ID: 1083309138

View in Genome Browser
Species Human (GRCh38)
Location 11:61775599-61775621
Sequence ACGTGGGTATGGAGAGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083309132_1083309138 3 Left 1083309132 11:61775573-61775595 CCAGTGCACGTGGAGGAGTAGAG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1083309138 11:61775599-61775621 ACGTGGGTATGGAGAGGATCTGG 0: 1
1: 0
2: 1
3: 16
4: 182
1083309129_1083309138 19 Left 1083309129 11:61775557-61775579 CCTTGGCATGGCTCTGCCAGTGC 0: 1
1: 0
2: 1
3: 18
4: 229
Right 1083309138 11:61775599-61775621 ACGTGGGTATGGAGAGGATCTGG 0: 1
1: 0
2: 1
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083309138 Original CRISPR ACGTGGGTATGGAGAGGATC TGG Intronic
902239726 1:15080497-15080519 GCGTGGGTGTGAAGAGCATCAGG - Intronic
903644873 1:24888945-24888967 GCGTGGGGAGGGAGAGCATCAGG - Intergenic
904803979 1:33118138-33118160 ATGGGGGTATGGGGAGGAACTGG + Intronic
904823790 1:33261789-33261811 AAGTGGGAAGGGAGAGGAGCAGG + Intronic
905171611 1:36113129-36113151 ACGGGGGTAAGGAGAGGGCCAGG + Intronic
905662131 1:39735749-39735771 AGGTGGGAATGGAGAGGGGCTGG + Intronic
906042058 1:42795185-42795207 AGGTGGGGATGGGGAGGTTCAGG + Intergenic
907541099 1:55215734-55215756 ACGGGGGTTCGGAGAGGCTCGGG - Intergenic
908270525 1:62417382-62417404 ACGAGGGGAGGGAGAGCATCAGG - Intergenic
908720076 1:67116212-67116234 ACCTGGGTGAGGAGAAGATCAGG - Intronic
909538747 1:76767687-76767709 AGGTGGGGATGGGGAGAATCTGG - Intergenic
912006911 1:104915352-104915374 ATGTGAGGAGGGAGAGGATCAGG - Intergenic
915420636 1:155778691-155778713 GCGGGGGAAGGGAGAGGATCAGG - Intronic
915527828 1:156487096-156487118 ACATGGAGATGGAGAGGATGGGG + Intronic
915922051 1:159983330-159983352 AAGTGGGTATTGAGTGGACCTGG + Intergenic
916841668 1:168607846-168607868 ATGGGGGTAGGGAGAGGAGCAGG + Intergenic
917590187 1:176468561-176468583 AGGTGGGCATGGAAAGAATCAGG + Intronic
920388803 1:205586144-205586166 ATATGGGAATGGAGAGGAGCCGG - Exonic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
1063057725 10:2522290-2522312 ACGTGGGTGTCGCGTGGATCAGG - Intergenic
1063057742 10:2522374-2522396 ACGTGGGTGTCGCGTGGATCAGG - Intergenic
1063958521 10:11286638-11286660 ACGTGGGTGTTGAGAGGCCCTGG - Intronic
1064675204 10:17753381-17753403 ACGGTGGGAGGGAGAGGATCAGG - Intronic
1064679488 10:17795631-17795653 ATGTGGGGAGGGAGAGCATCAGG + Intronic
1066294259 10:34040577-34040599 AGGTGGGTAAGGAGAGGACGAGG + Intergenic
1066749473 10:38637972-38637994 ACCTTAGTATAGAGAGGATCTGG - Intergenic
1068874923 10:61985727-61985749 ACGTGTGTATGATGAGAATCAGG + Intronic
1071252600 10:83836197-83836219 TGGGGGGTATGGAGAGTATCAGG + Intergenic
1071996746 10:91156664-91156686 AAGTGGATATGGGGAGGACCAGG + Intergenic
1073935336 10:108624645-108624667 ATGTTGGTATAGAGGGGATCTGG - Intergenic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1077280291 11:1741642-1741664 ATGTGGGTACAGAGAGGAACTGG + Intronic
