ID: 1083310657

View in Genome Browser
Species Human (GRCh38)
Location 11:61781950-61781972
Sequence CAGAATAAGGATCAGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083310657 Original CRISPR CAGAATAAGGATCAGGAATC AGG Intronic
900025049 1:264797-264819 CAGGATAGGGATCAGGATTTAGG - Intergenic
900028653 1:354191-354213 CAGGATAGGGATCAGGATTTAGG - Intergenic
901900672 1:12359051-12359073 CAGAAGTAGGATCAGGATTGGGG + Intronic
903134332 1:21299478-21299500 CAGCAGAAGGAACAGGAATAGGG + Intronic
903663705 1:24994339-24994361 CAGAACCAGGAGCTGGAATCAGG - Intergenic
908280650 1:62531130-62531152 GAGAATAATGATGAGGAATCTGG - Intronic
908478518 1:64513029-64513051 CAGAATAAAGATTTGGACTCTGG - Intronic
908775219 1:67633058-67633080 CAGAATAAATATCAGGAACTAGG + Intergenic
909272421 1:73640692-73640714 TTGAACAAGAATCAGGAATCAGG - Intergenic
909511811 1:76461891-76461913 CAGAATAAGGATCCAGACTTAGG + Intronic
909941727 1:81618823-81618845 CAGTATATGCATCAGTAATCTGG + Intronic
910259345 1:85280692-85280714 CAGAATAAGGATCAGGGATTGGG + Intergenic
911294527 1:96098541-96098563 AAGAATAAGGATCAGTTATTTGG + Intergenic
911603262 1:99869989-99870011 CAGAATCAGAATCAGGAGTTTGG - Intronic
912318031 1:108683844-108683866 CTGCATAAGGCTCAGGAATTGGG - Intergenic
912769273 1:112448056-112448078 GAGTATAAGGATCAGGAAGTGGG - Intronic
914459542 1:147870397-147870419 AAGAATAAGGCTTAGGAAGCTGG + Intergenic
918629151 1:186695004-186695026 CACAAAAAAGATCATGAATCTGG + Intergenic
918632780 1:186738551-186738573 GAGAATTAGGAGCAGGAAACTGG - Intergenic
918641056 1:186841810-186841832 CATCTTAAGGATCAGGAAACTGG - Intronic
919776812 1:201199586-201199608 CTGAAAAAGGAGCAGGAATGAGG - Intronic
920056203 1:203194065-203194087 TAGAATAAGGGTCAGAAAACTGG - Intergenic
921295046 1:213693533-213693555 CAGAAAAAGGAAGAGGGATCGGG + Intergenic
921669407 1:217909518-217909540 CAAAATAAGTATTTGGAATCAGG - Intergenic
922050736 1:221988333-221988355 CAGAGGATGGCTCAGGAATCAGG - Intergenic
923364587 1:233246870-233246892 CAGAATAAGAACCAGCTATCAGG - Intronic
924420358 1:243903684-243903706 CAGAGTAAGCATCTGGAACCAGG - Intergenic
1063862212 10:10323368-10323390 GAGAATCAGAATTAGGAATCTGG - Intergenic
1064050492 10:12055513-12055535 CAGAGCTAGGATTAGGAATCAGG + Intergenic
1064759214 10:18601553-18601575 CAGAACTAGGAGCAGGAAACAGG + Intronic
1064895787 10:20234682-20234704 CAGAATAAGAAGCAGGAAAAAGG - Intronic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1067024199 10:42829461-42829483 CTTAATTAGAATCAGGAATCAGG + Intronic
1068054909 10:51999913-51999935 CAGAATATGGATCAGAAGTTTGG + Intronic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068720307 10:60237937-60237959 CAGAATCAGGATCAGAATTTGGG + Intronic
1069083051 10:64108470-64108492 GATGATAAGGATCAGGAATTGGG - Intergenic
1070179523 10:73999752-73999774 GAGAAGAAAGATCAGGAATTTGG - Intronic
1070499992 10:77063601-77063623 CAGAACAATGATGAGGAATTTGG - Intronic
1070698572 10:78581915-78581937 AAGAATGAGGATCAGGGAACTGG - Intergenic
1070741613 10:78907185-78907207 CAGAATGATGCTCAGGAAGCAGG + Intergenic
