ID: 1083314281

View in Genome Browser
Species Human (GRCh38)
Location 11:61804727-61804749
Sequence CTGGAAGTAGAGAGGCAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 475}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083314275_1083314281 20 Left 1083314275 11:61804684-61804706 CCACCCACTTCTTTCGCTGGATA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG 0: 1
1: 0
2: 4
3: 54
4: 475
1083314277_1083314281 16 Left 1083314277 11:61804688-61804710 CCACTTCTTTCGCTGGATAACAA 0: 1
1: 0
2: 1
3: 13
4: 97
Right 1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG 0: 1
1: 0
2: 4
3: 54
4: 475
1083314276_1083314281 17 Left 1083314276 11:61804687-61804709 CCCACTTCTTTCGCTGGATAACA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG 0: 1
1: 0
2: 4
3: 54
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083314281 Original CRISPR CTGGAAGTAGAGAGGCAGCA AGG Exonic
900188536 1:1343835-1343857 CAGGACCTAGAGGGGCAGCAGGG + Intronic
900474709 1:2870641-2870663 CTGGAAGTAGACAGGCTCCCTGG + Intergenic
900911789 1:5601790-5601812 CGGGATGTGGAGACGCAGCATGG + Intergenic
900941328 1:5800448-5800470 CTGGTAGGAGAGGGGCAGGAAGG - Intergenic
901037664 1:6346056-6346078 CTGGAAGCAGAGAGGGAGCCAGG + Intronic
901726527 1:11247226-11247248 CTGCAAGTGGTGAGGCAGCTTGG + Intronic
901871995 1:12143554-12143576 GTGGATGTCGAGAGGCACCACGG + Exonic
902479067 1:16702225-16702247 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
902643808 1:17783948-17783970 CTGCAATTTGAGAGGCAGAATGG - Intronic
902932207 1:19739670-19739692 CTTGAACTGGAGAGGCAGCAAGG + Intronic
903168937 1:21540313-21540335 GTGGCAGGAGAGAAGCAGCAGGG - Intronic
904248352 1:29204297-29204319 CTGGTTTTTGAGAGGCAGCAGGG + Intronic
904503400 1:30930881-30930903 CTGGAAGTGGAGCGTCAGGATGG - Intergenic
904587473 1:31588222-31588244 CGGGCATTTGAGAGGCAGCAAGG - Intergenic
905117826 1:35657899-35657921 CTGGAACTAGAAAGTCATCATGG + Intergenic
905514312 1:38550632-38550654 CTGGAAGCAGAGGGGCAGTGGGG + Intergenic
905615165 1:39391962-39391984 CTGGAAGAAGAGTGGGAGAAGGG + Intronic
905648948 1:39643832-39643854 CAGGAACAAGAGAGGAAGCAGGG - Intergenic
906243141 1:44254677-44254699 CTGGAAGTAGGAAGGCATTAGGG - Intronic
906454870 1:45985948-45985970 CTGGAATAAGAGAGTTAGCAAGG - Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906529221 1:46513612-46513634 CTGGATGGAGAGCAGCAGCAGGG + Exonic
907118494 1:51989924-51989946 TGGGAAGGAGAAAGGCAGCAGGG - Intronic
907536023 1:55158100-55158122 ATGCAGGTAGAGAGGCAGCAAGG + Intronic
907605691 1:55815240-55815262 CTGGAAGTTCAGGAGCAGCATGG - Intergenic
907786844 1:57620799-57620821 CTGGAAGCAGGGGGGCAGCGCGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
910053859 1:83008473-83008495 GTGGAAGGAGAGAGGGAGGAAGG - Intergenic
910112436 1:83696983-83697005 CTGGAAGTGGAGAGGTAACCTGG - Intergenic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
911725791 1:101239562-101239584 CTTGTGGTAGAGCGGCAGCACGG - Exonic
911758814 1:101592188-101592210 GGGGAAGTGAAGAGGCAGCAGGG - Intergenic
912173856 1:107134411-107134433 GAGGAAATAGAAAGGCAGCAAGG + Intergenic
912402392 1:109405911-109405933 CTGGAAGTAGGGATGGAGAAGGG + Intronic
912951395 1:114123039-114123061 CTGGAAGCAAAAAGGCAGGAAGG - Intronic
914720072 1:150282353-150282375 CAGCCAGTAGAGAGGCAGCCAGG - Intergenic
915008402 1:152662285-152662307 CAGGAAGTAGAGGGTCAGCCAGG - Intergenic
915009679 1:152674172-152674194 CAGGAAGTAGAGGGTCAGCCAGG - Intergenic
915079185 1:153339929-153339951 CTAGAAGCAGAGAAGCAGCACGG + Intronic
915797184 1:158748298-158748320 CGGGAAGAAGAAAGGCAGTATGG - Intergenic
916021748 1:160798683-160798705 CTGGAAGGAGAGAGGCTGCTTGG - Intronic
916463251 1:165048071-165048093 CCGGAAGGAGAGAGGAAGAAGGG + Intergenic
916801622 1:168221497-168221519 CTGGAAGTAGAGGGGAGGCCTGG + Intergenic
918519940 1:185404335-185404357 CTGGAAGTCGAGAGGATGCCGGG + Intergenic
918679170 1:187329844-187329866 CTGGAAGCAGAGGGTTAGCAGGG + Intergenic
919391958 1:196996927-196996949 CTGGAAGTCCTGAGGCTGCAAGG - Intronic
919920479 1:202163986-202164008 CAGGAAGCAGGGAGACAGCAGGG + Intergenic
920198048 1:204242703-204242725 GTGGAGGCAGAGAGACAGCATGG + Intronic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920528995 1:206688054-206688076 GTGGAGGGAGAGAAGCAGCAGGG - Intronic
920647487 1:207814179-207814201 CTGGGAGTCAGGAGGCAGCATGG - Intergenic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
921304183 1:213779370-213779392 CAGGAGTTAGATAGGCAGCAGGG - Intergenic
921718804 1:218448109-218448131 ATAGAAGTAGAAAGGCAGGAGGG + Intergenic
921996021 1:221419245-221419267 CTGGAAGTAGAGAGTGAGAAAGG - Intergenic
