ID: 1083313519

View in Genome Browser
Species Human (GRCh38)
Location 11:61799330-61799352
Sequence GGCATTGCCTCATGAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083313519 Original CRISPR GGCATTGCCTCATGAATAGG AGG Intronic
902006694 1:13237896-13237918 GGCATATCCTGATGAACAGGGGG + Intergenic
905972754 1:42153954-42153976 GGCATTGCAAGATGAACAGGAGG + Intronic
906312031 1:44760954-44760976 TGCATTACCTGATGAAAAGGGGG + Intronic
907187649 1:52622686-52622708 GGTATTGGCTCATGGATAGAAGG + Intergenic
910525670 1:88175263-88175285 GTGATTGCTTCATGCATAGGTGG - Intergenic
911094952 1:94047559-94047581 GGCATTTCCTCATGAATTTCTGG + Intronic
913442071 1:118908630-118908652 GGCATTGTCTCTGCAATAGGAGG - Intronic
914694761 1:150067267-150067289 TTCATTGCGTCATTAATAGGCGG - Intergenic
923608309 1:235465681-235465703 TGCATTGCCTCATGAATTCTTGG - Exonic
924664940 1:246061861-246061883 TGCATTGCCTGATCAAGAGGTGG + Intronic
924920013 1:248619174-248619196 AGCTTTCCCTCATGAATATGAGG - Intergenic
1063700625 10:8381070-8381092 GGCAGTCCCTCAGGAAAAGGAGG + Intergenic
1069782528 10:70965762-70965784 GGCAGTGCCACATGAAAATGGGG - Intergenic
1074679735 10:115893053-115893075 GCCAATGCCTCAATAATAGGAGG + Intronic
1078276482 11:9852668-9852690 GGAATTACCTTCTGAATAGGCGG + Exonic
1080721474 11:34853475-34853497 GGCTTAGCCTCATGAGTAGCTGG + Intronic
1081599115 11:44480149-44480171 GGCATTGCTTGAGGAATGGGGGG + Intergenic
1081626006 11:44655540-44655562 TGCATTGCGTCATGCCTAGGAGG - Intergenic
1081684486 11:45032572-45032594 GGCATTGCATCCAGGATAGGTGG - Intergenic
1083313519 11:61799330-61799352 GGCATTGCCTCATGAATAGGAGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084419475 11:69053170-69053192 GGCAGTGGCTCCTGACTAGGAGG - Intronic
1087530875 11:99380652-99380674 AGCCTTGCCTCATGAGTAGCTGG - Intronic
1088424626 11:109689460-109689482 TGCATTGCCACATGAATATTAGG - Intergenic
1088452217 11:109994412-109994434 GGGATTTCCTGATGAATTGGAGG - Intergenic
1090642579 11:128741818-128741840 GCCATTGCCTCAGGAGAAGGTGG - Intronic
1091651874 12:2316587-2316609 GGCTTGGTCTCATGAATAGGTGG + Intronic
1096379140 12:51140705-51140727 GCCATAGCCTCCTGAATAGCTGG + Intronic
1099498619 12:83382976-83382998 AGCTTTGCCACATGAGTAGGTGG + Intergenic
1100498551 12:95150721-95150743 GGCTCAGCCTCCTGAATAGGTGG + Intronic
1102809509 12:115812297-115812319 GCCATGGCCTCATGATTGGGTGG - Intergenic
1103708271 12:122892226-122892248 GGAATTGCATAATGAACAGGAGG + Intronic
1106463558 13:29993483-29993505 GGCATGGCCTCATCAAGAAGAGG - Intergenic
1106783730 13:33086864-33086886 GGTATTGCCTGATGACTCGGAGG + Intergenic
1112705359 13:102061672-102061694 GTGATTGCCTCATGAATAGAAGG + Intronic
1113504926 13:110809434-110809456 GGCATTAGTTCATGAATAGAGGG + Intergenic
1114719782 14:24868899-24868921 TGCAATGCCTAATGAATTGGAGG + Intronic
1118474373 14:66102858-66102880 AGCTTTGCCTCATCAATATGAGG + Intergenic
1121685732 14:95833690-95833712 GGCATAGCAACATGAATAGCTGG - Intergenic
1126614088 15:50558776-50558798 GCCACTGCCTCTTGATTAGGTGG - Exonic
1130530327 15:84742566-84742588 GGCATAGCTTAATGAAGAGGAGG - Intergenic
1131997806 15:98148554-98148576 GGCATTGACTCAGGAATGAGTGG - Intergenic