1072407854 10:95171146-95171168 CAGAACAAGGAGGAAGAATCAGG + Intergenic
1072569526 10:96646445-96646467 TAGAAGAAGTATCAGAAATCAGG - Intronic
1073678718 10:105679032-105679054 CAGCATAAGAACCAAGAATCAGG + Intergenic
1076177649 10:128380756-128380778 CAGATTAAGAATCACTAATCTGG - Intergenic
1077609616 11:3636261-3636283 CTGAACAAGGAACAGGAATGGGG - Intergenic
1078167298 11:8899106-8899128 CAGAAAAAGAATCAGTAAACTGG + Intronic
1079112791 11:17614259-17614281 CAGATCAAGGCTCAGGAATTGGG - Intronic
1079603291 11:22337734-22337756 CAGAGTAAGTTTCAGGAATAGGG - Intergenic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080469462 11:32530861-32530883 CAGAATCAGGATAAAGAATTTGG + Intergenic
1080740481 11:35059379-35059401 CAGAAAAAGGATTAGAATTCAGG - Intergenic
1081996289 11:47366447-47366469 GAGAAGAAAGATGAGGAATCAGG + Intronic
1083310657 11:61781950-61781972 CAGAATAAGGATCAGGAATCAGG + Intronic
1084380681 11:68810604-68810626 CAAAAAGAGGTTCAGGAATCAGG + Intronic
1085395523 11:76205338-76205360 CAGGACAAGGGTCTGGAATCTGG - Intronic
1086807978 11:91268757-91268779 GAGAGTCAGGAGCAGGAATCGGG + Intergenic
1087267882 11:96080864-96080886 CAGAATCAGGTTCAGGTTTCAGG - Intronic
1087433671 11:98085500-98085522 AACAATAAGGATCAAGCATCTGG - Intergenic
1088289644 11:108222558-108222580 CACAATAAGGAACAAGACTCAGG + Exonic
1089035335 11:115383802-115383824 CAGAATAAAGATCAGCCATTTGG - Intronic
1095584177 12:43832734-43832756 TAGAGTAAGGATCAGAAACCAGG - Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096847450 12:54415536-54415558 CAGAATATGAAGCAGAAATCAGG + Intronic
1099015487 12:77339039-77339061 CAGATTAAGGAGGAGAAATCTGG + Intergenic
1099207638 12:79746462-79746484 CAGAATATGGAAAAGGTATCTGG + Intergenic
1099321390 12:81154615-81154637 CAATATGAGGTTCAGGAATCTGG - Intronic
1100781555 12:98032262-98032284 CATATTAAGGATAAGGATTCTGG - Intergenic
1101531155 12:105574791-105574813 TAGAATAAGGCTTAGGAACCTGG + Intergenic
1103733372 12:123043182-123043204 GAGACTAAGGCTCAGGAAGCAGG + Intronic
1107072144 13:36282162-36282184 CACAACAAGGATAAAGAATCGGG + Intronic
1107329477 13:39283669-39283691 GAGAATATACATCAGGAATCAGG - Intergenic
1109564844 13:64098777-64098799 CAGAATCAGGAGCAGGACTTGGG - Intergenic
1110202779 13:72872447-72872469 AAGAATAAGGATCTCGAACCTGG + Intronic
1110383385 13:74879736-74879758 CAGAATATGGATCAAGATGCAGG - Intergenic
1110851744 13:80253855-80253877 CAGAATCAGGGTCAAGAATTGGG + Intergenic
1111172111 13:84541162-84541184 TAGAATAAAGAACTGGAATCAGG - Intergenic
1114852228 14:26395003-26395025 AAGAACAAGGATCATCAATCAGG - Intergenic
1115772116 14:36675263-36675285 CAGAATCAGGATTAAAAATCAGG + Intronic
1116302427 14:43201659-43201681 CAGAATCAGAATCAGCAAGCAGG - Intergenic
1116855979 14:49952700-49952722 GAGAACAAGGATCAGGAAAATGG - Intergenic
1119856660 14:77906165-77906187 CAGAATTAGGAACAGGAAATAGG + Intronic
1123425353 15:20166501-20166523 CTTAATTAGAATCAGGAATCAGG + Intergenic
1123534576 15:21173033-21173055 CTTAATTAGAATCAGGAATCAGG + Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1125811313 15:42543881-42543903 AAGAAAAAGGATCAGGAGACAGG - Exonic