923096374 1:230778339-230778361 GTGGAAGCAGAGAGGCAGCTAGG - Intronic
923178200 1:231489704-231489726 ATGGAAATAAAGAGGGAGCAGGG + Intergenic
923363228 1:233233711-233233733 CTTGAAGGAGAGAGGCAGGGAGG + Intronic
923765373 1:236888212-236888234 CAGGAAGTAGAGAGACAGGAAGG + Intronic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1065526668 10:26629150-26629172 CTGGAACTAGAGAGCAAGCGGGG + Intergenic
1066012730 10:31209442-31209464 CTGGCAGCAGAGAGGGAGAAAGG - Intergenic
1067191812 10:44076853-44076875 CTAGAAGAAGAGAGGGATCATGG - Intergenic
1067845126 10:49713499-49713521 GTGGCAGTAGAGAAGCTGCAAGG + Intergenic
1069216316 10:65825784-65825806 CAGGAAGTCTGGAGGCAGCAGGG + Intergenic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1070004293 10:72408038-72408060 CTGCAAGAGGAGAGACAGCAAGG + Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1071074300 10:81732720-81732742 CTGGATGTTGAGAGCCATCAAGG + Intergenic
1071299455 10:84245367-84245389 CTGGGAGCAGAGAGGAAGCCAGG + Intronic
1071496486 10:86170830-86170852 CTGAAAATAGACAGGAAGCACGG - Intronic
1072617676 10:97060264-97060286 CTGGAAGTGGGAAGGGAGCAGGG - Intronic
1072945166 10:99803461-99803483 ATGGAAGGAGAGAGGGAGGAAGG - Intronic
1073177093 10:101563292-101563314 CTGGGAGTAGAGAGGCTCCATGG - Intergenic
1074695871 10:116049876-116049898 GTGAAAGTAGAGAGGTAGCTTGG + Intergenic
1075709570 10:124523354-124523376 CTGGAAGACGAGGGGCTGCAGGG + Intronic
1075984445 10:126771528-126771550 CTGGAAGAAGATGAGCAGCAGGG - Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076237091 10:128871774-128871796 CTGGAAGTGGAGTGGAAGCCAGG + Intergenic
1076456845 10:130606017-130606039 CAGGAAGGAGAGAGGCAGACAGG + Intergenic
1076598910 10:131644528-131644550 CTGCCGGTGGAGAGGCAGCACGG + Intergenic
1076995248 11:294533-294555 CTGCAGGGAGAGAGGCAGCCTGG - Intronic
1077268693 11:1665155-1665177 CTGGAATTAGAGGGACATCAAGG + Intergenic
1077272082 11:1686148-1686170 CTGGAATTAGAGGGACATCAAGG - Intergenic
1078538737 11:12196616-12196638 CTAGAGGTAGAGAGGCAGTCAGG - Intronic
1078861322 11:15249786-15249808 GTGTAGGTAGAGAGTCAGCAGGG - Intergenic
1078909740 11:15719699-15719721 CTGGAATTAGGGAGCCAGCTGGG + Intergenic
1079281484 11:19090776-19090798 CTGGAAGCATAGAGGCAGATTGG - Intergenic
1081438979 11:43059501-43059523 CTGGGAGTAGATAGGCTACAGGG - Intergenic
1081724916 11:45321401-45321423 CTGGCGGAAGAGAGGCATCAAGG - Intergenic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083621453 11:64051363-64051385 CACGAGCTAGAGAGGCAGCAGGG + Intronic
1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG + Intergenic
1083732287 11:64659092-64659114 CTGGACCTAGAGGGGAAGCAGGG - Intronic
1083821176 11:65172256-65172278 CTGGAAGTAGACCAGCACCATGG - Exonic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084092309 11:66886646-66886668 TGGGAGGCAGAGAGGCAGCAGGG + Intronic
1084729540 11:71064581-71064603 CTGGAAGGAAAGAGGCTGGATGG + Intronic
1084870241 11:72093787-72093809 AAGGAAGTAATGAGGCAGCATGG + Intronic
1086917307 11:92545704-92545726 ATGGAAGCAGAGAGACAGCCAGG + Intronic
1088325660 11:108598399-108598421 CTGGAAATGCAGAGGCACCAAGG + Intergenic
1089160273 11:116432035-116432057 CTGGCAGAGGGGAGGCAGCATGG - Intergenic
1089270236 11:117296881-117296903 CTGGTAGTAGCGATGCAGGAAGG + Exonic
1089417515 11:118304697-118304719 CAGGAAGTAGAGAGGCCTCTGGG - Exonic
1089785287 11:120903205-120903227 CTGGATGCAGACAGGCAGCTGGG - Intronic
1089969614 11:122682292-122682314 CTGGACGGTGAGAGGCAGCTTGG - Intronic
1090655975 11:128845895-128845917 CTGGAAGGAGGGAGGCACCTAGG - Intronic
1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG + Intergenic
1092109164 12:5946597-5946619 CTGGAAGTAGACAGGGAGAAAGG - Intergenic
1092110836 12:5963414-5963436 CTGAAATTAGAGAAGCAGTAAGG + Intronic
1093816374 12:23553524-23553546 GTGGAAGAAGGGAGGCAGGAGGG + Intronic
1094098890 12:26739635-26739657 CTGGAAGTGGGGTGGAAGCAAGG + Intronic
1094317158 12:29147261-29147283 CTGGAAGTAGGTAAGCATCATGG + Intergenic
1094396931 12:30016999-30017021 CTGCGAGAAGAGAGGCAGAAAGG - Intergenic
1094753494 12:33439794-33439816 CTGGAACTAGAGACCCGGCATGG + Exonic
1095154012 12:38830894-38830916 CTAGAAGCAGAGAGGCAGCATGG - Intronic
1096504609 12:52084855-52084877 CTGGAAGTAGAGAGGAGGCAAGG + Intergenic
1096917036 12:55044498-55044520 ATGGAAGCAGAGGGGCAGCTGGG - Intergenic
1097071119 12:56355653-56355675 CCTGAAGTAGAGAGGAACCATGG - Intronic
1097942909 12:65331878-65331900 CTGGAAGCAGAGAAACTGCATGG + Intronic
1097971807 12:65640902-65640924 CTGGAGCTAGAGAAGCGGCAGGG - Intergenic
1099411081 12:82328992-82329014 CGGAGAGGAGAGAGGCAGCAGGG + Intronic
