ID: 1083316466

View in Genome Browser
Species Human (GRCh38)
Location 11:61817384-61817406
Sequence AAGATAACTGCAACTTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 237}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083316466_1083316473 16 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316473 11:61817423-61817445 CGGTCTCTTGGGCTTGGTGGTGG 0: 1
1: 0
2: 0
3: 26
4: 226
1083316466_1083316472 13 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316472 11:61817420-61817442 TTACGGTCTCTTGGGCTTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1083316466_1083316475 21 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316475 11:61817428-61817450 TCTTGGGCTTGGTGGTGGTTGGG 0: 1
1: 0
2: 1
3: 31
4: 282
1083316466_1083316469 4 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316469 11:61817411-61817433 ACAGCATATTTACGGTCTCTTGG 0: 1
1: 0
2: 1
3: 6
4: 79
1083316466_1083316468 -4 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316468 11:61817403-61817425 TCTTGTGAACAGCATATTTACGG 0: 1
1: 0
2: 3
3: 38
4: 395
1083316466_1083316471 10 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316471 11:61817417-61817439 TATTTACGGTCTCTTGGGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 78
1083316466_1083316478 26 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316478 11:61817433-61817455 GGCTTGGTGGTGGTTGGGGGAGG 0: 1
1: 1
2: 10
3: 165
4: 1245
1083316466_1083316476 22 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316476 11:61817429-61817451 CTTGGGCTTGGTGGTGGTTGGGG 0: 1
1: 1
2: 6
3: 57
4: 748
1083316466_1083316470 5 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316470 11:61817412-61817434 CAGCATATTTACGGTCTCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1083316466_1083316474 20 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316474 11:61817427-61817449 CTCTTGGGCTTGGTGGTGGTTGG 0: 1
1: 1
2: 4
3: 44
4: 401
1083316466_1083316479 27 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316479 11:61817434-61817456 GCTTGGTGGTGGTTGGGGGAGGG 0: 1
1: 0
2: 9
3: 102
4: 1059
1083316466_1083316477 23 Left 1083316466 11:61817384-61817406 CCCTTGAAAGTTGCAGTTATCTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1083316477 11:61817430-61817452 TTGGGCTTGGTGGTGGTTGGGGG 0: 1
1: 0
2: 4
3: 78
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083316466 Original CRISPR AAGATAACTGCAACTTTCAA GGG (reversed) Intronic
900838188 1:5023229-5023251 AAGATAACTTAAGCTTTTAAAGG + Intergenic
901753100 1:11423972-11423994 GCCATAACTGCAGCTTTCAAAGG + Intergenic
903583306 1:24388557-24388579 AAGGTAAGTGCACATTTCAAAGG + Intronic
904690981 1:32292979-32293001 AAGATAACAGCAAGTTTCAGAGG + Intronic
908000797 1:59677017-59677039 GAGGTCACTGGAACTTTCAAAGG - Intronic
908375535 1:63535597-63535619 AAGAAAACTGAAACTCTGAAGGG - Intronic
912071608 1:105817394-105817416 AAAATAAATCCAACTTACAAGGG - Intergenic
912870688 1:113302374-113302396 AACCTAACTGAAACCTTCAAAGG + Intergenic
915610345 1:156986856-156986878 AGGATAAATGGAATTTTCAAAGG - Intronic
916707586 1:167367941-167367963 ATAATGTCTGCAACTTTCAAAGG - Intronic
919432980 1:197519869-197519891 AGGATAACTGCAAGTCTTAATGG - Intronic