1126267484 15:46771558-46771580 TATAATAAGGTACAGGAATCAGG - Intergenic
1126329833 15:47520348-47520370 CAGAGTGAGGAATAGGAATCAGG + Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1127655634 15:61053010-61053032 TAGATTAAGGATCATGAATATGG - Intronic
1130965404 15:88693974-88693996 CAGAATAAGGACCAGCAAACAGG + Intergenic
1132125291 15:99218348-99218370 GAGAATAATGATCAGAACTCTGG + Intronic
1133606089 16:7389479-7389501 CAGAACAAAGATCAAGAATCAGG - Intronic
1133609815 16:7422857-7422879 AAGAAAAAGCATCAGGAATATGG - Intronic
1136859513 16:33689226-33689248 CTTAATTAGAATCAGGAATCAGG - Intergenic
1137411806 16:48234919-48234941 CAGAGAAAGAATCAGGAACCTGG - Intronic
1138492407 16:57384111-57384133 CTGAAGAAGCATCAGGAATGTGG - Exonic
1138673310 16:58632556-58632578 CAGAACAAGGATGAGGAATAAGG + Intergenic
1138677881 16:58665243-58665265 CAGGAGAAGGAGCTGGAATCTGG - Exonic
1139030282 16:62872579-62872601 CAGAATAAAGATCATGAAGCAGG - Intergenic
1140470896 16:75213745-75213767 CAGAACAAGGATAAAGAACCCGG - Intergenic
1141076386 16:81009539-81009561 CAGAATCAGGATCATGAAACAGG - Intronic
1141098327 16:81178770-81178792 CAGAACCAGGATCCGGAAACAGG + Intergenic
1142456104 16:90224580-90224602 CAGGATAGGGATCAGGATTTAGG + Intergenic
1203121018 16_KI270728v1_random:1537414-1537436 CTTAATTAGAATCAGGAATCAGG - Intergenic
1142726923 17:1822295-1822317 GGGAATAAGAATCAGGAATGGGG + Intronic
1143509295 17:7386707-7386729 CAGAGAAGGGATCAGGAATTAGG - Intronic
1144479887 17:15620529-15620551 CAGAATGGGGAATAGGAATCAGG + Intronic
1146473119 17:33140119-33140141 GATAATAAGGCCCAGGAATCTGG + Intronic
1146517942 17:33503852-33503874 CAGGATTAGGATGAGGAATGAGG + Intronic
1147312191 17:39601954-39601976 CAGGATAAGAATCAGGCCTCGGG + Intergenic
1148668714 17:49394108-49394130 AACAATAAGGAACAGAAATCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149682419 17:58515319-58515341 AGGAATAAGGACCAGGAATAAGG + Intronic
1152951106 17:83232366-83232388 CAGGATAGGGATCAGGATTTAGG + Intergenic
1154166221 18:12016399-12016421 CAGAATCAGGATCTGAAATTGGG - Intronic
1155160585 18:23192401-23192423 CAGAAGAAGGCTGAGGAATCTGG + Intronic
1155524649 18:26704043-26704065 TAGAAGGAGGTTCAGGAATCAGG + Intergenic
1156544309 18:37948279-37948301 AAGAATAAGTATCAGGAATCTGG - Intergenic
1156985172 18:43342259-43342281 CAGAGAAAGGATCAGGAATGGGG - Intergenic
1157075660 18:44464547-44464569 CAGCAAAAGGATCAAGAATGAGG + Intergenic
1158446617 18:57527691-57527713 AAGCGCAAGGATCAGGAATCTGG + Intergenic
1158780116 18:60638590-60638612 CAGAATAGTGATAAGAAATCAGG + Intergenic
1161109890 19:2463164-2463186 CAGAACCAGGCTCTGGAATCCGG - Intergenic
1161497868 19:4597501-4597523 CAGCTCAAGGATGAGGAATCAGG + Intergenic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
927335733 2:21922029-21922051 CAGAATCAGGACTAGGAAACAGG + Intergenic
929955845 2:46458059-46458081 CATAATATGGACCTGGAATCAGG + Intronic
934457871 2:94190346-94190368 CTTAATTAGAATCAGGAATCAGG - Intergenic
934932351 2:98436823-98436845 AAGAATAAGGATCAGGACAAAGG - Intergenic