1100310556 12:93391093-93391115 CTGGCAGCAGGGAGGGAGCAGGG + Intronic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1101525437 12:105524209-105524231 CTTCAAGCAGAGAAGCAGCATGG + Intergenic
1101765318 12:107692949-107692971 CTAGAAGCAGAGAGCCAGTAAGG - Intronic
1103990464 12:124795643-124795665 GTGGAGGTTGAGAGGGAGCATGG - Intronic
1104073881 12:125372658-125372680 TTGGAAGTAGAAAGGCAGCTGGG + Intronic
1104486858 12:129158913-129158935 GTGGCAGGAGAGAGGAAGCAAGG + Intronic
1104638958 12:130455155-130455177 CGGGAGGGAGAGAGACAGCATGG + Intronic
1104659073 12:130596189-130596211 CTGGAAGCAGGTAGGCAGGAAGG + Intronic
1105309254 13:19191661-19191683 CTGGAATTTGAGAAGGAGCAGGG + Intergenic
1106191641 13:27458786-27458808 CTGGAATTAGAAAGGTAGAAAGG - Intergenic
1106448997 13:29862872-29862894 CTGGATGTAGGGAGGCACCATGG - Intergenic
1106607439 13:31242173-31242195 CTGCAAGTCAGGAGGCAGCAAGG - Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108246340 13:48518015-48518037 CTGGAAGTCAAGGAGCAGCAAGG + Intronic
1111790791 13:92852072-92852094 CAGGAAGTCCAGAGGCATCAGGG + Intronic
1112065756 13:95790908-95790930 TTGGATGCAGAGAGCCAGCAAGG + Exonic
1112917946 13:104574109-104574131 CTGGCAGTAGAAAGGGAACAGGG + Intergenic
1113635032 13:111913532-111913554 GTGGCGGAAGAGAGGCAGCATGG - Intergenic
1113637132 13:111927330-111927352 CTGGGAGCAGACGGGCAGCAGGG - Intergenic
1114366167 14:22029112-22029134 TGGGAAGTTCAGAGGCAGCAGGG + Intergenic
1114476252 14:22997151-22997173 CTGGAAGGTGGGAGGCAGAAAGG - Intronic
1114489515 14:23090028-23090050 CTGAAAGTCAGGAGGCAGCAGGG + Exonic
1114629913 14:24152242-24152264 CTGGAAGTGGAGGGGTTGCAGGG - Intronic
1114658371 14:24329534-24329556 CTGGAAGGAGGGAGGCAGTAGGG + Intronic
1115761262 14:36580892-36580914 CTGGAACTGGTGAGGCCGCAGGG - Exonic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117141913 14:52797740-52797762 GTGGAAGGTGAGAGGAAGCAAGG + Intergenic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1118885257 14:69860460-69860482 CTGGAAATAGTGAGGCGGGAAGG + Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1120444931 14:84582642-84582664 AAGGAAGGAGAGAGGGAGCAAGG + Intergenic
1120951453 14:90045813-90045835 CTGGAAATGGAGACTCAGCACGG - Intergenic
1121959990 14:98250557-98250579 CCAGAAGTGGAGAGACAGCAAGG - Intergenic
1122652106 14:103231694-103231716 CAGGAAGTAGGGGGACAGCAGGG + Intergenic
1122695266 14:103549350-103549372 CTGGGCCTAGAGAGGCACCAGGG - Intergenic
1122781220 14:104144387-104144409 CTGGCAGCAGAGAGGCAGTGAGG - Intronic
1123189004 14:106550072-106550094 ATGGCAGGAGAGAGACAGCAAGG - Intergenic
1123922830 15:25082565-25082587 TAGGAAGTACAGAGGCAACACGG - Intergenic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1128134845 15:65255196-65255218 CTGGGAATGGAGAGGCAGGAAGG - Intronic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128609978 15:69065586-69065608 CATGAAGGAGAGAGGAAGCAAGG + Intergenic
1128686530 15:69690398-69690420 CTGGCAGTAGTCAGGCTGCAAGG - Intergenic
1128938304 15:71766994-71767016 CTGACCGTAGAGGGGCAGCATGG + Intronic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129460853 15:75699515-75699537 CTGGAAGATGAGTGGAAGCAGGG + Intronic
1129723962 15:77892202-77892224 CTGGAAGATGAGTGGAAGCAGGG - Intergenic
1129786713 15:78314553-78314575 CTGGAGGTAGAGATTCAGAAGGG + Intergenic
1130300956 15:82679801-82679823 CTGGCACAAGAGAGGCAGCTAGG + Intronic
1130568427 15:85019053-85019075 ATGGAAGCAGGGAGGCAGCAAGG - Intronic
1130600962 15:85272880-85272902 TTGGAAGAAGCCAGGCAGCATGG + Intergenic
1130742938 15:86620666-86620688 CAGAAAGTAGAAATGCAGCAGGG - Intronic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1131512089 15:93055068-93055090 CTGGAATTAGTGAGGCTGCCGGG - Intronic
1131759407 15:95603899-95603921 CAGGAAGTTTGGAGGCAGCATGG - Intergenic
1132958919 16:2611642-2611664 CTGGAAGGACGGAGGCAGGAGGG - Intergenic
1133393219 16:5425966-5425988 CTGGAAGGAGAGAGTGTGCAGGG + Intergenic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1136687279 16:32002856-32002878 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1136881890 16:33907382-33907404 CTGGGAGTGGGGAGGCAGGAGGG - Intergenic
1137616818 16:49853598-49853620 TTGGTAGGAGAAAGGCAGCAAGG - Intronic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138538442 16:57673267-57673289 CTGGACGAAGATGGGCAGCAAGG - Intronic
1138770993 16:59663654-59663676 GTGAAAGCAGAGAGGCAGTAAGG - Intergenic
1139609614 16:68046185-68046207 CAGGAAGCAGAGAGGAGGCAAGG - Intronic
1140330336 16:74050168-74050190 CTTGAAGTTGAGAGGGGGCAGGG - Intergenic