921208342 1:212869326-212869348 CACCTAACTGCTACTTTCAAAGG - Intronic
923218581 1:231872833-231872855 AAGATAAGTGCATATTTCAGAGG + Intronic
1063760110 10:9064829-9064851 AAGAAAACTGCAGATTTTAAGGG + Intergenic
1063835257 10:10004848-10004870 AAGATAACAGCAAGTTGGAAAGG - Intergenic
1064263465 10:13805075-13805097 AATATAACTTCAAATCTCAAAGG + Intronic
1064427091 10:15239233-15239255 AGGAAAACTGCTTCTTTCAAAGG + Intronic
1064494812 10:15898195-15898217 AATATTAGTGCAATTTTCAAAGG - Intergenic
1066063290 10:31743327-31743349 AAGATATTTTCAACTTGCAATGG - Intergenic
1066366364 10:34780742-34780764 AAAATAACAGCAATTTTGAATGG - Intronic
1066562315 10:36683524-36683546 AAGATAACTGCAAATGTAATGGG + Intergenic
1067960277 10:50840188-50840210 AAGAGAACTGCACCTTAAAATGG - Intronic
1067978970 10:51060973-51060995 AAAATATCTGCAACCTTCAAAGG - Intronic
1068091135 10:52433573-52433595 AAGTTAACTCAAATTTTCAATGG - Intergenic
1068148624 10:53102940-53102962 AAAAGAACTGCAACTCTCATAGG - Intergenic
1068336004 10:55632945-55632967 AAGGAAACTGAAGCTTTCAAAGG + Intergenic
1070048164 10:72860302-72860324 AAGTTAACTGAAATTTTAAAAGG + Intronic
1072816185 10:98511776-98511798 GAAATAACTGCAAGGTTCAAAGG + Intronic
1074164608 10:110864039-110864061 AAGATAACTGCAAAGTGCAGTGG + Intergenic
1074900807 10:117815175-117815197 AAGATGCCTGCATCTTTCAGGGG - Intergenic
1074950603 10:118330880-118330902 AAGATAACTGCAACCCACAGAGG - Intronic
1075554262 10:123418747-123418769 AAAATGACTCCAAGTTTCAATGG + Intergenic
1076223350 10:128753362-128753384 AAAATAACTCAAATTTTCAAAGG + Intergenic
1076235654 10:128862081-128862103 AAGATAACTGGAACATTCCAAGG + Intergenic
1078986081 11:16599990-16600012 AAAATAACTTCTACTTTGAATGG + Intronic
1079515772 11:21266551-21266573 AAGAGAAGTGCAACATTCAAAGG - Intronic
1079737014 11:24010115-24010137 GAGATAGCTGCTAATTTCAAAGG + Intergenic
1080071567 11:28095098-28095120 AAGATGACTACAAATTGCAAAGG - Intronic
1080163050 11:29202339-29202361 TAGATAGCAGCAAATTTCAAGGG + Intergenic
1082628804 11:55516940-55516962 AAGAGAAATCCAACTTACAATGG - Intergenic
1083316466 11:61817384-61817406 AAGATAACTGCAACTTTCAAGGG - Intronic
1084862408 11:72028550-72028572 GAGATAACTGTGACGTTCAAAGG + Intronic
1085370359 11:75998097-75998119 CAAATTACTGCAACTGTCAAGGG - Intronic
1085577361 11:77618658-77618680 AAGCTAACTGGAACTTTAAAAGG + Intronic
1085989587 11:81825736-81825758 AAGATAACTCAAACTTCCATGGG - Intergenic
1086253469 11:84846047-84846069 TAGAAAACTCCAACTTTTAAAGG - Intronic
1086290157 11:85299524-85299546 AAGATAAATGCAAAGTGCAAAGG - Intronic
1087691067 11:101321027-101321049 AAGAGAACTGCAGCCTTGAAGGG - Intergenic
1088867393 11:113861678-113861700 AAGATAACAGAAACTGTTAATGG - Intronic
1093338511 12:17940390-17940412 AACATATCTGCAAGTTTCTAAGG - Intergenic
1093785642 12:23189061-23189083 AAGATAAATGCTACTATCAGTGG + Intergenic
1093916788 12:24811759-24811781 AAGATATCTGAGACTTGCAATGG + Intronic
1095612681 12:44148273-44148295 AATGAAACTCCAACTTTCAAGGG - Intronic
1095772460 12:45976122-45976144 AAGATAACTGCAACATAAAGGGG + Intronic
1097726437 12:63080423-63080445 AGCAAAACTGCAACTTTTAAAGG - Intergenic
1098425399 12:70359948-70359970 AAGAATACTTCAAATTTCAAGGG + Intergenic
