ID: 1083311113

View in Genome Browser
Species Human (GRCh38)
Location 11:61784245-61784267
Sequence AACCTCATTTCTCTGCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083311113 Original CRISPR AACCTCATTTCTCTGCTAAC TGG Intronic
903691115 1:25174376-25174398 AACATCATTTATCTGCCAAGAGG + Intergenic
904296497 1:29522595-29522617 GACCTCTGTTCTCTGCAAACTGG - Intergenic
905415983 1:37804554-37804576 AAGCTCCTTTCTCTGCTTAGAGG - Intronic
906999320 1:50833911-50833933 AACCACATTACTCTCTTAACTGG + Intronic
908740419 1:67321813-67321835 AACCTTGTTTGTCTGCAAACTGG + Exonic
909195934 1:72623344-72623366 AACCTCATTTCTGTTTTAACAGG + Intergenic
911745477 1:101437393-101437415 AACCCCAGTTCGCTGCTAGCTGG - Intergenic
912162184 1:106998676-106998698 ATCCTCATTCCTCTGAGAACAGG - Intergenic
914399265 1:147301166-147301188 AAGATCATGTCTCTGCAAACAGG - Intergenic
915536757 1:156541034-156541056 AACCCCAGTCCTCTTCTAACTGG + Intronic
915666772 1:157452093-157452115 ATCCACATTTCTCTCCTATCTGG - Intergenic
918406381 1:184215204-184215226 AACCTCATTTTTCTGCAGGCTGG - Intergenic
919077885 1:192834565-192834587 AACCTAAATTATCTGCTTACTGG - Intergenic
919959683 1:202453841-202453863 AAACTAATTTCTGGGCTAACAGG + Intronic
920516641 1:206589392-206589414 GCCTTCATTTCTCTGCTCACTGG - Intronic
921279351 1:213550324-213550346 AAGCACATTTTTCTCCTAACAGG + Intergenic
921756399 1:218861752-218861774 ATCCTCATTTCTCTTCAATCAGG - Intergenic
921945167 1:220881193-220881215 GATCTCACTTCCCTGCTAACCGG + Exonic
922926848 1:229355168-229355190 AAGATCATTTATCTGCAAACAGG + Intergenic
923495246 1:234519097-234519119 AACCCAATTTCTCTACTATCGGG - Intergenic
923506971 1:234612266-234612288 ATACTCATTTCTCTGCAAGCTGG + Intergenic
1065643222 10:27806100-27806122 AGCCTCAGTTCTCTGCTGAAAGG + Intergenic
1066234468 10:33471548-33471570 AAACTCATTCCTCTGTTAAGTGG - Intergenic
1068655890 10:59576223-59576245 AGCCTGCTTTGTCTGCTAACAGG - Intergenic
1074706655 10:116138901-116138923 AACTTCATTCTTCAGCTAACTGG - Intronic
1075383773 10:122039920-122039942 AACCTCTTCTATCTGCTAATTGG + Intronic
1083182269 11:60994706-60994728 AAACTCATTTCTCAGCTTTCAGG - Intronic
1083311113 11:61784245-61784267 AACCTCATTTCTCTGCTAACTGG + Intronic
1083980557 11:66164851-66164873 AACTTCACTTCTCTCTTAACAGG + Intronic
1086412454 11:86556368-86556390 TCACTCATTTCTCTGCTTACGGG + Intronic
1087307947 11:96506276-96506298 CATCTCATTCCTCTGGTAACAGG + Intronic
1089146229 11:116331327-116331349 AAACTCAGCTCTCTTCTAACAGG + Intergenic
1093013227 12:14130011-14130033 ACCCTCATTTCTCTGAGACCTGG + Intergenic
1093900628 12:24627339-24627361 AACTTCCTTTCTCTACTAAATGG - Intergenic
1094272905 12:28637044-28637066 TTCCTCATTTCTCTACTCACAGG - Intergenic
1094563933 12:31582483-31582505 AACCTCTTTGCTCTTCTTACTGG - Intronic
1096643264 12:53012070-53012092 AACATCTTTTCTCAGTTAACTGG + Intronic
1099072377 12:78061550-78061572 AACCTTCTATCTCTGCTAATAGG - Intronic
1103121867 12:118387290-118387312 CACCTCCTTTATCTGCTAAAAGG - Intronic
1104085164 12:125467492-125467514 TATCTCATTTCTCTGCCCACAGG - Intronic
1104129560 12:125880074-125880096 AACCTCACTTTGCTGCTATCAGG + Intergenic
