ID: 1083313874

View in Genome Browser
Species Human (GRCh38)
Location 11:61802301-61802323
Sequence TTTAATACTCAGAGGGGGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083313874_1083313883 16 Left 1083313874 11:61802301-61802323 CCCAACCCCCTCTGAGTATTAAA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1083313883 11:61802340-61802362 CCTCAAGCTCCCCTCTGCCTTGG 0: 1
1: 0
2: 4
3: 56
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083313874 Original CRISPR TTTAATACTCAGAGGGGGTT GGG (reversed) Exonic
900023426 1:200390-200412 TTTAATTCTTAAAGGGGGGTGGG - Intergenic
902894620 1:19470651-19470673 TTTACTGCTCACAGGGGTTTGGG - Intronic
904771961 1:32885878-32885900 ATTAATTCTGAGAGGGGGGTCGG + Intergenic
908823680 1:68113727-68113749 TTTCTTACTCAGAAGGGCTTGGG - Intronic
909136106 1:71802518-71802540 TTTACTTCTCAGAGAGGGTGGGG + Intronic
910362459 1:86427221-86427243 TGGAATACTCAGAGGCTGTTTGG - Intronic
919110423 1:193212227-193212249 TTTAATAATCAGTGTGGCTTGGG - Intronic
920795660 1:209133844-209133866 TTTAAAACTCCGAGGGGGCTCGG + Intergenic
922232418 1:223698660-223698682 TTTAATTGTGAGTGGGGGTTGGG + Intergenic
923511869 1:234659935-234659957 TGTAATACATAGAGGGGGCTTGG - Intergenic
1063054215 10:2485499-2485521 TTTAAAACCCAGGGTGGGTTAGG - Intergenic
1063334754 10:5200764-5200786 TTCAAGACTCAGTGTGGGTTAGG - Intronic
1064960491 10:20958565-20958587 ATTAATATTCAGATGGGGTTTGG - Intronic
1066635667 10:37496611-37496633 GTTAATACTTTGAGGGGGTTTGG + Intergenic
1068834620 10:61540285-61540307 TTTGATATTCAGTGGGGGTGAGG + Intergenic
1070497132 10:77034826-77034848 TTTACAGCTCAGAGGGGATTAGG - Intronic
1070745425 10:78930897-78930919 TTTAATGAACAGAGGTGGTTAGG - Intergenic
1071779032 10:88822381-88822403 CTCAATACTCAAAGGGGGCTGGG + Exonic
1074520859 10:114222478-114222500 TTTAATACACAAAGGGTTTTTGG + Intronic
1077605707 11:3610120-3610142 TTTAATATACAGATAGGGTTAGG - Intergenic
1079889178 11:26029020-26029042 TTTACTACTCAGAGGAAGATTGG + Intergenic
1080221698 11:29913434-29913456 TTTATTACTGAGAAGGTGTTAGG - Intergenic
1081451188 11:43172147-43172169 TTTAATATTCAGTGGGGGAGAGG + Intergenic
1083271967 11:61577225-61577247 TCTAAAACCCAGAGGGGGTGAGG - Intronic
1083313874 11:61802301-61802323 TTTAATACTCAGAGGGGGTTGGG - Exonic
1087915834 11:103809850-103809872 TCTTATACTCAGATGGGGCTTGG - Intergenic
1089481463 11:118808613-118808635 TTTGATGCTCAGAGTTGGTTAGG - Intergenic
1089530260 11:119123444-119123466 TGTAATAGTCAGAGGAGGTGTGG + Intronic
1091377125 12:31928-31950 TTTAATTCTTAAAGGGGGGTGGG - Intergenic
1096278072 12:50227811-50227833 ATAAATACTCAGAGTGGGCTGGG - Intronic
1098479489 12:70942540-70942562 TTTAATACCCAGAGGGTGATAGG - Intergenic