1098506819 12:71262444-71262466 GAGAAAACAGCAACTTTCTATGG - Intronic
1098614405 12:72505541-72505563 AAAATAACTTCAATTTTAAAGGG + Intronic
1098972734 12:76873049-76873071 CAGATAACTTAAACTTTAAATGG - Intronic
1102382804 12:112482175-112482197 AAGAGAACTTAAACTTTCAAAGG + Exonic
1106204436 13:27577198-27577220 AAGATAAATCCAATTTTAAATGG - Intronic
1108252415 13:48580456-48580478 AAGAGAACTGGAAGATTCAATGG + Intergenic
1108830160 13:54467848-54467870 GATATAACTGAAACTTTCAAAGG - Intergenic
1111548236 13:89772846-89772868 AATATATCTTCATCTTTCAATGG + Intergenic
1111790448 13:92848527-92848549 AACATAATTGCAACTTTAAGGGG + Intronic
1112093938 13:96111818-96111840 AAGAGAACTGCAGATTTCATTGG + Intronic
1112696675 13:101957207-101957229 AAGAAAAGTGCAGCATTCAAGGG - Intronic
1112892636 13:104257417-104257439 AACAAAACTACAATTTTCAAAGG + Intergenic
1115418768 14:33168237-33168259 AAGAGAACTGCAACTATCCCAGG - Intronic
1117802591 14:59460404-59460426 AAGATAAAGACAACTATCAAAGG - Intronic
1118670188 14:68117336-68117358 ATGATAACTGCAACATTTAATGG - Intronic
1119365236 14:74085358-74085380 AAGAGAACTGATCCTTTCAATGG - Intronic
1119843170 14:77808462-77808484 TAGAGAACTGAAACTGTCAAGGG + Intronic
1121458805 14:94057269-94057291 AATATTACTGCTACTATCAATGG + Intronic
1121888311 14:97564975-97564997 AAGATCAGTGGAACTTTCAAAGG + Intergenic
1122512860 14:102284063-102284085 AAGCTAACAGCAACTTTCCCTGG + Intronic
1124089854 15:26588575-26588597 AAGATACATTCAACTTTTAAAGG + Intronic
1128456886 15:67836070-67836092 AAGAAAAGTGCAGCTTCCAAAGG - Intergenic
1129148359 15:73670450-73670472 AAGATAGCTGACACTTTTAAGGG - Intergenic
1130730986 15:86491996-86492018 AAGGTAAAATCAACTTTCAAGGG - Intronic
1130941183 15:88510667-88510689 CAGATATCTTCAACTTACAATGG + Intergenic
1132044653 15:98553425-98553447 AATCTCACTGCAACTTTGAAAGG - Intergenic
1132172030 15:99668414-99668436 AAAATAATTTCAAATTTCAATGG - Intronic
1134379934 16:13714484-13714506 ATGATAGTTGCAACTTACAATGG + Intergenic
1134802935 16:17101955-17101977 TAGGAAACTGCAACTTTCCATGG + Exonic
1139386249 16:66573580-66573602 CAATTAACTGCAACTTTCATTGG - Intronic
1140812971 16:78595959-78595981 AAAAGAACTTCAACATTCAAAGG + Intronic
1142253639 16:89003566-89003588 AAGATAACTGCATCTCTCGCAGG + Intergenic
1144186256 17:12798809-12798831 AAGATAAAAACAACTTTCCAAGG + Intronic
1146130601 17:30270955-30270977 AAGATAACTTCTACTTTATAAGG - Intronic
1146415661 17:32630407-32630429 AAAATAACTATAACTTACAATGG + Intronic
1146696835 17:34915494-34915516 AAGTTAAGTGCAAATTTCCAAGG + Intergenic
1147356112 17:39898516-39898538 AAAATACATGCAACTTACAAAGG - Intergenic
1148553397 17:48564072-48564094 AAGATGAGAGCAACTTTGAAAGG - Intronic
1150749290 17:67845225-67845247 CAGATAAATACTACTTTCAAAGG - Intronic
1150981254 17:70143929-70143951 AGAAAAACAGCAACTTTCAATGG + Intergenic
1151652071 17:75476202-75476224 AAGACAACTGCCAGTATCAAGGG - Intronic
1151711278 17:75808384-75808406 AGGCAAACTGCAAATTTCAAGGG - Intronic
1152144959 17:78562758-78562780 AAGAGCACTGCCACTCTCAAGGG + Intronic
1153412503 18:4809652-4809674 AAAATAACTGACACTTGCAAAGG - Intergenic
1155076511 18:22361607-22361629 AAGAAAACTGCAACTTAGAAGGG + Intergenic