1104178248 12:126353258-126353280 AACAGCATTTCTCTGCTCTCTGG + Intergenic
1104363493 12:128155406-128155428 AACCTCATTTCTCTGTGGCCAGG - Intergenic
1104745953 12:131210666-131210688 ACACTCATTTCTCTCCTCACAGG - Intergenic
1109147777 13:58802956-58802978 AACTTCTTTTCTCTACTCACGGG + Intergenic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1112951384 13:105001420-105001442 AATATCATTTCTCTGCTGATTGG + Intergenic
1113461244 13:110484064-110484086 AGCCTGAAATCTCTGCTAACAGG - Intronic
1116732000 14:48635335-48635357 AACTTCATTTCTATGGAAACAGG + Intergenic
1116870180 14:50062592-50062614 AGCCTAAATTCTCTGGTAACGGG - Intergenic
1119294838 14:73524633-73524655 AACCTGACTCCTCTGCTTACGGG - Intronic
1120148430 14:81004914-81004936 CTCCTCATTTCTCTCCTACCTGG + Intronic
1122154142 14:99740296-99740318 AACCTGGCTTCTGTGCTAACAGG - Intronic
1130870820 15:87970784-87970806 AACATCATTTGTCTAGTAACTGG + Intronic
1133491031 16:6268263-6268285 AAACTCATTTCCCTGCTAGCAGG + Intronic
1133950122 16:10384731-10384753 TGCCTCATTTTTCTCCTAACTGG + Intronic
1137785981 16:51138201-51138223 AACGTCACTGCTCTGCTAATGGG - Intronic
1138214602 16:55192115-55192137 AACTTCAGTTCTCTGCTATATGG - Intergenic
1139692854 16:68652066-68652088 AACCTCATTTTACAGCTAAGTGG - Intronic
1143747035 17:9002665-9002687 AACCTCAATTCCATGCTAACTGG - Intergenic
1146249895 17:31330356-31330378 AACCTGATGTCTCTAGTAACTGG - Exonic
1150197458 17:63315311-63315333 AACCTCATTGAGCTGGTAACAGG - Intronic
1150938006 17:69658648-69658670 AACCTCAGTCCTCTGATCACAGG - Intergenic
1153850586 18:9090552-9090574 AACCTCCTCTCTTTTCTAACAGG + Intergenic
1154957365 18:21271978-21272000 ACCCCCACTTCTTTGCTAACAGG - Intronic
1155323291 18:24640362-24640384 AACCTCTTTTCTTTTGTAACAGG - Intergenic
1156079722 18:33317925-33317947 AATCTCATTTCCATGCTAAATGG + Intronic
1157014586 18:43696190-43696212 AACCTCATTTTTTTGCTATCAGG + Intergenic
1157239477 18:45996251-45996273 AGCCCCTTTTCTGTGCTAACAGG + Intronic
1157929427 18:51804948-51804970 AACCTCATTTCTTTCCCACCAGG - Intergenic
1158405496 18:57156030-57156052 AACCACATTTTTCAGATAACTGG + Intergenic
1159201675 18:65194356-65194378 AACTCCATTTCTAGGCTAACAGG - Intergenic
1162946419 19:14046597-14046619 AACCTCAGTGCTCTGTTACCAGG + Exonic
1165025708 19:32959677-32959699 AACCTAATTGCTCTGCGATCTGG - Intronic
1166758800 19:45212031-45212053 AACCTCCTTCCTCTCCTGACAGG + Intronic
927605293 2:24481365-24481387 TTCTTCATTTCTATGCTAACAGG + Intergenic
930222617 2:48760365-48760387 AGCCCTATTTCTCTCCTAACTGG - Intronic
930424747 2:51198360-51198382 CACAACATTTGTCTGCTAACTGG + Intergenic
933114375 2:78449027-78449049 AATCTCAATCCTTTGCTAACAGG + Intergenic
936271194 2:111050535-111050557 CACCTCTTTTCTCTGCTCACCGG + Intronic
941877514 2:170449298-170449320 AATCTCATTTCTTTTGTAACAGG - Intronic
944621645 2:201522223-201522245 AAGATCATGTCTCTGCAAACAGG - Intronic
945848478 2:214977081-214977103 AAACTCATATCTCTGCAAAAGGG + Intronic
1169598889 20:7233862-7233884 AACTTGATTTGTCTGCTAATGGG - Intergenic
1173040530 20:39458328-39458350 CACTACATTTCTCTCCTAACTGG - Intergenic
1173178025 20:40779508-40779530 TACTTCATTTCTCTGATAATTGG + Intergenic