1099280673 12:80641751-80641773 TTCCAGACTCAGAGGCGGTTTGG + Intronic
1101217620 12:102600560-102600582 TGTAATACTCAGCCTGGGTTTGG + Intergenic
1103204001 12:119114040-119114062 TTTAATAATCAGTTGGTGTTTGG + Intronic
1106580134 13:31010595-31010617 TTTAATACTCACTGGGGGAAGGG + Intergenic
1107516565 13:41135095-41135117 TTTTCTACTCAGATGGGCTTTGG + Intergenic
1107715209 13:43192977-43192999 TTTAATACTCAGCAAGGGCTTGG + Intergenic
1107722998 13:43268715-43268737 TTGATTACTCACAGAGGGTTGGG + Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1109186394 13:59273844-59273866 TTTAATACTTCGAGGGGGTGGGG - Intergenic
1109360531 13:61289561-61289583 TTGAATTCACAGAGGGAGTTTGG + Intergenic
1111810722 13:93093267-93093289 TTTAATATTCAGTGGGGGAGAGG + Intergenic
1116041860 14:39695352-39695374 TTTAATCCTGAGAGGGAGATTGG + Intergenic
1116517043 14:45816311-45816333 TTTAATATCCAGAGGGGGAGAGG + Intergenic
1116517181 14:45817192-45817214 TCTAATGTTCAGAGGGGGATAGG - Intergenic
1116724247 14:48542014-48542036 TTTAAAACTCAGATGAGGTCAGG - Intergenic
1119273941 14:73335562-73335584 TTTCTTACTCAGAAGGAGTTTGG - Intronic
1123788234 15:23693653-23693675 TTTAAAACTCAGACTGGGTGTGG - Intergenic
1123799035 15:23802580-23802602 TTTAATCCTCAGTGTGGGATGGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125996481 15:44165872-44165894 TTTAATACTCAGAGGCTGAGTGG - Intronic
1127734608 15:61829477-61829499 ATTAGTACTAAGAGGGGGCTCGG - Intergenic
1127746806 15:61985550-61985572 TTTAAAACTAAGAGAGGGCTGGG - Intronic
1130188768 15:81711927-81711949 TTTAATATTCAGTGGGGGAGAGG + Intergenic
1133991049 16:10707870-10707892 TTTAATATTCAGAGGGGTCGTGG - Intergenic
1133992185 16:10717263-10717285 TTTAATATCCAGAGGGGGAGGGG - Intergenic
1140612428 16:76617627-76617649 TTTAAAACTCAAAGAGTGTTTGG - Intronic
1147640707 17:41997291-41997313 TTGAAAACTTAGAGGGGGCTGGG + Intronic
1149263717 17:54905268-54905290 TTTGATTCTCATAAGGGGTTAGG + Intronic
1152382086 17:79947313-79947335 TCTAAGGCTCAGAGGGGGCTGGG + Intronic
1155209008 18:23585371-23585393 TTTAGTTCTCAGAAGGGGATAGG - Intronic
1158892144 18:61882774-61882796 TGTAATACCAAGTGGGGGTTGGG - Intronic
1159888205 18:73930161-73930183 TTTTATCTTCAGAGGGTGTTTGG + Intergenic
1162310545 19:9904484-9904506 TATAATACTCAGACTGGGCTGGG - Intronic
1165534426 19:36431468-36431490 ATTAACACACAGAGGGGGTTGGG + Intergenic
929736833 2:44558533-44558555 ATTAATTCTCAGAGGTGGATTGG + Intronic
930229002 2:48824862-48824884 TTTAATACTGAAAGGGGGGCAGG - Intergenic
930265016 2:49189497-49189519 TTCAATTGTCAGAGGGGATTAGG - Intergenic
930517690 2:52429242-52429264 GTTAATACTGAGATGGGGTAGGG + Intergenic
931158568 2:59663278-59663300 TTTAATACTGAGAAAGTGTTCGG + Intergenic