1155360810 18:24999538-24999560 TTGATAACTGCAAATTTAAATGG + Intergenic
1156221536 18:35057394-35057416 AATATCACTACAATTTTCAAAGG - Intronic
1156282464 18:35653445-35653467 AAGATAACAGCTTCTTACAAGGG - Intronic
1157155696 18:45263442-45263464 AAGATATCTATAAATTTCAAAGG - Intronic
1157267374 18:46238420-46238442 AAGAAAGCTGCAATATTCAATGG - Intronic
1158046225 18:53158650-53158672 AAGATAACAGAAACTTTAAAAGG - Intronic
1158963519 18:62605206-62605228 AAGATATCTGTGACTTCCAAAGG - Intergenic
1159187380 18:64992994-64993016 AAAATATATGGAACTTTCAATGG + Intergenic
1159190426 18:65034784-65034806 AAGATCACTGCCACTCTAAAAGG - Intergenic
1159303753 18:66613184-66613206 AAAATAACTCCAACTTTCAGTGG + Intergenic
1159325232 18:66906341-66906363 ATGATAACTGAAACTCTCTAAGG - Intergenic
1167048277 19:47064192-47064214 AAAATAACTGCATCCTTTAATGG + Exonic
925802583 2:7615722-7615744 AAGATAAAGGCAACAGTCAAAGG + Intergenic
926667968 2:15545674-15545696 AAGAAAACTCCAAGTTTCACTGG + Intronic
928129304 2:28638105-28638127 AAGATGACTGCTACTCTCATGGG + Intronic
928734681 2:34273830-34273852 AAAAAAACTGCAAATTTGAAAGG - Intergenic
928760897 2:34581092-34581114 AAGACAACTGGAACTCTCATGGG - Intergenic
929189841 2:39129745-39129767 AATATAACTGCATCTTCAAAAGG - Intergenic
929408612 2:41671353-41671375 AAGAGAACTGAGACTTTGAAAGG - Intergenic
929742408 2:44616338-44616360 CAGATAAATGCAATTTTTAAAGG - Intronic
930845239 2:55896399-55896421 AATATAACTGCAACTCTTAAAGG - Intronic
932006731 2:67934735-67934757 AAAATACCTACAACTTACAAGGG - Intergenic
934112116 2:88753706-88753728 GAGATAACTGCAGCTTCCCATGG - Intergenic
935665016 2:105503662-105503684 AAGATAACACCAACTTTCACAGG - Intergenic
936600816 2:113892463-113892485 AAAATAACTGAAACTCTAAAGGG - Intronic
939524300 2:143273393-143273415 AAGATATTTTCAACTTACAAAGG - Intronic
939721945 2:145664408-145664430 AACATAACAGCATCTCTCAAGGG + Intergenic
940351788 2:152698926-152698948 AAGATAAGTACAACCTACAAAGG + Intronic
940678461 2:156753780-156753802 AAAATAAATGCAATTATCAAAGG + Intergenic
941393890 2:164950490-164950512 AAGATACCTAAAACTTTTAAGGG - Intronic
941744165 2:169068705-169068727 ATAATAACTGCAATTTTCAAAGG + Intronic
942910387 2:181236495-181236517 AAGATAATTGCAAGTTAGAAAGG - Intergenic
943107394 2:183562529-183562551 AAAAAAACAGCAACATTCAAAGG + Intergenic
944827146 2:203496027-203496049 AAGATAATTTCTTCTTTCAAGGG - Intronic
945043366 2:205761090-205761112 AAGCCAACAGCCACTTTCAAAGG - Intronic
945537596 2:211038191-211038213 AAGAAAACTGCAGCTTTATATGG - Intergenic
945776787 2:214115424-214115446 TAGCTAAATGCAACTTTAAATGG - Intronic
947292794 2:228596260-228596282 AAAATAGCTTCTACTTTCAATGG + Intergenic
947531850 2:230914245-230914267 AATATACCTGCTACTGTCAATGG - Intronic
948687866 2:239681453-239681475 AAGAAATCAGTAACTTTCAAAGG - Intergenic
1170994545 20:21339389-21339411 AAGAGTACAGTAACTTTCAAGGG - Intronic
1172924553 20:38520793-38520815 AAAATAAAAGCAACTTTCAAAGG + Intronic
1173024092 20:39291842-39291864 CAGTTAACTACAACTTACAAAGG - Intergenic
1176092185 20:63323149-63323171 AAAATATTGGCAACTTTCAAAGG - Intronic
1176636590 21:9249470-9249492 AAGGTAACTGAGATTTTCAAAGG - Intergenic
1176956590 21:15111515-15111537 AAAATAATTGCAACTTAAAATGG + Intergenic