1173352537 20:42258050-42258072 AAACACATTTCTCTGCTGAACGG - Intronic
1178385933 21:32150568-32150590 ATACTCATTTCTCTTCTAGCTGG - Intergenic
1179017947 21:37609977-37609999 CAGCTCATCTCTCTGCTACCGGG + Exonic
1180255544 21:46624815-46624837 AAGCTCCTTTCCCTGCTAAGGGG - Intergenic
1182045104 22:27268004-27268026 CTCCCCAATTCTCTGCTAACTGG + Intergenic
1183416798 22:37687197-37687219 AACCTCATTACTCTCTCAACAGG - Intronic
1183827592 22:40400674-40400696 TTCCTCTTTTCTCTTCTAACAGG + Exonic
1184305153 22:43593575-43593597 AAACTCAATTCTCTGCTTTCAGG + Intronic
949201513 3:1385880-1385902 CACCTCATTTCTTTACTAATTGG + Intronic
949507577 3:4741676-4741698 GCCCTCATCTCTTTGCTAACTGG - Intronic
952528560 3:34239691-34239713 AACTTGATTTATCTGCTAAATGG - Intergenic
954925796 3:54233208-54233230 AATATCAATTCTGTGCTAACAGG + Intronic
955050838 3:55409385-55409407 CACCTCATCCCTCGGCTAACAGG - Intergenic
956530151 3:70209531-70209553 ACCTTCATTCATCTGCTAACTGG - Intergenic
959769144 3:110072028-110072050 AACTTCATTTCTCTGCCACATGG - Intergenic
961263607 3:125622412-125622434 AACCTCATTTCTGTGGGAACTGG - Intergenic
963005882 3:140725903-140725925 AACATCATTTCTGTGGTAGCTGG - Intergenic
964465718 3:156989475-156989497 ATACTCATTTCTCTGCTTCCTGG + Intronic
964969206 3:162539243-162539265 AGCCTCATTCCTCTGAGAACGGG - Intergenic
967852483 3:194092862-194092884 AACCTCATTTATCTGCTTTGAGG - Intergenic
970341898 4:15115968-15115990 TTCTTCATTTCTCTGCTAAGAGG + Intergenic
977048117 4:92091958-92091980 AACCTCATAACTATGCTAATTGG + Intergenic
977162361 4:93651041-93651063 AAAATCATTTCTCTGAAAACTGG + Intronic
977239218 4:94546348-94546370 AACCTCACTTCTCTTCCAAGCGG + Intronic
977402515 4:96550678-96550700 CACCTCATTTCTAGGCTAAAAGG - Intergenic
977547075 4:98396333-98396355 TACCTCTTTTCTCTCCTACCAGG - Intronic
978103980 4:104878855-104878877 ATCCTGGTTTTTCTGCTAACTGG + Intergenic
978454610 4:108874598-108874620 AACCACATTTCCCTGATAATGGG - Intronic
978709195 4:111757102-111757124 TACCACATTTCTCTGCTCCCAGG - Intergenic
979600159 4:122578766-122578788 AGCCTCATTTCTCTTAAAACGGG + Intergenic
979965219 4:127068642-127068664 AATTTCATTTCTCTGCTTCCAGG + Intergenic
981567440 4:146115695-146115717 AACCTTATCTCTCTGTTAATCGG - Intergenic
982048076 4:151468990-151469012 AAGCTTATTTTTCTGCTATCAGG - Intronic
982715761 4:158805878-158805900 AATGTCTTTTCTTTGCTAACTGG + Intronic
982945977 4:161623116-161623138 AACATCTTTTATCTGCCAACAGG + Intronic
983368638 4:166829976-166829998 AATCTCATTTCTCTTTTATCTGG + Intronic
983722737 4:170876664-170876686 AACCTAGTGTCTCTGCTAAGGGG - Intergenic
984395329 4:179190631-179190653 AACCTCATTTTCCTGCAAAATGG - Intergenic
985543377 5:497340-497362 AACCTGGTTTCTCTGCTCCCGGG + Intronic
985774386 5:1833239-1833261 ATCCTCATTTCCCTGCTCAAGGG + Intergenic
988409557 5:30869700-30869722 AACCTCATTCTTCTGCAAGCTGG + Intergenic
988680084 5:33476436-33476458 AGCCGCATCTCTCTGCTGACTGG + Intergenic
989146312 5:38253753-38253775 AACCTCATAATTCTGCTCACAGG + Intergenic
992459244 5:76944754-76944776 CACTTCATTTCTCTGCTGTCAGG + Intergenic
993972623 5:94438797-94438819 AACCTCATTTGTATACTAACAGG + Intronic