1078451864 11:11446520-11446542 TCCTGGGTCTGGAGAGGAGCTGG - Intronic
1083309138 11:61775599-61775621 ACGTGGGTATGGAGAGGATCTGG + Intronic
1085164381 11:74383583-74383605 GCGTGGGGAGGGAGAGCATCAGG - Intronic
1087382352 11:97422685-97422707 ACAGGGGTAGGGAGAGCATCAGG + Intergenic
1088281713 11:108141300-108141322 ACATGGGCCTGGAGAGGATGAGG + Intronic
1089179220 11:116569453-116569475 AAGTGGGTCTGGAGAGCTTCAGG + Intergenic
1090080355 11:123608528-123608550 ACAAGGGTATGGAGAGGACACGG - Intronic
1091131746 11:133152518-133152540 AGGTGGGAGTGGAGAGGATTAGG - Intronic
1092124466 12:6065721-6065743 ACCTGAGTGTGGAGAGGCTCTGG + Intronic
1095370485 12:41461346-41461368 ATTTGAGGATGGAGAGGATCAGG - Intronic
1104094443 12:125544199-125544221 TGGTGGGTAGGGAGAGCATCAGG + Intronic
1104746977 12:131216742-131216764 ACGTGGGTGGGGACAGGATGGGG + Intergenic
1106008207 13:25791392-25791414 ATGGGAGTAGGGAGAGGATCAGG + Intronic
1111645947 13:91032160-91032182 AAGTGGATAAGCAGAGGATCTGG - Intergenic
1112507914 13:99985970-99985992 ACGTGGGCATGGAGATTAGCAGG - Exonic
1120058977 14:79959535-79959557 AGGTGGGTAGGGAGAACATCGGG + Intergenic
1122116285 14:99528844-99528866 ACGAGGGGAGGGAGAGCATCAGG + Intronic
1125289563 15:38130772-38130794 ACAAGGGCATGGAGAGGACCAGG + Intergenic
1125349614 15:38753447-38753469 ACGCTGGTACAGAGAGGATCAGG - Intergenic
1127585194 15:60371667-60371689 ATCTAGGTAAGGAGAGGATCTGG - Intronic
1127783195 15:62333544-62333566 ACATGTGTCTGGAGGGGATCTGG + Intergenic
1128661130 15:69501792-69501814 ACCTGGGTTTGGAGAGCTTCTGG + Intergenic
1129923939 15:79345283-79345305 GGGTGGGAAGGGAGAGGATCAGG - Intronic
1132519500 16:380981-381003 ACGTGGGTGTGGAGACCGTCAGG - Intronic
1134309068 16:13059523-13059545 AGGTGGGGAGGGAGAGCATCAGG + Intronic
1135204255 16:20469404-20469426 AAGTGGGGAAGGAGAGGATGAGG - Intronic
1135214746 16:20555562-20555584 AAGTGGGGAAGGAGAGGATGGGG + Intronic
1136294932 16:29296173-29296195 ATGTGGGTAGAGAGAGGGTCTGG + Intergenic
1137267564 16:46881682-46881704 AGGTGGGGATGGATAGGATCTGG - Intergenic
1137354161 16:47743292-47743314 ATGGGGGTAGGGAGAGCATCAGG - Intergenic
1138227178 16:55305992-55306014 TCATGGGTATAGAGAGGTTCTGG - Intergenic
1140692859 16:77501071-77501093 AGGTGGGGAGGGAGAGCATCAGG - Intergenic
1141794366 16:86260175-86260197 ACCTGAGGATGGAGAGGGTCTGG + Intergenic
1142100826 16:88270182-88270204 ATGTGGGTAGAGAGAGGGTCTGG + Intergenic
1142317913 16:89360739-89360761 ATGTGGCTATGGAGAGGAAGAGG + Intronic
1142351616 16:89583306-89583328 ACCTGGGCCTGGAGAGGGTCAGG + Intronic
1142881526 17:2885726-2885748 ACTGGGGCAGGGAGAGGATCTGG + Intronic
1144776234 17:17786151-17786173 AGGTGGGTATGGAGACAAACTGG - Intronic
1144802910 17:17943465-17943487 ACTTGGGTATGGAGAGAATGTGG + Intronic
1146680054 17:34800613-34800635 ATGTGGTTATGCAGAGGGTCTGG - Intergenic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150017104 17:61568990-61569012 ACGTAGGAAAGGAGAGGATCAGG + Intergenic