1140969826 16:80002090-80002112 TTGGAAGTTGAGAAGAAGCATGG - Intergenic
1141450009 16:84092907-84092929 CTGGAGGTAGAGAAGAAACAAGG + Intronic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1203090121 16_KI270728v1_random:1208064-1208086 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1142599233 17:1045257-1045279 CTGGAATTAGGGAGGCTTCAAGG - Intronic
1143107223 17:4535868-4535890 CTGGCAGGAGAGAAGCAGCCAGG + Intronic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1144130404 17:12241373-12241395 TTGGAAGTATAGAGGCAACATGG + Intergenic
1144378235 17:14666960-14666982 CTGGAAGCAGAGGGACAGAAAGG - Intergenic
1144945451 17:18967349-18967371 CAGGAAGGAGGGAGGCAGGAGGG + Intronic
1145967707 17:28932064-28932086 CTTGAAGCAGAGAGGAAACATGG - Intronic
1146799206 17:35805221-35805243 GTGGAAGAAGAGAGGAAGAAAGG - Intronic
1147218043 17:38912322-38912344 GAGGAAGGAGAGAGGGAGCAAGG + Intronic
1147306043 17:39565061-39565083 CTGGAAGTGGCCAGGAAGCAGGG - Intergenic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147925108 17:43941215-43941237 CTGGGAGGGAAGAGGCAGCAGGG + Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148322068 17:46763206-46763228 CAGAAAGAAGAGATGCAGCAGGG - Exonic
1148484532 17:47982202-47982224 CAGGAAGTGGACAGGCAGCCAGG - Intergenic
1148749975 17:49940087-49940109 CTGGGAGTAGGGAGGGGGCAGGG + Intergenic
1149657350 17:58317268-58317290 CTGGAAGCAAGGAGGCAGAAAGG + Intronic
1150287659 17:63963048-63963070 AGGGAAGTAGGGAGGCAGGAGGG - Intronic
1150630434 17:66876815-66876837 CAGGAAGTAGAGAGGAAGAATGG - Intronic
1151344736 17:73494700-73494722 TGGGAGGGAGAGAGGCAGCAGGG - Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1152032439 17:77852815-77852837 GTGGAGGCAGAGAGGCGGCAGGG + Intergenic
1152046292 17:77938170-77938192 CTGAAAGGAGGGAAGCAGCAAGG + Intergenic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1153971995 18:10235504-10235526 ATGGAAGTGGAGAGGCAGGAGGG - Intergenic
1154145213 18:11861284-11861306 CTGGAGACAGAGGGGCAGCAGGG - Intronic
1155344961 18:24848816-24848838 CTGGAAGGAGAAAGGAAGCTGGG - Intergenic
1156105423 18:33653665-33653687 CTGGCAGGAGAGAGGAAACAGGG - Intronic
1156816961 18:41323009-41323031 GAGGAAGTAGAGACACAGCATGG + Intergenic
1156918565 18:42490576-42490598 CAGGAGGTAGAAAGGCATCATGG - Intergenic
1158315108 18:56203548-56203570 AAGCAAGTAGGGAGGCAGCATGG + Intergenic
1158343850 18:56494710-56494732 TGGGAAGTAGAGAGTGAGCAGGG + Intergenic
1158933665 18:62345234-62345256 CTGGAAGCAGAGAGCCAGAAAGG + Intronic
1160008918 18:75089038-75089060 CTGGAACTGGAGAGGCCGCCTGG + Intergenic
1160701073 19:507700-507722 CTCGAAGTAGTGAGCCAGGAAGG - Exonic
1162199341 19:9009538-9009560 CTGGAAGCAGAAACGCAGCGTGG - Intergenic
1162859710 19:13497069-13497091 ATGGTTGTAGAGAAGCAGCATGG - Intronic
1163468249 19:17482109-17482131 CTAGTACCAGAGAGGCAGCAGGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164705300 19:30314922-30314944 CTGCAGGTAGAGAGCCAGCAGGG - Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165741198 19:38206287-38206309 GTGGAGGGAGAGAGGCAGCAGGG - Exonic
1165883493 19:39060334-39060356 CTGGAAGCAGAGAGGCAGTGTGG + Intergenic
1166395032 19:42433407-42433429 CTGAAAGCAGAGAGGCAAAATGG - Intronic
1166830883 19:45639120-45639142 CTGGAAGAAGGGAGTCACCAAGG + Intronic
1166864973 19:45830316-45830338 GAGGAACTGGAGAGGCAGCAGGG - Intronic
1166960004 19:46491604-46491626 CTGGAAGTGGGGAGGCATCAGGG + Exonic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1202713108 1_KI270714v1_random:28132-28154 CTGGAAGGAGGGAGGGAGGAAGG - Intergenic
925427090 2:3758848-3758870 CTGGAAGATGAGAGGCCACATGG - Intronic
927054951 2:19358863-19358885 CTGGACCTAAAAAGGCAGCAGGG - Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927689526 2:25197971-25197993 CAGGCTGTGGAGAGGCAGCATGG + Intergenic
928160786 2:28922438-28922460 ATGGAGGGAGAGAGGCAGCGAGG + Intronic
928314502 2:30235191-30235213 GGGGCAGTAGAGAGGCAGCAGGG - Intronic
928333456 2:30375458-30375480 GTGGAAGTTGAGGGGCAGGAAGG - Intergenic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
928718925 2:34096832-34096854 ATTGAAGAAGAGAGGCTGCATGG + Intergenic
929900067 2:45993088-45993110 CTGGGAGTGGATTGGCAGCAGGG + Intronic
930864094 2:56105880-56105902 CAGGAAGAAGAGAGAGAGCAGGG + Intergenic
931023425 2:58077866-58077888 CTGGAAGTATAGAGACATCTAGG - Intronic
932465908 2:71923995-71924017 CTGGAAGGAGAGGAGCAGCAAGG + Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
932682158 2:73835584-73835606 CTTGAAGTAGTGTGGCAACATGG + Intronic
932767494 2:74480803-74480825 CTGGAAGTGGAGCAGCAGCTGGG - Exonic