935533836 2:104269485-104269507 CAAAATATGAATCTGGAATCAGG - Intergenic
936275481 2:111092945-111092967 CAGCACGAGGATCAGGAATCAGG + Exonic
937299610 2:120831213-120831235 CAGAAGAAGGGCCAGGCATCGGG - Intronic
942979338 2:182060731-182060753 TAGCATAAGGATCAGGAAAGAGG + Intronic
943813620 2:192222552-192222574 AAGAATAAGGATTAAAAATCTGG - Intergenic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
948771572 2:240253841-240253863 CAGAATTAGGAGCAAGAATTAGG + Intergenic
949087602 2:242169381-242169403 CAGGATAGGGATCAGGATTTAGG + Intergenic
1168984574 20:2037182-2037204 CATAATACAAATCAGGAATCAGG + Intergenic
1173637494 20:44573418-44573440 TAGATTAAGGATCAGGAGCCTGG + Intronic
1173735182 20:45355989-45356011 GGGAATCAGGAACAGGAATCAGG - Intergenic
1174755281 20:53152461-53152483 CAGAATCAGGGTCAGGATTAGGG - Intronic
1175063625 20:56266596-56266618 CAGAACTAGAATCAGGAAGCTGG + Intergenic
1178708727 21:34895622-34895644 CTGAATAAGCATCATGAATAAGG + Intronic
1181381919 22:22512057-22512079 CAGAATGAGGACCAGGACTGGGG + Intergenic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183383584 22:37502735-37502757 AAGAATGAGGTTCAGGGATCTGG + Intronic
1183838119 22:40473989-40474011 CAATATAAGGATTGGGAATCAGG + Intronic
949337281 3:2989302-2989324 CAGAATCAGGATCTGGGTTCAGG - Intronic
949746616 3:7301241-7301263 CAGAATCAGGATCAGTTCTCCGG - Intronic
949949120 3:9214729-9214751 CAGATGAAGGACCAGGAATTTGG + Intronic
950771509 3:15315073-15315095 CAGGATTAGAATCAGGAACCCGG - Intronic
952737056 3:36701374-36701396 CAAAATAAAGGTCTGGAATCTGG - Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
956146957 3:66199818-66199840 CTGCATAAGGATCAGGTGTCAGG - Intronic
957378874 3:79398148-79398170 CAGAATAAGAATCAGAGAACAGG - Intronic
959845434 3:111027406-111027428 CAGGAGATGGATGAGGAATCAGG - Intergenic
960268061 3:115644000-115644022 CAGATTAAGGAAAAGCAATCAGG - Intronic
960409941 3:117310503-117310525 CAGAATAATGTTCATTAATCTGG - Intergenic
960456482 3:117878959-117878981 CAGGACAAGGATCATGAATCTGG + Intergenic
961068704 3:123899787-123899809 CAGAAAAAAGATCAGGAGTTTGG - Intronic
961150923 3:124637146-124637168 AAGAATAAGGAACAGTGATCAGG - Intronic
961198422 3:125023799-125023821 CATTATAAAGATCAGGAATTTGG - Intronic
962961086 3:140311604-140311626 CATAATAAGTATCATAAATCTGG - Intronic
963788747 3:149561825-149561847 TAGAATAATGCTCAGGAAGCTGG + Intronic
966377249 3:179308953-179308975 CTGCATAAGGATTAGGAATTGGG - Intergenic
966432299 3:179844970-179844992 CAGAATAAGTATGACCAATCTGG - Intronic
971035892 4:22692600-22692622 CAGAGTACGGATCAGGAATTGGG + Intergenic
971958597 4:33455507-33455529 CAGAGCAAGAATCTGGAATCTGG + Intergenic
975557287 4:75677087-75677109 TATAATAAAAATCAGGAATCAGG - Intronic
976085077 4:81399501-81399523 GAGGATAAGAATCTGGAATCTGG + Intergenic
976953535 4:90865275-90865297 ATGAATAAGGATCAAGAATGAGG + Intronic
977242017 4:94584222-94584244 GAGAAAAAGGAACATGAATCTGG - Intronic
977395546 4:96466789-96466811 CAGAATATGGATAAGAAATTAGG - Intergenic