996588420 5:125117949-125117971 GACCTCATTTCTCTCCTCAATGG + Intergenic
998621301 5:143796876-143796898 AACCCCATTTCTCTGGTTACAGG - Intergenic
1005892532 6:30151781-30151803 AACCTCCTTGCTCTGCTGGCCGG - Intergenic
1009685066 6:66945993-66946015 AAGCTCATTTCTCTGTAATCGGG - Intergenic
1009994740 6:70885578-70885600 AACTTCATTTCTCTTCTGGCGGG - Intronic
1011774822 6:90717864-90717886 AACTTCATTTCTATGTTAAACGG - Intergenic
1012397854 6:98820509-98820531 AACCTTCTTTGTCTACTAACTGG - Intergenic
1012406350 6:98904186-98904208 AAATTCTTTTCTCTGCTAATAGG - Intronic
1012423152 6:99086449-99086471 ATTCTCACTTCTCTGCTAAAAGG + Intergenic
1014594571 6:123318426-123318448 AACCTCATTCAGCTGCTAAGTGG + Intronic
1014601385 6:123417564-123417586 AACCTCTTTTCTCTTCTCATTGG - Intronic
1016413593 6:143809619-143809641 AACCTCATTTCTGTTCTCACAGG + Intronic
1018506548 6:164476282-164476304 AAAGCCATTTATCTGCTAACAGG + Intergenic
1019627885 7:2030297-2030319 AAACTCATTACCTTGCTAACTGG + Intronic
1025133507 7:56391396-56391418 CACCTCATTTCTGTGCTACTTGG + Intergenic
1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG + Intergenic
1026489264 7:70848660-70848682 TACCTCATGTCTCTGATGACAGG + Intergenic
1027620770 7:80482220-80482242 AACCCCATTTCTCTGTTAAATGG + Intronic
1028057736 7:86268683-86268705 AACCTTATTCATCAGCTAACAGG + Intergenic
1029377563 7:100188944-100188966 GACCTCATCTCCCTGCTCACTGG + Exonic
1030021525 7:105279698-105279720 CACCACATTTCATTGCTAACGGG - Intronic
1031037011 7:116798817-116798839 AAGGTAATTTCTCTGGTAACTGG - Intergenic
1034227274 7:149493956-149493978 ACACTCATTTCTCTGTTAAATGG - Intronic
1036689031 8:10929765-10929787 AACCTCCTGTCTGTGCTCACAGG - Intronic
1045475794 8:102551051-102551073 AACCTCATTTCTCTACTGGTTGG - Intergenic
1045911405 8:107414798-107414820 CATCTCATTTGTCTGCTAAAGGG + Intronic
1046105525 8:109661378-109661400 AACCTCATTTAGCTTCTAACTGG + Intronic
1047058036 8:121189837-121189859 ATCAGCATTTCTCTGCTCACTGG + Intergenic
1051608886 9:18942590-18942612 TCCTTCATTTCTCTGCTATCTGG + Intronic
1052688715 9:31787259-31787281 GAACTCATTTCACTGCTAAGAGG - Intergenic
1053547015 9:39034023-39034045 AATCTCATTTCCATGCTAAATGG + Intergenic
1053811333 9:41855683-41855705 AATCTCATTTCCATGCTAAATGG + Intergenic
1054619261 9:67331756-67331778 AATCTCATTTCCATGCTAAATGG - Intergenic
1055661572 9:78508904-78508926 ACCCTCTTTTTTCTGGTAACAGG - Intergenic
1057807579 9:98230939-98230961 AACCTGATTTCTCTTCGATCTGG - Intronic
1188085474 X:25897063-25897085 AACCTGTTTTCTATGCTAAAGGG + Intergenic
1189505173 X:41606143-41606165 AAGCTCATTTCACAGCTAACAGG - Intronic
1190503783 X:51105083-51105105 AAACTCATTTCCATGCTATCGGG + Intergenic
1195369997 X:104164333-104164355 CACCTCATTTGTCTTCTCACAGG + Intergenic
1196393118 X:115230614-115230636 AAAATCTTTTCTCTGCTAACAGG - Intronic
1197000715 X:121435914-121435936 ACCCTAATTACTCTGCTAACAGG + Intergenic
1197156072 X:123271901-123271923 AACATCCTTTCTTTGCTAATAGG - Intronic
1197376228 X:125685011-125685033 AAAGTCATCTCTCTGCTCACAGG - Intergenic
1201401596 Y:13609670-13609692 AACCTGTTTTCTCTCCTAAAGGG + Intergenic
1202576001 Y:26325797-26325819 AAACTAATTTCTGGGCTAACAGG - Intergenic