934681411 2:96286453-96286475 CCGGAAGGAGACAGGCAGCTGGG + Exonic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
935579988 2:104748324-104748346 ATGGAAATATAGAGGCGGCACGG - Intergenic
936251469 2:110871348-110871370 CTGGAAGTGGAGTATCAGCAAGG - Intronic
937121313 2:119441603-119441625 CCAGAAGAAGAGAGGTAGCAGGG + Intronic
937122854 2:119452779-119452801 GGGGAAGAGGAGAGGCAGCAGGG - Intronic
937150497 2:119682776-119682798 CTTGGAGAGGAGAGGCAGCAAGG + Intronic
938095195 2:128456974-128456996 GTGGAAGCAGAGAGGAAGAATGG - Intergenic
938150142 2:128875433-128875455 CTGGAAGTATAGGAGCAGGAAGG - Intergenic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
939007456 2:136805899-136805921 CTGGAAGTGGAGAAGCCACAAGG - Intronic
939698116 2:145353984-145354006 CTGGAAGCAGAGAGGTATCAGGG - Intergenic
940000429 2:148961857-148961879 CTGGAAATAGGGAAGCAGAAGGG - Intronic
941601657 2:167550566-167550588 TTGGATGTAGAGAGGAAACATGG + Intergenic
942292408 2:174486358-174486380 GTGGAAGTGGAAAGGCAGCCAGG + Intronic
943340173 2:186671300-186671322 ATGCAAGCAGAGAGGCAGGAAGG - Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944208325 2:197180492-197180514 CTGGGAGTAAGGAGGCTGCAGGG - Intronic
944884046 2:204044378-204044400 CTGGGGGTAGAGAAGCATCAAGG + Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946373466 2:219294620-219294642 CTGGAAGGAGAAAGGAAGCAGGG + Intronic
947615832 2:231556365-231556387 CTGGAAGGAGAGAGCCCTCAAGG + Intergenic
947665865 2:231904934-231904956 CTGGGAGGTGAGAGGCATCATGG + Intergenic
947689313 2:232120269-232120291 CTGAAGGTAGTGTGGCAGCATGG + Intronic
948573169 2:238930169-238930191 CTGGAAGGAGAGAGGCAATCAGG - Intergenic
1168855716 20:1006296-1006318 CTGGAAGTGGAGAGGGAGGGTGG - Intergenic
1168893150 20:1307318-1307340 CTGGGAGCAGGGAGGCTGCAGGG - Exonic
1169350912 20:4867222-4867244 CTGGAAGTGGAAGGTCAGCAAGG - Intronic
1169411010 20:5370337-5370359 CTGGAAGAAGAAATGCTGCAAGG + Intergenic
1170921430 20:20683274-20683296 ATGGAAGAAGAGTGGAAGCAGGG - Intronic
1171521816 20:25781937-25781959 CAGGAAGTATAGAGCCAGCTGGG + Intronic
1171555009 20:26073946-26073968 CAGGAAGTATAGAGCCAGCTGGG - Intergenic
1172110959 20:32544602-32544624 CTGGAAGGAGAGAGGCAGGGAGG + Intronic
1172631601 20:36382116-36382138 CTGGAGGTGGAGAAGCAGCCTGG + Intronic
1172785969 20:37469240-37469262 CAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1172785977 20:37469278-37469300 AAGGAAGGAGAGAGGCAGGAAGG - Intergenic
1172899937 20:38327375-38327397 CTGGAAGTAGAGAGAGAAAATGG + Intronic
1173214811 20:41071175-41071197 GTGGAAGTAGGGAGCCAGTAGGG - Intronic
1173759068 20:45543860-45543882 ATGGAGGTATAGAGGTAGCACGG - Intronic
1174208560 20:48858678-48858700 CTGAAAATAGACAGGCAGCAGGG + Intergenic
1175300331 20:57938304-57938326 TGGGAAGCAGAGAGGCAGCTTGG + Intergenic
1175553730 20:59833079-59833101 CTGTAAGTAGAGAGGCAGGTTGG + Intronic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1177718819 21:24877779-24877801 CAGAAAGTAGAGAGGCAAGAAGG + Intergenic
1178155354 21:29847229-29847251 ATGGCAGGAGAGAGGCAGGAAGG - Intronic
1179277183 21:39903130-39903152 CTGGAAGCAGAGTGGCTGCTGGG + Intronic
1179725577 21:43339735-43339757 CTGGCAGTGGAGAGGCACCTGGG + Intergenic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1179994293 21:44966914-44966936 CGGGAAGGAGAGAGGCAGCAGGG + Intronic
1181088636 22:20457080-20457102 CAGGAAGTAGGGGGCCAGCAAGG + Intronic
1181174448 22:21027822-21027844 CTGGAGATTGAGAGGCAGCAGGG - Exonic
1181518503 22:23432075-23432097 GTAGAATTAGCGAGGCAGCATGG - Intergenic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1182098081 22:27639268-27639290 CGGGGTGCAGAGAGGCAGCAGGG - Intergenic
1182815576 22:33160438-33160460 CGGGAAATAGAAAGCCAGCAAGG - Intergenic
1183069759 22:35387819-35387841 CTGGGAGTAGGGAGCCAGGAGGG - Intronic
1183405589 22:37629148-37629170 CTGGCAGCAGAGAGCCTGCAGGG - Intronic
1183771621 22:39931277-39931299 CTGGAAGTACAGAGAGAGGAAGG + Intronic
1184070642 22:42144308-42144330 CTGGAAGTCCACATGCAGCAAGG + Intergenic
1184614760 22:45630534-45630556 CTGGAAGAAGAGAGGCAAGGGGG + Intergenic
949127752 3:466822-466844 ATGGAAATACAGAGCCAGCAAGG - Intergenic
949478686 3:4472669-4472691 GTGGAAGGAGGGAGGCAGGAAGG + Intergenic
950223459 3:11214195-11214217 CTGGAAGAAGAGAGGCTGGTCGG + Intronic
950689908 3:14647392-14647414 CTGGATTTAGAGAGGCAGCAGGG - Intergenic
953409851 3:42684696-42684718 CTGGAAGTTTAGAAGCACCAAGG - Intergenic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
954576338 3:51678372-51678394 CAGGAGGTAGAGAGCCAGCCTGG - Intronic
954639551 3:52089841-52089863 CTGAGAGTAGTGAGGCAGCTTGG + Intronic