1135242485 16:20820676-20820698 GCCTTAGCCTCCTGAATAGGTGG + Intronic
1135846276 16:25921489-25921511 GGCCTTGTCTCATTACTAGGAGG + Intronic
1137568460 16:49549206-49549228 GGCTTTGCCTGGTGAATGGGGGG + Intronic
1139066963 16:63328541-63328563 GGGATTCTATCATGAATAGGAGG + Intergenic
1139494196 16:67304147-67304169 GGCATTCCCTGATGAATAGGAGG + Intronic
1140520663 16:75578383-75578405 CGCCTTGCCTCCTGAATAGCTGG + Intergenic
1141357509 16:83362239-83362261 CAGATTGCCTCATGAATATGTGG - Intronic
1142318909 16:89368309-89368331 GCCATAGCCTCCTGAATAGCTGG + Intronic
1153845914 18:9049768-9049790 GCCATTTCCTCATCAAGAGGTGG - Intergenic
1154468208 18:14670263-14670285 GTCATAGCGTCATGAATAGCTGG + Intergenic
1162589858 19:11584340-11584362 GGCATGGGCTGCTGAATAGGTGG + Intronic
1165567772 19:36746463-36746485 AGCCTTGCCTCCTGAATAGCTGG + Exonic
1166403415 19:42501379-42501401 GGCTCAGCCTCCTGAATAGGTGG - Intergenic
925997255 2:9303593-9303615 GGCATGGCCTCATTTATAGTTGG + Intronic
927520955 2:23697733-23697755 GGCATTGCCACGTGAAAATGAGG + Intronic
928669549 2:33587274-33587296 GGCTTTCCCACATGATTAGGTGG + Exonic
929040473 2:37739506-37739528 GGCATTGCCACAGCAAAAGGAGG + Intergenic
931439287 2:62276594-62276616 GTCATTCCCTCATCAAGAGGTGG + Intergenic
933912902 2:86959846-86959868 GTCTCTGCCTCCTGAATAGGTGG + Intronic
934010093 2:87810044-87810066 GTCTCTGCCTCCTGAATAGGTGG - Intronic
935412457 2:102780301-102780323 GGCATTGCCTCATTAATTCCAGG + Intronic
935418617 2:102844172-102844194 GGCAGTCCCTCCTGAATGGGAGG + Intergenic
935773662 2:106450768-106450790 GTCTCTGCCTCCTGAATAGGTGG - Intronic
935906402 2:107845153-107845175 GTCTCTGCCTCCTGAATAGGTGG + Intronic
936128186 2:109810293-109810315 GTCTCTGCCTCCTGAATAGGTGG + Intronic
936216511 2:110561192-110561214 GTCTCTGCCTCCTGAATAGGTGG - Intronic
936425652 2:112415766-112415788 GTCTCTGCCTCCTGAATAGGTGG - Intronic
941362934 2:164574827-164574849 GGCTTAGCCTCTTGAATAGATGG - Intronic
943122032 2:183748598-183748620 AGCATTGCCTCAAGAAAGGGAGG + Intergenic
947125589 2:226865242-226865264 GGCTTTGCGTCTTGAAGAGGAGG + Intronic
1169787787 20:9378818-9378840 GTCATTTCCTCATGCATATGGGG - Intronic
1170167344 20:13375308-13375330 CGCATTTTCTCATGTATAGGTGG - Intergenic
1170423758 20:16218146-16218168 GGCATGGCCTTATGGAGAGGGGG - Intergenic
1171494406 20:25545428-25545450 GGCATGTCCTCATGTATGGGAGG + Intronic
1172156953 20:32833315-32833337 GAAATTGCCTCCTGAAGAGGAGG + Intronic
1176202148 20:63865896-63865918 GGGGTTGCCTCATGGAGAGGGGG + Intronic
1176806310 21:13487386-13487408 GTCATAGCGTCATGAATAGCTGG - Intergenic
1178924287 21:36762021-36762043 AGCATTTCCACATGAAGAGGAGG + Intronic
1181856263 22:25783593-25783615 AGCATTGCCTCCTGGAGAGGGGG + Intronic
1184295949 22:43525693-43525715 GGCATTTCCTGAGGAGTAGGTGG + Intergenic
1203292750 22_KI270736v1_random:11112-11134 GGCATTGCCACAGCAAAAGGAGG + Intergenic
958867317 3:99516317-99516339 TGAATTTCTTCATGAATAGGTGG - Intergenic
961255403 3:125546445-125546467 AGCCTTGCCTCCTGAATAGCTGG + Intronic
965700389 3:171454603-171454625 GGCATTGCCTCATAAAAAGTAGG - Intronic
967359394 3:188612306-188612328 GGCATTGGCTGATGAAAGGGTGG + Intronic