977805937 4:101297958-101297980 AAGAAATAGGACCAGGAATCAGG + Intronic
978574513 4:110175673-110175695 CTGAACAAGGATCAGAACTCAGG + Intronic
978691874 4:111523595-111523617 CAGAGGAAGGTTCAGGATTCAGG + Intergenic
984847468 4:184120188-184120210 GGGAAGAAGGAGCAGGAATCAGG - Intronic
985124734 4:186682156-186682178 CAGATTCAGGACTAGGAATCAGG + Intronic
986072422 5:4298645-4298667 CAGAATCAGGCACAGGATTCAGG + Intergenic
989559889 5:42838016-42838038 CAGTTTCTGGATCAGGAATCTGG - Intronic
989788656 5:45363949-45363971 AAGAATCAGGATTAGGAAACAGG - Intronic
992248134 5:74849614-74849636 CATAATAAGGTTCAGAAATAAGG - Intronic
993191051 5:84681944-84681966 GAGAACAAGGATCAGTAATGTGG - Intergenic
994310273 5:98261309-98261331 CTAAATGAGGATCAGGAATGAGG + Intergenic
994387294 5:99147000-99147022 CAGAGGAAGAATCAGGAATCAGG + Intergenic
995456526 5:112358504-112358526 CAGAAAAAGGATCACCCATCAGG + Intronic
995984791 5:118157005-118157027 CTGAATAAGTATCTGGAGTCAGG + Intergenic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
998440504 5:142157393-142157415 CAAAATAAAGATGTGGAATCAGG - Intergenic
998725042 5:145002964-145002986 CAAAATTAGTATCAAGAATCAGG + Intergenic
1000106323 5:158062500-158062522 AAGAATAAGTATTTGGAATCTGG - Intergenic
1000485823 5:161842471-161842493 TAGAATAAAGATCAAGAATTAGG - Intergenic
1002161367 5:177315600-177315622 CAGCATAATGATCAGGAGTTGGG + Intergenic
1002745337 5:181466180-181466202 CAGGATAGGGATCAGGATTTAGG + Intergenic
1004276866 6:14244346-14244368 CAGAATGAGGATTAGGACCCAGG + Intergenic
1005885299 6:30092832-30092854 AGGAATGAGGATCAGGAGTCGGG + Intergenic
1006105490 6:31713816-31713838 CAGACACAGGCTCAGGAATCTGG + Exonic
1006109049 6:31733963-31733985 TGGAGAAAGGATCAGGAATCAGG + Intronic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1008156476 6:48020971-48020993 AGGAAGAAGGATCAAGAATCAGG + Intronic
1008510834 6:52274188-52274210 CAGAATAAGGTTTGGGAAGCAGG - Intronic
1009277987 6:61709004-61709026 CATATTAAAGATCAGGAAACTGG - Intronic
1010635393 6:78253152-78253174 TAGAATCAGCATCTGGAATCAGG - Intergenic
1011282692 6:85692337-85692359 GAGAATAAGGTTCTGGAATTTGG + Intergenic
1011397989 6:86930411-86930433 CAGAATAAGAATCAAGAAAAGGG + Intergenic
1011742008 6:90371379-90371401 GAGAAAAAGGATCAGGAAATGGG - Intergenic
1013945843 6:115721247-115721269 CCACAGAAGGATCAGGAATCAGG - Intergenic
1015381016 6:132569232-132569254 AAGAATAATGAACAGGAAACTGG - Intergenic
1015456552 6:133433009-133433031 AACAATATGGATTAGGAATCAGG - Intronic
1015554122 6:134443383-134443405 CAGCATGAGGATCAGAAACCAGG - Intergenic
1016339240 6:143043691-143043713 CATAAAAATGATCAGGAATAAGG + Intergenic
1016722249 6:147313971-147313993 CAGAATAAAGTGCAGGAATAAGG - Exonic
1018226610 6:161635197-161635219 CAGCATAAGGAACAGAGATCTGG - Intronic
1019548158 7:1588373-1588395 GAGATTTAGGATGAGGAATCTGG + Intergenic
1022043595 7:26604037-26604059 AAGAGCAAGGAGCAGGAATCTGG + Intergenic
1022617183 7:31943436-31943458 TAGAATATGGATCAACAATCAGG - Intronic
