129801485-129801507 AGCTGGGCACTGAGGGAGTTAGG - Intergenic
1061509952 9:131054344-131054366 GTTTGGGGATTGCGGGTGCTGGG - Intronic
1062399798 9:136367375-136367397 TTCTGGGCATGGAGGGGGCCTGG - Intronic
1189810261 X:44774820-44774842 ATCTGGAAAATGAGGGTGCCGGG - Intergenic
1189866477 X:45335200-45335222 ATCTGGGCTTTGAGGGTGACTGG + Intergenic
1190617491 X:52250815-52250837 ATCTCTGCATTGAGGGTCATGGG + Intergenic
1193775978 X:85642093-85642115 CTGGGGGCATTGAGGGGGCTGGG - Intergenic
1197685339 X:129433773-129433795 TGCTAGGCATTGAGGATGCTGGG - Intergenic
1199546455 X:149011536-149011558 ATCTGAGCATTGAGGAGGCTGGG - Intergenic
1199745555 X:150770066-150770088 TTCTGGGCATTGCGGCTGCTCGG - Intronic