ID: 1083316338

View in Genome Browser
Species Human (GRCh38)
Location 11:61816860-61816882
Sequence AAACCCGGCGCGCAGGCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083316338_1083316346 3 Left 1083316338 11:61816860-61816882 CCAGCCGCCTGCGCGCCGGGTTT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1083316346 11:61816886-61816908 GCACCGCAGGGCAGACCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 135
1083316338_1083316344 -1 Left 1083316338 11:61816860-61816882 CCAGCCGCCTGCGCGCCGGGTTT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1083316344 11:61816882-61816904 TTCAGCACCGCAGGGCAGACCGG 0: 1
1: 0
2: 7
3: 8
4: 125
1083316338_1083316341 -10 Left 1083316338 11:61816860-61816882 CCAGCCGCCTGCGCGCCGGGTTT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1083316341 11:61816873-61816895 CGCCGGGTTTTCAGCACCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1083316338_1083316342 -9 Left 1083316338 11:61816860-61816882 CCAGCCGCCTGCGCGCCGGGTTT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1083316342 11:61816874-61816896 GCCGGGTTTTCAGCACCGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 74
1083316338_1083316350 27 Left 1083316338 11:61816860-61816882 CCAGCCGCCTGCGCGCCGGGTTT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1083316350 11:61816910-61816932 CTCGCAGCGCGCGTTCCCATTGG 0: 1
1: 0
2: 0
3: 2
4: 19
1083316338_1083316345 2 Left 1083316338 11:61816860-61816882 CCAGCCGCCTGCGCGCCGGGTTT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1083316345 11:61816885-61816907 AGCACCGCAGGGCAGACCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083316338 Original CRISPR AAACCCGGCGCGCAGGCGGC TGG (reversed) Exonic
900507451 1:3036807-3036829 AGACCCTGCGGGCAGCCGGCAGG - Intergenic
904237641 1:29124819-29124841 ACCCCCGGCGCGCAGCCGGGGGG + Intergenic
908415466 1:63909148-63909170 AAAGCAGGTGCGCAGGGGGCAGG - Intronic
911716061 1:101134511-101134533 AAAGCCGGAGCACAGGTGGCTGG - Intergenic
921023685 1:211259179-211259201 AAACCCCGCTCGCAGGCAGCCGG - Intronic
921225482 1:213015414-213015436 AAACCCGCCGCGCAGCTGGCGGG - Intronic
1067694332 10:48524145-48524167 CGCCCCGGGGCGCAGGCGGCAGG - Intronic
1069419229 10:68231548-68231570 GAGCGCGGCGCGCAGGCGCCTGG - Exonic
1069514373 10:69065887-69065909 AATCCCAGCGGGCAGGAGGCGGG + Intergenic
1069573206 10:69506925-69506947 AAGCCCAGCGTGGAGGCGGCAGG + Exonic
1070800849 10:79243607-79243629 AAAGGCTGCGCGCAGGCAGCGGG - Intronic
1073105474 10:101030206-101030228 AAACCCTGCGCCATGGCGGCTGG + Exonic
1074095030 10:110304526-110304548 AAACACGGCCCGCAGGGGACCGG - Intronic
1076035611 10:127196547-127196569 CAGCCGGGCGCACAGGCGGCAGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1077532156 11:3102382-3102404 AAACCAGGCCAGCAGGCAGCGGG - Intronic
1083272932 11:61581052-61581074 ACACGCGGCGCGCAGGCCGGAGG - Intronic
1083316338 11:61816860-61816882 AAACCCGGCGCGCAGGCGGCTGG - Exonic
1091079101 11:132649482-132649504 TAACCCTGAGCGCAGGGGGCGGG + Intronic
1096482368 12:51951442-51951464 GAGCCCGGCGCGGAGGAGGCCGG - Intergenic
1102591114 12:113957621-113957643 ACACACGGCGAGCAAGCGGCAGG + Intronic
1104258177 12:127158153-127158175 AAACCCGGCATGCAGGCAGAAGG - Intergenic
1123706282 15:22953424-22953446 AATCCCAGGGTGCAGGCGGCTGG - Intronic
1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG + Exonic
1125532389 15:40422103-40422125 CAACCCCGCGGGCAGCCGGCAGG - Intronic