932676375 2:73785136-73785158 TTTAAGACTCAGCCAGGGTTGGG + Intronic
932676961 2:73790037-73790059 TTTAAGACTCAGCCAGGGTTGGG + Intronic
932677546 2:73794934-73794956 TTTAAGACTCAGCCAGGGTTGGG + Intronic
932678132 2:73799832-73799854 TTTAAGACTCAGCCAGGGTTGGG + Intronic
932678718 2:73804732-73804754 TTTAAGACTCAGCCAGGGTTGGG + Intronic
932679295 2:73809631-73809653 TTTAAAACTCAGCCAGGGTTGGG + Intronic
936566024 2:113583566-113583588 TTTAATTCTTAAAGGGGGGTGGG + Intergenic
937000653 2:118464244-118464266 TTTAATACTCAGCTGTGGCTGGG - Intergenic
941533496 2:166696192-166696214 TTTAATATTCAGTGGGGGAGAGG + Intergenic
943041942 2:182814431-182814453 TTGAAAGCTCAGAAGGGGTTGGG - Intergenic
945937517 2:215917988-215918010 TTTCATATTCAGAGGGGTTCTGG - Intergenic
947676438 2:231985259-231985281 TTTAGTGCTTAGATGGGGTTAGG - Intronic
1170098510 20:12673061-12673083 TTTAAAACTCAGAGGGGCACTGG + Intergenic
1173085305 20:39910397-39910419 TTTCATACTCTGAGAAGGTTTGG + Intergenic
1174107148 20:48170857-48170879 ATTGATACTCAGAGAGGGTAAGG - Intergenic
1175386178 20:58596846-58596868 TTGAAGACTCAGAGGCGGTGAGG - Intergenic
1177276988 21:18924633-18924655 TATAATACTGAGAGGGCATTAGG + Intergenic
1178793783 21:35724245-35724267 ATTAAAACTCAGAGGAGGCTGGG - Intronic
1178978080 21:37237687-37237709 TTAAACACTCACAGGGGTTTGGG + Intronic
1179308558 21:40176688-40176710 TTTAATATTCAGAGGAGCTAAGG - Intronic
1182376082 22:29849072-29849094 GTTTAAATTCAGAGGGGGTTGGG + Intergenic
949761729 3:7478541-7478563 TTTAATAATCAGTGAGAGTTAGG + Intronic
955012153 3:55028402-55028424 TTTAATAATCAGTGGGGTATTGG - Intronic
957441998 3:80260660-80260682 TATAATATTCAGTGGGAGTTTGG - Intergenic
964012982 3:151912998-151913020 TTAAATAATCAGAGTGGGCTGGG - Intergenic
970031531 4:11680824-11680846 TATAATACTCAGAAGGGGATAGG - Intergenic
970431271 4:15991029-15991051 TTCAAGGCTCAGAGGGGTTTGGG + Intronic
973624746 4:52760024-52760046 TTTAATAATCAGAGCTTGTTAGG - Intergenic
975430103 4:74279593-74279615 TATAATAATCAGAGGGAGATTGG + Intronic
979623511 4:122821760-122821782 TTAAATACTCACAGGAGGCTGGG - Intergenic
980323524 4:131309838-131309860 TTTCAAACTCAGTGGGGGTTGGG + Intergenic
982172874 4:152678740-152678762 TTTAGTGTTCAGAGTGGGTTTGG - Intronic
984545959 4:181102820-181102842 TAAAATACTAAGAAGGGGTTGGG + Intergenic
994722391 5:103395309-103395331 TTTAATTCTCACTGGGTGTTGGG + Intergenic
996416908 5:123220424-123220446 TTAAATGGTCAGAGGGGTTTTGG + Intergenic
998935925 5:147231575-147231597 TTTAATATTCAGTGGGGGAGAGG + Intergenic
1005066905 6:21827168-21827190 TTTAATATGCAGGGTGGGTTGGG + Intergenic
1006972003 6:38055285-38055307 ATTTATAGTCAGATGGGGTTTGG + Intronic