1023165543 7:37339816-37339838 CAGAATAATTATCAAGAATTAGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1028393240 7:90338611-90338633 CAAAATAAAGATCAGGACTGTGG - Intronic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029503945 7:100950685-100950707 CAGAGTTAGGATCAGAGATCCGG - Intronic
1030892085 7:115011153-115011175 CAGAAACAGGATCAGGACCCAGG - Intronic
1030978918 7:116162997-116163019 GATGAGAAGGATCAGGAATCAGG + Intergenic
1031932537 7:127700720-127700742 CAGAACAAGGCTGAGGAATGTGG - Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034448184 7:151123920-151123942 CAGAATGAGGCCCAGGAATGTGG + Intronic
1035497125 8:61959-61981 CAGGATAGGGATCAGGATTTAGG - Intergenic
1037377434 8:18246500-18246522 CAGAACAATAATGAGGAATCAGG + Intergenic
1037712509 8:21366515-21366537 CAGAATAAAGATCAAGAGTACGG + Intergenic
1037900012 8:22682615-22682637 CATGATAAGGATCAGGAAGCAGG + Intergenic
1039867605 8:41518867-41518889 GAGAGTAAGGAACAGGAATGAGG + Intergenic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1041225903 8:55697832-55697854 CAGAATAAGGCTCCAGGATCAGG - Intronic
1044215551 8:89605462-89605484 CAGACTCAGGATCAGGAATCAGG - Intergenic
1044608251 8:94065852-94065874 AAGAATAAGGTTCAGGCACCTGG - Intergenic
1046579748 8:116077660-116077682 ATGAATAAGAATCGGGAATCAGG + Intergenic
1047535601 8:125717056-125717078 CAGAAAAATAATCAGGAAACAGG - Intergenic
1048751052 8:137676246-137676268 AAGAACAAGGCTCAGGAATTAGG + Intergenic
1049157506 8:141075804-141075826 CAGAGCAAGGATTTGGAATCGGG + Intergenic
1049657733 8:143806159-143806181 CAGAACAAAGATGAGCAATCAGG + Intronic
1051731334 9:20146442-20146464 CAGAATAAGTTACAGGAATTAGG - Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053688379 9:40566143-40566165 CTTAATTAGAATCAGGAATCAGG - Intergenic
1053939743 9:43221619-43221641 CTTAATTAGAATCAGGAATCAGG - Intergenic
1054275651 9:63064907-63064929 CTTAATTAGAATCAGGAATCAGG + Intergenic
1054299620 9:63367054-63367076 CTTAATTAGAATCAGGAATCAGG - Intergenic
1054399182 9:64700022-64700044 CTTAATTAGAATCAGGAATCAGG - Intergenic
1054432760 9:65184288-65184310 CTTAATTAGAATCAGGAATCAGG - Intergenic
1054497625 9:65837388-65837410 CTTAATTAGAATCAGGAATCAGG + Intergenic
1056550747 9:87651773-87651795 CAGAATCAGGACCCAGAATCGGG - Intronic
1056550752 9:87651806-87651828 CAGAATCAGGACCTGGGATCAGG - Intronic
1056550761 9:87651839-87651861 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550770 9:87651872-87651894 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550777 9:87651905-87651927 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550786 9:87651938-87651960 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550795 9:87651971-87651993 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550804 9:87652004-87652026 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550813 9:87652037-87652059 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550846 9:87652169-87652191 CAGAATCAGGACCTGGGATCAGG - Intronic
1056550856 9:87652202-87652224 CAGAATCAGGACCCGGGATCGGG - Intronic
1056550865 9:87652235-87652257 CAGAATCAGGACCTGGGATCAGG - Intronic