1150341749 17:64374081-64374103 AGTTGGGTTTGGAGGGGATCGGG - Intronic
1151036375 17:70805036-70805058 GCGAGGGTAGGGAGAGCATCAGG + Intergenic
1151418593 17:73982890-73982912 ATGAGGGTGTGGAGAGGATGGGG + Intergenic
1153534505 18:6086576-6086598 TCAGGGGCATGGAGAGGATCTGG - Intronic
1155959002 18:31978130-31978152 ACGTGAGTAAGGGAAGGATCTGG + Intergenic
1160451683 18:78970733-78970755 AGGTGGGGAAGGAGAGGAGCAGG - Intergenic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1163405039 19:17116759-17116781 TGGTGGGTATGGAGAGGATGGGG + Intronic
1165378263 19:35459279-35459301 CAGTGGGCATGGAGAGGGTCTGG + Intergenic
1166210610 19:41304446-41304468 TCCTGGGTTTGGAGGGGATCTGG - Intronic
925291181 2:2749697-2749719 ATGTGTGTATGGGGAGGATGTGG + Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
928257411 2:29735157-29735179 AAATGGGTAAGGAGAGGATGAGG + Intronic
928338161 2:30416877-30416899 AAGTGGGGTTGGAGAGGATGGGG - Intergenic
930368328 2:50471741-50471763 GTGTGAGGATGGAGAGGATCAGG + Intronic
931928081 2:67096984-67097006 GTGTGGTAATGGAGAGGATCTGG + Intergenic
932211755 2:69937320-69937342 AGCTGGGCATTGAGAGGATCCGG + Exonic
933114922 2:78456549-78456571 ATGTGAGAAGGGAGAGGATCAGG - Intergenic
936533364 2:113292101-113292123 GCCTGGGGATGGAGAGGAACTGG - Intergenic
940901147 2:159127715-159127737 ACGGGGGGAGGGAGAGCATCAGG + Intronic
942942904 2:181640309-181640331 ACGTGGGTGTGGTGAGCAACAGG - Intronic
945000409 2:205344294-205344316 ATGTGGATATGGAGTGGATGAGG + Intronic
946424365 2:219585079-219585101 ACGTGGGGAGGGAGAGGATTAGG - Intergenic
946868792 2:224067237-224067259 GCGTGGGGAGGGAGAGCATCAGG + Intergenic
947106684 2:226675074-226675096 GTGTGGGGAGGGAGAGGATCAGG + Intergenic
947935465 2:233999877-233999899 GCCTGGGCATGGTGAGGATCAGG - Intronic
948584388 2:239009788-239009810 ACGTGGCTCTGCAGAGGAGCTGG + Intergenic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
1169044613 20:2525394-2525416 AGGTGAGGATGGAGAGCATCTGG + Intergenic
1169558768 20:6776323-6776345 ACGTGGATATGGGGAGTATCAGG - Intronic
1169617262 20:7462599-7462621 ACGTGGGTAGGGGGAGGAGCTGG - Intergenic
1171907568 20:30912378-30912400 ACGTGGGTAGTGAGGGGAGCTGG - Intergenic
1175251437 20:57612409-57612431 ACATGGGTATGGCCAGAATCAGG + Intronic
1175412308 20:58778321-58778343 ACTGGGGTGTGGAGAGGCTCTGG + Intergenic
1175621951 20:60454824-60454846 ACGTGGGCAAGGACAGGATCAGG - Intergenic
1177550423 21:22613899-22613921 AAGTGGGGAGGAAGAGGATCAGG + Intergenic
1177971328 21:27793487-27793509 ATGGGGGTAGGGAGAGCATCAGG + Intergenic
1179459246 21:41522677-41522699 ATGTGGGGAGGGAGAGCATCAGG - Intronic
1180228232 21:46411018-46411040 AGGTGGGTGTGGAGTGCATCCGG + Intronic
1183889135 22:40911105-40911127 ACCAGGGGATGGAGAGGATGTGG - Intronic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