1009225330 6:61015785-61015807 TTTAATATTCAGAGGGGTATAGG - Intergenic
1009362703 6:62835136-62835158 TTTAATATTCAGAGGGGGAGAGG + Intergenic
1009368998 6:62878441-62878463 TTTAATATTCAGAGGGGGAGAGG + Intergenic
1012444881 6:99297281-99297303 GTTAGTACTCAGTGGGGGTGAGG - Intronic
1012775306 6:103488694-103488716 CTTAATAATCAGAGGGGGAGAGG + Intergenic
1014143306 6:117968623-117968645 TTGTATACTCAGAAGTGGTTTGG + Intronic
1014150350 6:118047757-118047779 TTTACTACTTAGTGGTGGTTGGG + Intronic
1015614333 6:135059398-135059420 TTAAATACTCATATGAGGTTTGG + Intronic
1021039103 7:15839446-15839468 TTTTTTACTCAGTAGGGGTTTGG + Intergenic
1022040602 7:26577955-26577977 TTAAATGCTCAAAGAGGGTTAGG - Intergenic
1022606893 7:31824300-31824322 TATAATACTCAGAGGTGACTGGG - Intronic
1023405664 7:39831172-39831194 TTAAATACTAAGAGGGTGTGTGG + Intergenic
1025938406 7:66055725-66055747 TTTAACACTCAGAGGCCATTAGG - Intergenic
1028437223 7:90817985-90818007 TTTAAGAGTCAGATGGGCTTAGG - Intronic
1028457609 7:91055686-91055708 TTTAATACTCTTAGGTGGGTTGG - Intronic
1029268226 7:99359138-99359160 TTTAAGAGTAAGAGGGGGTGGGG + Intronic
1034479068 7:151305958-151305980 TTCAACACTCTGAGGGGGCTGGG - Intergenic
1035094698 7:156344095-156344117 TTTAGTACACAGAGGGTGTGGGG + Intergenic
1038929751 8:32179680-32179702 TTTAATATTCAGAAAGTGTTTGG + Intronic
1039387450 8:37148651-37148673 TTTAATCCTCAGTGGATGTTGGG - Intergenic
1040098927 8:43479817-43479839 TTTAATACTTAGTGGGCATTTGG + Intergenic
1041558742 8:59190013-59190035 TTTAATACTCTCAGGATGTTAGG - Intergenic
1044792410 8:95861581-95861603 TTTAATGCTGAGAGGAGGTGGGG + Intergenic
1045926969 8:107585889-107585911 TCTAATAATCAGAGGGGGAGAGG - Intergenic
1047386386 8:124413784-124413806 TTAAATACTGACAGGGTGTTTGG + Intergenic
1047768623 8:128011930-128011952 ATTACTACTGAGAGGGGGTGGGG + Intergenic
1051233197 9:14973903-14973925 TGTAATATTCAGAGGGGGAGAGG - Intergenic
1057419833 9:94902428-94902450 TCTAGTCCTCAGAGGGGGTGTGG - Intronic
1061441720 9:130609274-130609296 TTTAATAATAAGAGGCTGTTTGG + Intronic
1186561451 X:10618016-10618038 TATAAGATTCAGAGGGGTTTGGG - Intronic
1190869298 X:54411748-54411770 TTTAACACTCAGTGTGGCTTTGG + Intergenic
1190974830 X:55389127-55389149 TTTAGTTCTCAGAAAGGGTTTGG - Intergenic
1191669576 X:63736464-63736486 TCTTATACTCAGAGGTGGTCAGG + Intronic
1193660313 X:84249266-84249288 TTAAATGCTCAGAGGGGAGTTGG - Intergenic
1194613096 X:96067635-96067657 TTAAAGACTGAGAAGGGGTTAGG - Intergenic
1195283154 X:103356843-103356865 TTTAAGACTGAGGCGGGGTTCGG - Intronic
1195427944 X:104756440-104756462 TTTAATAGCCATAGGGAGTTGGG + Intronic
1201955489 Y:19618092-19618114 TTTCTTAGTCAGAGGGGGTTGGG - Intergenic