1056550875 9:87652268-87652290 CAGAATCAGGACCCGGGATCGGG - Intronic
1056550884 9:87652301-87652323 CAGAATCAGGACCTGGGATCAGG - Intronic
1056550893 9:87652334-87652356 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550902 9:87652367-87652389 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550911 9:87652400-87652422 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550920 9:87652433-87652455 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550929 9:87652466-87652488 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550937 9:87652499-87652521 CAGAATCAGGACCTGGTATCAGG - Intronic
1056550952 9:87652565-87652587 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550957 9:87652598-87652620 CAGAATCAGGACCTGGGATCAGG - Intronic
1056550965 9:87652631-87652653 CAGAATCAGGACCTGGTATCAGG - Intronic
1056550979 9:87652697-87652719 CAGAATCAGGACCTGGGATCAGG - Intronic
1056550988 9:87652730-87652752 CAGAATCAGGACCCGGGATCAGG - Intronic
1056550997 9:87652763-87652785 CAGAATCAGGACCCGGGATCAGG - Intronic
1056551005 9:87652796-87652818 CAGAATCAGGACCTGGGATCAGG - Intronic
1056551014 9:87652829-87652851 CAGAATCAGGACCTGGGATCAGG - Intronic
1056551024 9:87652862-87652884 CAGAATCAGGACCCGGGATCGGG - Intronic
1056551033 9:87652895-87652917 CAGAATCAGGACCCGGGATCAGG - Intronic
1056551047 9:87652961-87652983 CAGAATCAGGACCTGGGATCAGG - Intronic
1056551057 9:87652994-87653016 CAGAATCAGGACCCGGGATCGGG - Intronic
1056551064 9:87653027-87653049 CAGAATCAGGACCTGGGATCAGG - Intronic
1056551072 9:87653060-87653082 CAGAATCAGGACCTGGGATCAGG - Intronic
1056551082 9:87653093-87653115 CAGAATCAGGACCCGGGATCGGG - Intronic
1056551088 9:87653126-87653148 CAGAATCAGGACCTGGGATCAGG - Intronic
1056551108 9:87653192-87653214 CAGAATCAGGACCCGGGATCGGG - Intronic
1061621886 9:131815976-131815998 CAGATTTAGAATCAGGAACCTGG - Intergenic
1062002555 9:134224049-134224071 CAGAAAAAGGTTCAGTAAACTGG - Intergenic
1062077333 9:134597934-134597956 TAGACTAAGAATCAGGAAACTGG + Intergenic
1062597618 9:137306256-137306278 CAGAGTAAGGAGCAGGCTTCGGG - Intergenic
1186680676 X:11870510-11870532 CAGTATAAGAATTATGAATCAGG - Intergenic
1186768415 X:12793756-12793778 CTGAACTAGGATCAGAAATCTGG + Intronic
1187413716 X:19074030-19074052 CAGAAAAAGAATCAGGAAACTGG + Intronic
1187779086 X:22797155-22797177 AAGAATAAGCAGCAGTAATCTGG + Intergenic
1187785761 X:22884131-22884153 CAGAGCAAGGATCAGCAACCTGG - Intergenic
1190577980 X:51860537-51860559 CAGAATAAGGAGCAGGTTTGTGG + Intronic
1192576487 X:72247114-72247136 CATAATGAGGACCAGAAATCAGG + Intronic
1193488024 X:82111440-82111462 CAGAATACGGCTCAAGAACCTGG + Intergenic
1194802855 X:98293359-98293381 CTGTATATGGATCAGGAATATGG - Intergenic
1196231451 X:113227453-113227475 CAAAATTATGATCAGGAATTGGG + Intergenic
1198198015 X:134384537-134384559 CAGAAGAAGAATCAGGTTTCAGG - Intronic
1198204188 X:134450876-134450898 CAGAAGGAGGATCAGGAAGGTGG + Intergenic
1198258288 X:134944323-134944345 TAGATTGAGGATCAGAAATCAGG - Intergenic
1198993743 X:142548293-142548315 AAGAATAAGGATCAGTAAGGAGG + Intergenic