955656375 3:61249436-61249458 ATCTAAGTACAGAGGCAGCATGG + Intronic
956717382 3:72090220-72090242 CTGGAACCAGGGAGTCAGCAGGG + Intergenic
959444985 3:106427773-106427795 CTGGAAGTCCAGAGGCAGAGTGG - Intergenic
960011165 3:112835637-112835659 CAGGAGGTAGAGAGGCTCCAGGG - Intronic
961091799 3:124119143-124119165 CTGCAAGGCGAGAGGCAACAGGG + Intronic
961109465 3:124271657-124271679 CTGGGAGCAGAGGGACAGCAGGG - Intronic
961146977 3:124602355-124602377 CTGGGAGTGGAGACTCAGCAAGG + Intronic
961369783 3:126422399-126422421 CCAGAAGCAGAGAGGCATCAGGG - Intronic
962126626 3:132626212-132626234 CTGAGAGTAGAGAGGCAATATGG - Intronic
962297614 3:134205947-134205969 CGGGAAGATGAGAGGCAGCAAGG + Intronic
962932194 3:140048912-140048934 ATGGAGGTAGTGAAGCAGCAGGG - Intronic
963260137 3:143184162-143184184 CTGGGAGTGAAGAGGCAGGAGGG - Intergenic
964417357 3:156461325-156461347 CTGGAAGCTAAGAGGAAGCAAGG - Intronic
965673788 3:171173910-171173932 CAGGGAGAAGAGAGGAAGCAGGG + Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
968726908 4:2252042-2252064 CTGGAAGGAGAGAGGGGGCCAGG - Intronic
969232928 4:5844327-5844349 CTGGAAGGAAAGAGGAAGTAAGG + Intronic
969329803 4:6467763-6467785 CTGGAAGTTCAGAGGCGGCCTGG + Intronic
969425948 4:7123875-7123897 CTGGAGGTGGAGAGGCCGCCAGG + Intergenic
970074200 4:12198915-12198937 CTGGAAGTACAAGGTCAGCATGG - Intergenic
970091936 4:12419287-12419309 CTAGCAGAAGAGAAGCAGCAGGG - Intergenic
972633159 4:40859236-40859258 CTGGAACTAGGGTGGCAGCATGG - Intronic
972948797 4:44292469-44292491 CTAGAAGTAGAGAGGGAGGAAGG + Intronic
973975764 4:56260934-56260956 CAGGAAGTAGAGAGGGAGAGAGG - Intronic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
975231482 4:71939384-71939406 GAGGAAGGAGAGAGGCAGAAAGG - Intergenic
977128265 4:93198649-93198671 CTGGAGTTAGAGAGGTAGGATGG + Intronic
978349176 4:107803369-107803391 CTGGAAGTAGAGCAGGAGAAGGG + Intergenic
978607805 4:110501427-110501449 TTGAAAGTAGAGAGGGAGGAGGG - Intronic
979041491 4:115803018-115803040 TGGGGAGTAGAGAGGCATCAAGG - Intergenic
980730572 4:136818978-136819000 CAGGAAGCAAAGAGGCAGCATGG - Intergenic
981008635 4:139901761-139901783 CTGGAAGGAGGGAGGCGGGAAGG + Intronic
981116491 4:140996886-140996908 CTGGAAGTAATGAGGCAGAAAGG + Intronic
981416562 4:144500610-144500632 CAGGAATTTGAGAGGCAGAAGGG + Intergenic
981588879 4:146334660-146334682 TTGCAACTAAAGAGGCAGCAGGG + Intronic
981725606 4:147843936-147843958 ATGCAAGTAGAGAGGTAGGACGG - Intronic
981803436 4:148684504-148684526 CTGGAAGTAGAGAGGAAGGCAGG - Intergenic
982201073 4:152961214-152961236 CAGGGAGGAGAGAGGCAGCTGGG - Intronic
984784914 4:183558669-183558691 CAGGAAGTGGAGACGCAGCAAGG + Intergenic
985622622 5:963388-963410 CTGGAATTAGGGAGGCTGCTGGG + Intergenic
986167239 5:5285279-5285301 CTGCAGGTGGAAAGGCAGCATGG - Intronic
986293127 5:6416324-6416346 CTGGAGGGAGAGTGGCAGCCAGG - Intergenic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
988485622 5:31666004-31666026 TTGGAGGTGGAGAGGCAGCGTGG + Intronic
988961459 5:36375487-36375509 CTGTAAATTGAGAGGCAGAAAGG - Intergenic
989507129 5:42239025-42239047 ATGGAAGTAGAGATGCAGAGAGG - Intergenic
990285668 5:54298546-54298568 CTGGAACTGGAGGGGCAGGAAGG - Intronic
990496713 5:56355318-56355340 CTTGAAGCAGAGAGGAAGAAGGG - Intergenic
993050739 5:82923198-82923220 CTGGCTGTAAGGAGGCAGCAGGG - Intergenic
993524885 5:88953145-88953167 CTGAAAGTGGAGATTCAGCAAGG + Intergenic
993732473 5:91439039-91439061 CTGGACTTAGACAGGAAGCAGGG - Intergenic
993901946 5:93590130-93590152 CTGGTAGTAGAGAGCCAGCCAGG - Intronic
994143900 5:96371473-96371495 CTGGAAGAAGAAAGGAAGAAAGG - Intergenic
994167818 5:96626294-96626316 CGGGAGTAAGAGAGGCAGCAGGG - Intronic
995457597 5:112368551-112368573 CTGGAATTAGAGATGCAGAGAGG - Intronic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997587523 5:135052366-135052388 CTGGAAGCAGGAAGACAGCAAGG - Intronic
997721843 5:136084330-136084352 GTGAAAGGAGAGAGGGAGCAAGG + Intergenic
999410723 5:151347506-151347528 CTGGAAGGAGGGAAGCAGGAAGG + Exonic
999992045 5:157058601-157058623 CTGGAAGCAGAGAACCAGCGTGG + Intronic
1001195404 5:169668988-169669010 CTGGGAGGAGAAAAGCAGCAGGG - Intronic
1002172980 5:177385771-177385793 CTGGGAGTGGGGAGACAGCAGGG - Exonic
1002296754 5:178235638-178235660 CTGGAACTCCAGAGGCGGCATGG + Intergenic
1002430676 5:179202226-179202248 CTGGAAGAATGGAGGCAGCCTGG - Intronic
1002565767 5:180112432-180112454 CTGGGGGTAGAGGTGCAGCATGG - Intronic
1003136167 6:3436121-3436143 CTGGAAGTCCAGAGACAGGACGG - Intronic
1005008044 6:21309823-21309845 CTGGAAGCTGAAAGGCAGCGGGG - Intergenic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1006483325 6:34316724-34316746 CTGGTATTAGAGGAGCAGCAAGG + Intronic