1131780021 15:95846047-95846069 AAACCCGAGGCGGAGGCGCCGGG - Intergenic
1132586036 16:706073-706095 AACCCCGGCGCGCGGCGGGCGGG + Intronic
1135190281 16:20348825-20348847 AACCCCGGCCCGCAGGAGCCCGG + Exonic
1138455326 16:57117537-57117559 AAGCCTGGCGGGCAGGAGGCTGG + Exonic
1142115564 16:88354376-88354398 GAACCCGGGACGCAGGCGGCGGG + Intergenic
1142242037 16:88951946-88951968 AAACCCAGCTCGGAGGCGTCAGG - Intronic
1142378952 16:89721212-89721234 CCACGCGGCGCGCAGGTGGCGGG - Intronic
1147179502 17:38675098-38675120 GGACCCGGCGCGGCGGCGGCTGG + Exonic
1147185150 17:38709291-38709313 AAACCCGGGGGGCAGGGGGGTGG - Intronic
1152695216 17:81740843-81740865 ACACCCGCCGCGCTGGCGGGGGG + Intergenic
1160457597 18:79014227-79014249 ATACCCGTCGGGCAGGTGGCAGG - Intergenic
1160592748 18:79952908-79952930 AAACCAGTCGGGCAGGGGGCAGG - Intergenic
1160935527 19:1592778-1592800 AAAGCCGGCGCGCGCCCGGCTGG - Intronic
1161852397 19:6744582-6744604 ATACCCGGCACCCAGGCGGGTGG - Exonic
1161852521 19:6745072-6745094 AGACTCGGCGTTCAGGCGGCTGG - Intronic
1166330676 19:42076423-42076445 CGACCCGGCGCGCGGGCAGCCGG + Intronic
1167369391 19:49071809-49071831 AAACCCGGCGTGAAGAGGGCAGG - Intronic
1168713324 19:58513770-58513792 AAACCGGGCGCTCAGGCGCTTGG - Exonic
926066414 2:9843719-9843741 AAGCCGCGCGCGCATGCGGCCGG - Intronic
927714173 2:25341775-25341797 AAGGCCGGCCCGGAGGCGGCGGG - Intronic
946657237 2:221961687-221961709 CAAACAGGCGCTCAGGCGGCCGG - Intergenic
948393137 2:237626972-237626994 GAAGCCGGCGCCCAGGAGGCTGG + Intergenic
1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG + Intronic
1175859810 20:62143986-62144008 AAAGCCGGGGCGCAGCCGGGCGG + Intronic
1176388027 21:6149038-6149060 AAACCTGCAGGGCAGGCGGCAGG - Intergenic
1179735445 21:43389210-43389232 AAACCTGCAGGGCAGGCGGCAGG + Intergenic
1183149807 22:36028621-36028643 CAACCCGGCGGGCGGGCGGGCGG - Intergenic
1185274396 22:49944099-49944121 CAACCCGGCGGGCAGGCTCCTGG + Intergenic
955927654 3:64023506-64023528 GAAGCCGGGCCGCAGGCGGCCGG - Intronic
958798756 3:98732978-98733000 AAACCCGCAGCGAAGCCGGCCGG - Exonic
968229124 3:196994263-196994285 AAACTCGGGCCGAAGGCGGCTGG + Intronic
975779166 4:77820353-77820375 AAACGCGGCGCACGGGGGGCGGG - Intergenic
998136566 5:139677218-139677240 AAAGCTGGCGGGCAGGCGGGCGG - Intronic
1006611693 6:35298004-35298026 ACACCTGGCTCCCAGGCGGCAGG - Intronic
1006670675 6:35728090-35728112 AGCCCCGGCGCGCTGGCAGCGGG - Intronic
1015149038 6:130019110-130019132 CAGGCTGGCGCGCAGGCGGCGGG + Intronic
1020281624 7:6653074-6653096 GAAGTCGGCGCGCAGGCGGAAGG - Exonic
1020660374 7:10974188-10974210 AAAACCGGCGCGCAGCCAGCCGG - Exonic
1022719552 7:32930650-32930672 AAACCTGGCAGGCAGGCGGGCGG - Intergenic
1030227650 7:107169739-107169761 AGCCCCAGCGCGCAGGCGCCTGG - Intronic
1034890662 7:154836166-154836188 AAAGCCGGGCGGCAGGCGGCGGG - Intronic
1037855288 8:22367228-22367250 ATACCCGGCGCGTCAGCGGCCGG - Exonic
1041324942 8:56653769-56653791 AATCCCAGCGCGGAGGCGGGCGG - Intergenic
1049009878 8:139880226-139880248 AACCCAGGTGTGCAGGCGGCCGG + Intronic
1049360244 8:142209370-142209392 AAACCTGGGGGGCAGGAGGCTGG + Intergenic
1062349926 9:136133522-136133544 AAAGCCCGCGCCCAGGCCGCGGG - Intergenic
1192440712 X:71171422-71171444 GAACCCAGCGCGCTGGGGGCAGG - Intergenic
1195668298 X:107449762-107449784 GGAGCTGGCGCGCAGGCGGCGGG - Intergenic
1198750231 X:139931855-139931877 AAACACGGTGCCCAGGCGGCCGG - Intronic