949515288 3:4801805-4801827 AAAAGGGAATGGAGAGGATCTGG + Intronic
952142757 3:30498242-30498264 AGGATGGTATGGAGAGGAGCTGG - Intergenic
953540572 3:43814244-43814266 ACCTGGGAATGCAGATGATCTGG + Intergenic
955067455 3:55545457-55545479 ACGTGGGAATGCATGGGATCAGG + Intronic
960739439 3:120816846-120816868 TGCTGGGTTTGGAGAGGATCAGG + Intergenic
961557312 3:127705232-127705254 ACGGGGGGAGGGAGAGCATCAGG + Intronic
966920566 3:184608648-184608670 AGGTGGATATGGAGCGGATGGGG - Intronic
967870283 3:194223982-194224004 AGGAGGGGATGGAGAGGATGAGG - Intergenic
969216283 4:5724860-5724882 GCGAGGGGAGGGAGAGGATCAGG - Intronic
971861348 4:32109634-32109656 AAGTGGGGAGGGAGAGCATCAGG - Intergenic
972258470 4:37384096-37384118 ACGTGGGGAGGGAGAGCATCAGG - Intronic
972336474 4:38111208-38111230 ACGTGGGTAGAGAGTGGATGAGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
982689443 4:158531423-158531445 ATGTGTGTCAGGAGAGGATCAGG - Intronic
982938206 4:161513360-161513382 AGGGGAGTAGGGAGAGGATCAGG + Intronic
984724293 4:183005099-183005121 ACATGGGGAGGGAGAGCATCAGG + Intergenic
985181641 4:187271527-187271549 ACGAGGGTAGGGAGAAAATCGGG - Intergenic
985836257 5:2274294-2274316 CCGGGGGGAAGGAGAGGATCAGG - Intergenic
986054331 5:4120901-4120923 TGGTGGGGAGGGAGAGGATCAGG + Intergenic
988418357 5:30974773-30974795 AGGTGGGCATGGAGGGGGTCTGG - Intergenic
988845375 5:35122380-35122402 GCGTGGGGAGGGAGAGCATCGGG - Intronic
989273463 5:39558842-39558864 GGGTGGATATGGAGAGGAACTGG + Intergenic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
992901586 5:81301947-81301969 ACGTGGGAAGGGGGAGGCTCTGG - Exonic
996988911 5:129604110-129604132 AGGTGGGGAGGGAGAGCATCAGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1002172506 5:177383390-177383412 ACGGGGGAATGGAGAGAAACAGG + Intronic
1003960582 6:11205247-11205269 ACGAGGCTGTGGAGAGGATCAGG + Intronic
1004328116 6:14695679-14695701 ACGTTGGTAGGGAGAGGAGGTGG - Intergenic
1005725037 6:28639874-28639896 ACGGGGGTAGGGGGAGGCTCAGG + Intergenic
1005763689 6:28989930-28989952 GGGAGGGTATGGAGAGGATAAGG + Intergenic
1005781988 6:29201879-29201901 CCCTGGCTATGGAGAGGAGCGGG + Intergenic
1009594475 6:65716798-65716820 ACCTGGGTTTGGAGAGCTTCTGG - Intergenic
1010804069 6:80214108-80214130 TAGTGGGAATGGAGACGATCAGG + Intronic
1010897506 6:81382469-81382491 ACGTGGGATTGAAGAGAATCTGG - Intergenic
1013541141 6:111110560-111110582 AGGTAGGTTTGGTGAGGATCAGG + Intronic
1014559924 6:122877104-122877126 TTGTGGGTATGGAGAAGTTCAGG + Intergenic
1014869798 6:126579837-126579859 ATGAGGGGAGGGAGAGGATCAGG - Intergenic
1015143359 6:129959198-129959220 CCTTGGCTATGGAGAGGAGCGGG + Intergenic
1015891960 6:137978368-137978390 ACGTGGGGAAGGAGGGGACCTGG + Intergenic
1016181589 6:141153936-141153958 AAATGGGTTTGGAGAGCATCTGG + Intergenic
1017055681 6:150433793-150433815 ACAGGGGTATGGTGAGGATAAGG - Intergenic
1017720222 6:157238562-157238584 AGGTGGTGATGGTGAGGATCAGG + Intergenic