1006550540 6:34819430-34819452 CTGGGAGTAGTTAGCCAGCAGGG + Intronic
1006621404 6:35367166-35367188 CAGGAAGAAGAGAGGCCGGAGGG + Intronic
1006813322 6:36834957-36834979 CTGGAGCCAGAGAGGCAGCCCGG - Intronic
1007761208 6:44134712-44134734 CATGAAGTCGAGAGCCAGCACGG - Exonic
1008077124 6:47156606-47156628 GTGGAAGAGGAGAGGAAGCAGGG + Intergenic
1008473504 6:51910841-51910863 TTAGAAGTAGAGAGGCAGTTTGG - Intronic
1008811939 6:55513026-55513048 CTGGAAGCAGACAAGCACCAAGG + Intronic
1011632479 6:89340475-89340497 CTGGCAGTAGAGTTGGAGCAGGG - Intronic
1012245953 6:96925572-96925594 CTGGAAATAGAGGGGAAGAAGGG - Intronic
1013194422 6:107832768-107832790 CAGGAAGAAGAGAGGCCGTAGGG + Intergenic
1013315594 6:108939474-108939496 CAGGAAGAAGAGAGAGAGCAGGG - Intronic
1013356582 6:109350689-109350711 CTGGGAGCAGAAAGGAAGCAAGG + Intergenic
1015255516 6:131175260-131175282 GTGGAAGTGGGGAGGCAGGAGGG + Intronic
1015360160 6:132330702-132330724 CTGAAAGTAGAGAGCAAGCAAGG - Intronic
1016778678 6:147934601-147934623 TGGGAAGTCCAGAGGCAGCAGGG + Intergenic
1016845988 6:148569089-148569111 ATGGAAGCAGGGAGGCAGGAGGG + Intergenic
1017680241 6:156856551-156856573 CTTGATGCAGGGAGGCAGCATGG - Intronic
1018734951 6:166680917-166680939 ATGGGAGGAGAGGGGCAGCAAGG - Intronic
1019129175 6:169860810-169860832 GTGGCAGGAGAGAGACAGCAGGG - Intergenic
1019600060 7:1876869-1876891 GTAGAATTAGCGAGGCAGCATGG + Intronic
1020107620 7:5429409-5429431 CTGGGAGTGGAGAGGCTGCTGGG + Intergenic
1020342467 7:7127038-7127060 CATGAAGTAGAGAAGAAGCAAGG + Intergenic
1020676634 7:11191944-11191966 CTGGTACTAGAGAGACAGCCAGG + Intergenic
1020913187 7:14159187-14159209 ATGAAAGAAGAGAGGCAGCGTGG - Intronic
1021234635 7:18127445-18127467 CCAGAAGTACAGAGGGAGCAGGG - Intronic
1021468842 7:20978599-20978621 CTGGATGCAGAGAGGCAGTGAGG - Intergenic
1021773593 7:24029637-24029659 ATGGGAGTAGAGAAGCAGAATGG + Intergenic
1021930504 7:25576819-25576841 GAGGAAGAAGAGAGGCAGGAAGG + Intergenic
1022483555 7:30759991-30760013 CTGGAAGGAGAGAGTGGGCAAGG + Intronic
1022948644 7:35314769-35314791 CTGGAGGCAGAGAGCCAGCTAGG + Intergenic
1022999470 7:35793218-35793240 CTGGTAATAGACTGGCAGCACGG - Intergenic
1023232889 7:38052252-38052274 ATGGAAGGAGAGGGGAAGCAAGG - Intergenic
1023268998 7:38439097-38439119 GTGGCAGGAGAGAGACAGCAGGG - Intronic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1029375373 7:100174191-100174213 GTGGAAATAGAGAGGCAGTTAGG + Intronic
1029505898 7:100963960-100963982 CTGGAAGGAGAGAAGTTGCAGGG + Intronic
1029572500 7:101379481-101379503 CTGGAGGGTGAGAGGCAGGAAGG - Intronic
1030523125 7:110622562-110622584 CTGCAAGTCCAGAGGCAGTATGG + Intergenic
1030992973 7:116323560-116323582 CAGGGAGTAGAGAGGCCCCAGGG - Intronic
1030995415 7:116353319-116353341 CTTAAAGTAGTGAGGCAACATGG - Intronic
1031294226 7:119982628-119982650 CTAGGAGTAGGGAGGAAGCAGGG + Intergenic
1031673934 7:124586474-124586496 CTTGAATTAGAGTGGTAGCAGGG - Intergenic
1032121748 7:129161989-129162011 CTGGGAGCAGAGAGTCATCAAGG + Intronic
1032242787 7:130177965-130177987 CTGTAAGTAGAGAGGCACAGAGG + Intronic
1032338121 7:131044969-131044991 CTGGGTGTAGGGTGGCAGCATGG - Intergenic
1032754044 7:134871367-134871389 CTGGAAATAGAGTGGCTCCAAGG + Intronic
1033170693 7:139081078-139081100 CTGGAAGCAGGGAGGAAGGAAGG + Intronic
1033471823 7:141656936-141656958 CTGGAAACAGAGAGAGAGCACGG + Exonic
1034434314 7:151055849-151055871 CTGGGAGGAGAGAGGGAGAAGGG + Intronic
1034451509 7:151139450-151139472 CTGGAAGGAGGAAGGCAGGAAGG + Intronic
1035591862 8:822335-822357 CTGGAAGGAAACAGGCAGCCGGG + Intergenic
1036544326 8:9751723-9751745 CTGGCAGCCGAGAGGCAGGAGGG - Exonic
1036606460 8:10309728-10309750 TTGGAACTAGAGAGCCTGCAAGG + Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037815592 8:22110046-22110068 CTGGAAGGAGGGAGGGGGCAGGG + Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038028122 8:23610326-23610348 CTGGAAGGAGCCAGGCAGCAGGG + Intergenic
1038055485 8:23853832-23853854 CAGGAGGGAGACAGGCAGCAGGG + Intronic
1038647358 8:29372903-29372925 AAGGAAGTGGAGAGGCTGCAGGG + Intergenic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1038932895 8:32214941-32214963 CTGGAAGTAGAGAAAGAGAATGG - Intronic
1039944308 8:42116710-42116732 CTGGAAGCAGACAGGAAGCCAGG - Intergenic
1041401564 8:57450691-57450713 TTGGAAGAAGAAAGGCAGAAGGG + Intergenic
1041845934 8:62329145-62329167 CTGCAATTAGAGTGTCAGCAGGG - Intronic
1042110407 8:65375731-65375753 CTGGAGGAAGAGATGCAGCCAGG - Intergenic
1042715244 8:71765378-71765400 CAGGAAGGAGAGAGGAAGGAAGG - Intergenic