973708006 4:53599120-53599142 GGCAATTCATCTTGAATAGGGGG + Intronic
975715583 4:77202674-77202696 TGGAATTCCTCATGAATAGGTGG + Intronic
980841342 4:138264990-138265012 CGCATTTCCTCATTCATAGGTGG - Intergenic
982819050 4:159923770-159923792 GCCTTAGCCTCATGAATAGCTGG - Intergenic
983544141 4:168944361-168944383 GCCATAGCCTCCTGAATAGCTGG - Intronic
984873185 4:184345373-184345395 GGCATTGCGTCCTGGCTAGGTGG - Intergenic
986825377 5:11515127-11515149 CGCATTTCCTAATGAATGGGAGG + Intronic
987142413 5:14959779-14959801 TGCTTTGCCTCATAAACAGGCGG + Intergenic
991202360 5:64009116-64009138 GGCTTTGAATCATGAATAAGGGG - Intergenic
991962993 5:72064330-72064352 GCCATAGCCTCCTGAATAGCTGG + Intergenic
992425061 5:76648335-76648357 GGCACTGCCTCATTACTAGGAGG - Intronic
993433933 5:87867497-87867519 CACGTTGCCTCATGAATGGGTGG - Intergenic
1004643525 6:17538339-17538361 GGCTTAGCCTCCTGAATAGCTGG - Intronic
1005215572 6:23523432-23523454 GGCATTTCCTCATGTCTAGGCGG - Intergenic
1011041352 6:83033211-83033233 GGCATTCCCTCATGATCATGAGG + Intronic
1013761107 6:113518916-113518938 GGCATTACCTCAGGAATGTGAGG + Intergenic
1015130247 6:129801584-129801606 TGCATTGCCTCATGAATTATTGG + Intergenic
1017063852 6:150510424-150510446 TTCATTGACTCTTGAATAGGTGG - Intergenic
1018795501 6:167182117-167182139 GGCATTGACTCAGGAAGGGGTGG + Exonic
1018820820 6:167372946-167372968 GGCATTGACTCAGGAAGGGGTGG - Exonic
1019016511 6:168884342-168884364 GCCATTGGCACATGAAAAGGTGG + Intergenic
1020123773 7:5520983-5521005 AGCATTGCCTCCTGAGTAGCTGG + Intergenic
1021580675 7:22149480-22149502 GGGATTGGCTTCTGAATAGGAGG - Intronic
1024979528 7:55145661-55145683 GGCATTGCTTCATGAATCAGAGG + Intronic
1028956281 7:96696239-96696261 GGAACTGGCTCATGAAGAGGGGG + Intronic
1034089600 7:148351626-148351648 GCCATAGCCTCCTGAGTAGGTGG - Intronic
1035271160 7:157720778-157720800 GGCTTTGCCACAGGAATGGGTGG - Intronic
1036608868 8:10332778-10332800 GGCATTTGTTCATTAATAGGGGG + Intronic
1037519151 8:19662847-19662869 GGCATGACCTCCTGAATGGGGGG - Intronic
1039057286 8:33546903-33546925 GCCTTAGCCTCATGAATAGCTGG - Intergenic
1041217052 8:55611136-55611158 GGCATGGCCTTATGAAAGGGTGG + Intergenic
1046413133 8:113875350-113875372 TGCATGGTCTCATGTATAGGTGG - Intergenic
1051600387 9:18866660-18866682 GACATTGCCTCAGGAATGAGAGG + Intronic
1058986646 9:110214100-110214122 GCCATTCCCTCATCAAGAGGTGG + Intergenic
1059524771 9:114980445-114980467 GGAATTGCCTTATGATAAGGTGG + Intergenic
1059651328 9:116318857-116318879 GGCTGGGCCTCAAGAATAGGAGG - Intronic
1062067118 9:134534519-134534541 GGGACAGCCTCATGAAGAGGAGG + Intergenic
1186664063 X:11700610-11700632 GTCATTGACTCCTAAATAGGGGG + Intergenic
1186863727 X:13698444-13698466 AGCATTACCTCAAGAACAGGAGG - Intronic
1190306995 X:49089670-49089692 GCCATAGCCTCCTGAGTAGGTGG - Intronic
1194403795 X:93468811-93468833 GGCCTTGCCTGATGAAGAGCGGG - Intergenic
1195897832 X:109765890-109765912 GGCATTGCCTAATGATAAAGGGG + Intergenic
1196701914 X:118679039-118679061 GTCTTAGCCTCCTGAATAGGTGG + Intronic
1198104108 X:133446398-133446420 GGCACAGCCTCATGAGTAGCTGG + Intergenic
1200750480 Y:6940145-6940167 GCCTCGGCCTCATGAATAGGTGG - Intronic