1018148674 6:160918528-160918550 ACGTGGGTGTGGCAAGGAGCTGG - Intergenic
1021165900 7:17340151-17340173 ACGTGGGTGTGCTGAGGTTCTGG - Exonic
1023106700 7:36769924-36769946 AAGTGGGTAGGGAAAGGATGTGG + Intergenic
1023249194 7:38239233-38239255 ACGGGGGTATCGTGAGGATCAGG + Intergenic
1023250844 7:38259297-38259319 ATGGGGGTATCGTGAGGATCAGG + Intergenic
1023575138 7:41619216-41619238 AGGTGGGGAGGGAGAGCATCAGG - Intergenic
1024944388 7:54794210-54794232 ATGAGGGGAGGGAGAGGATCAGG + Intergenic
1027655365 7:80923864-80923886 ACGTGGGGAGGGAGAGGATCAGG - Intergenic
1032478594 7:132228710-132228732 ATGTGAGTTTGGAGAGGATGAGG - Intronic
1033923597 7:146427878-146427900 ACAGGGGGATGGAGAGCATCAGG - Intronic
1033925752 7:146458149-146458171 ATGTGGGGAGGGAGAGCATCAGG + Intronic
1034292174 7:149941617-149941639 ACATGGGGAGGGACAGGATCAGG - Intergenic
1034813900 7:154155280-154155302 ACATGGGGAGGGACAGGATCAGG + Intronic
1035302595 7:157907205-157907227 ACGTGGGCTCGGAGAGGACCAGG + Intronic
1035310399 7:157964222-157964244 ACGTGGGTGTGTGGAGCATCTGG - Intronic
1040549332 8:48426649-48426671 AGGGTGCTATGGAGAGGATCAGG - Intergenic
1042232196 8:66569088-66569110 AGGTGGGAAGAGAGAGGATCAGG - Intronic
1043662068 8:82755808-82755830 AGGTGGGGAAGGAGAGAATCTGG - Intergenic
1044457116 8:92401497-92401519 AGGTGGGGAGGGAGAGGAGCAGG - Intergenic
1045677246 8:104620797-104620819 ATGTGGGTAAGGAAAGGATCAGG + Intronic
1047171411 8:122496636-122496658 ATGTGAGGAGGGAGAGGATCAGG + Intergenic
1051696668 9:19775148-19775170 TGGTGGGTTTGGAAAGGATCTGG - Intronic
1052189944 9:25648507-25648529 ACCTGTGTATGGAGTGGATTGGG - Intergenic
1052303083 9:26975096-26975118 ACGTGAGCAGGGAAAGGATCTGG + Intronic
1052853955 9:33395366-33395388 ACGGGGACATGGAGAGGAACTGG + Intronic
1054994638 9:71371963-71371985 ATGTGGGAAGGGAGAGCATCAGG - Intronic
1057709918 9:97430549-97430571 ACATGGGAATGCAGAGGCTCGGG - Intronic
1057972793 9:99573504-99573526 ACATGGGTAGGGAGACGCTCTGG + Intergenic
1059403192 9:114083364-114083386 TGGTGGGGAGGGAGAGGATCAGG + Intergenic
1060548048 9:124472078-124472100 AGGTGAGGATGGAGAGCATCAGG - Intronic
1061603876 9:131693745-131693767 ACTTGGGAATGGATGGGATCTGG - Intronic
1186523317 X:10224730-10224752 ATGTGGGGAGGGAGAGCATCAGG - Intronic
1189916636 X:45862248-45862270 ACAGGGGTAGGGAGAGCATCAGG + Intergenic
1189925802 X:45953332-45953354 ATGGGGGTAGGGAGAGCATCAGG - Intergenic
1191719585 X:64218250-64218272 ACATGGGTAGGGAGGGGATCTGG + Intergenic
1193734010 X:85135181-85135203 ACGGGGGTAGGGAGAGCACCAGG + Intergenic
1195509018 X:105693054-105693076 CCATGGGTATAGAGAGGACCAGG - Intronic
1195809325 X:108812785-108812807 GCGGGGGCATGGAGAGCATCGGG - Intergenic
1196116529 X:112005318-112005340 AGGTGGGGAGGGAGAAGATCAGG + Intronic
1198839004 X:140836048-140836070 AAGAGGGTAGGGAGAGTATCCGG - Intergenic
1200090390 X:153633208-153633230 ACCTGGGTAGGGGGAGGACCTGG + Intergenic