1043377729 8:79669030-79669052 CTGGAAGTAGAAAAGAAGCAAGG - Intergenic
1043826279 8:84932673-84932695 CTACAGGTAGAGAGGAAGCAAGG - Intergenic
1044557349 8:93578247-93578269 TTTGAAGTTGAGAAGCAGCATGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1045545626 8:103125694-103125716 CTGGAAGCAGTGAGCAAGCAGGG - Intergenic
1045620654 8:103973960-103973982 CTGCCAGTGGAGAGTCAGCAAGG - Intronic
1046285994 8:112092978-112093000 CTGGAAGTTGAGAGGGGTCAAGG + Intergenic
1046526342 8:115386388-115386410 CCGTAGGTAGAGTGGCAGCATGG + Intergenic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047322261 8:123797808-123797830 CTGGATGGAGAGAGGAAGTACGG + Intronic
1048120726 8:131578628-131578650 CTGGAAGTAAAATGGCAGCCAGG + Intergenic
1048644639 8:136406314-136406336 CTGGAAGCAGGGAGGCAGAAAGG + Intergenic
1049800476 8:144515348-144515370 CAGGGAGTAGAGTGGCAGCACGG + Exonic
1050161053 9:2718764-2718786 CTGAAGGTAGAGCGGCAGGATGG - Exonic
1050175061 9:2861264-2861286 CTGGAAAGAAATAGGCAGCATGG + Intergenic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1051151829 9:14088330-14088352 TTGAGAGGAGAGAGGCAGCAGGG + Intronic
1052069682 9:24067082-24067104 CTGGAACTGGAGAGGGAGAAAGG + Intergenic
1052395635 9:27934790-27934812 TTTGGAGTTGAGAGGCAGCATGG + Intergenic
1053887087 9:42651803-42651825 CTGGATGTAGAGTTGCCGCATGG + Intergenic
1054226107 9:62459253-62459275 CTGGATGTAGAGTTGCCGCATGG + Intergenic
1055075583 9:72211978-72212000 GGGGAAGGAGAGAGGCAGAAAGG + Intronic
1055432767 9:76260698-76260720 CTAAAAGCAGAGTGGCAGCAGGG - Intronic
1055733350 9:79302182-79302204 CAGGAAGGAGGGAGGCATCAAGG + Intergenic
1056062184 9:82895018-82895040 CTAAAAGCAGAGAGGCTGCAAGG - Intergenic
1056268986 9:84927834-84927856 CAGGAAATAGGGAGGCAACAGGG - Intronic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056712444 9:89001760-89001782 CTTGGAGTAGAGGGGCAGGATGG - Exonic
1056714784 9:89020307-89020329 GTGGAGGGTGAGAGGCAGCAGGG + Intronic
1056796785 9:89664018-89664040 CTAGAAGAGGAGAGGCAGTAGGG + Intergenic
1057201817 9:93144547-93144569 CTGGAGGGAGAGAGGCAGGGAGG + Intergenic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057230327 9:93317782-93317804 CTGCAAGAAGACTGGCAGCACGG - Intronic
1057329635 9:94101404-94101426 CTGGAAGTGGAGAGGCTGGGAGG + Intronic
1057446824 9:95122182-95122204 CTGGAGGGAGAGAGGCAGGGAGG + Intronic
1057528922 9:95826973-95826995 CTGGAAGGCAAGAGGGAGCAGGG - Intergenic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1059862563 9:118481220-118481242 GTGGAAGAAGAGAGGAAGGAAGG + Intergenic
1059991087 9:119867425-119867447 GAGGAGGTAGAGAGGGAGCAAGG + Intergenic
1060600087 9:124871450-124871472 CTGCAGATAGAGCGGCAGCATGG + Intronic
1061014220 9:127972648-127972670 CTGGAGGCAGGGAGGCAACAAGG + Intronic
1061024939 9:128042422-128042444 CTGGAACCAGAGAGGTAGGAAGG + Intergenic
1061245902 9:129401249-129401271 CTGGGAGTAGAGGGACAGCATGG - Intergenic
1061561254 9:131405325-131405347 TTGGAAGAAAACAGGCAGCAAGG - Intronic
1061798411 9:133101592-133101614 CTGGTTGTAGAGCGGCAGCGCGG + Exonic
1062062147 9:134502422-134502444 GAGGCAGTGGAGAGGCAGCAGGG - Intergenic
1062097913 9:134712262-134712284 CAGGAAGAAGAGAGTCAGGAAGG - Intronic
1062097936 9:134712333-134712355 CAGGAAGAAGAGGGGCAGGAGGG - Intronic
1062098008 9:134712578-134712600 CAGGAAGAAGTGAGGCAGAAAGG - Intronic
1186698622 X:12065526-12065548 ATGGAAGTGGAGAGGGAGGAAGG - Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188261531 X:28030517-28030539 CTGGAGGTAGAGTGGCCGAAAGG + Intergenic
1188394330 X:29661944-29661966 GTGGAGGCAGAGAGGCAGAATGG - Intronic
1191664123 X:63680916-63680938 CAGGAAGTAGAGAAGAAGAAGGG - Intronic
1191930535 X:66366731-66366753 CTGGAGGCAGTGAGGCAGTATGG - Intergenic
1196179931 X:112678627-112678649 AGAGAAGTTGAGAGGCAGCATGG + Intronic
1196496150 X:116327598-116327620 CAGGAAGTAGAGAGGAGCCAAGG + Intergenic
1196960373 X:120993880-120993902 CTGGCAGTGGAGAGGGAGAAGGG + Intergenic
1197949883 X:131882858-131882880 CTGGAAGTAGAGAAGGAGGGCGG + Intergenic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1198508797 X:137328252-137328274 CTGGAACTAGAGAAGTAGCCAGG + Intergenic
1199596187 X:149507950-149507972 GAGGATATAGAGAGGCAGCAAGG + Intronic
1200125401 X:153811435-153811457 CTGGAAGGAAACAGGCCGCATGG - Intronic
1200322621 X:155205720-155205742 ATGGAAGCAGAGAGGAAGCATGG - Intronic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201282776 Y:12355635-12355657 CTGTAACTCGAAAGGCAGCATGG - Intergenic
1202354330 Y:24029729-24029751 CTTGAGTTAGGGAGGCAGCAAGG + Intergenic
1202516449 Y:25640383-25640405 CTTGAGTTAGGGAGGCAGCAAGG - Intergenic