1177433638 21:21023128-21023150 AAATTAAATGCAACTTTCAATGG - Intronic
1177628488 21:23697220-23697242 AACATAATTTCCACTTTCAAAGG + Intergenic
1178540922 21:33449040-33449062 AACATAACTGCATCTTTAATTGG + Intronic
1179013147 21:37572224-37572246 AAAATAAATGCAAGTTTCAAGGG - Intergenic
1181445259 22:22967573-22967595 AAAATAACTGCAACTTTTCAAGG - Intergenic
1181520041 22:23441638-23441660 AAGAAAACTTCAAGGTTCAATGG - Intergenic
1182183922 22:28381779-28381801 AAGAAAACTGCAAGATTTAAAGG + Intronic
949520608 3:4850241-4850263 TATATAACTGCATTTTTCAAAGG + Intronic
950161663 3:10764993-10765015 AAGATAACTCCAACACTCGAGGG - Intergenic
954774556 3:53005208-53005230 AACCTAACAGCAACTTACAATGG + Intronic
956618944 3:71201133-71201155 AATATAACTGCAATTTCTAAAGG - Intronic
957104173 3:75865794-75865816 AAGGTAACTGAGATTTTCAAAGG + Intergenic
957339760 3:78880619-78880641 AAGAAAATTGCAAATTTAAATGG + Intronic
958147919 3:89650761-89650783 AAGATTACTGGAACTTGGAAAGG + Intergenic
958993837 3:100878569-100878591 AAGATAAGTATAACTTTCAGTGG + Intronic
959784044 3:110271817-110271839 AAGATAACTGATACTTTTAAGGG - Intergenic
959795444 3:110422378-110422400 AAGATGCCAGCATCTTTCAAGGG - Intergenic
960297150 3:115958243-115958265 AATATAACTTGAACTTTTAAGGG + Intronic
962938094 3:140100127-140100149 AAGAGAAATGCAACTTACAGAGG - Intronic
962971141 3:140403232-140403254 GAGAAAACTGCAACTTGGAAGGG + Intronic
963522797 3:146376973-146376995 AAGATAAATTAAACTTTCAGTGG - Intergenic
964322776 3:155515546-155515568 AAGATCACAACAAATTTCAAGGG + Intronic
964738894 3:159944676-159944698 AAGCTAACTTCAATTTTCCACGG - Intergenic
966265475 3:178036770-178036792 AAGATTTCTGCAAATTTCCAGGG - Intergenic
967906588 3:194506571-194506593 ATGATTGCTGTAACTTTCAAAGG + Intergenic
970289771 4:14559348-14559370 AAGATATCTACAAATTTTAAGGG + Intergenic
972697381 4:41460914-41460936 AAAACAACTGCAATTTCCAATGG - Intronic
974258926 4:59499339-59499361 AAGATAATTAGAACTTTGAAAGG - Intergenic
975393419 4:73847375-73847397 AAGATAACTCTCTCTTTCAAGGG + Intronic
975405872 4:73988572-73988594 AAGATAACTTTCTCTTTCAAGGG - Intergenic
975409776 4:74037155-74037177 AAGAGAACAGCAGCTTTCTAGGG - Exonic
976201217 4:82580682-82580704 AAGAGAACTTAAACTTTCAAAGG - Intergenic
977320129 4:95503285-95503307 AAGGTACCGGCAACTTTCTAGGG - Intronic
979270716 4:118757546-118757568 AAGATCACTCTAACTTTCTAAGG + Intronic
980228788 4:130021258-130021280 AAGATATTTTCAACTTACAATGG + Intergenic
980793442 4:137649931-137649953 ATGATAACGGCAACTTTGAAAGG + Intergenic
983809605 4:172043783-172043805 AAGATATCTTCAATTTTGAAAGG + Intronic
983987025 4:174072273-174072295 TAGATAACTGAAACTTACCATGG - Intergenic
984051839 4:174873889-174873911 AAGAAACCTGCAAATTTCAGTGG - Intronic
984430770 4:179645797-179645819 AACAAAACTGCAATTTTCACTGG + Intergenic
984556222 4:181217266-181217288 AAAATACGTTCAACTTTCAAGGG + Intergenic
1202751478 4_GL000008v2_random:7909-7931 AAGGTAACTGAGATTTTCAAAGG - Intergenic
986498743 5:8375181-8375203 TAGATAACTGCACAATTCAATGG - Intergenic
988725803 5:33925273-33925295 ACGATAATTGCTAATTTCAATGG + Intergenic
989359445 5:40584061-40584083 AAGATCACTTGAACCTTCAATGG - Intergenic
989435939 5:41413899-41413921 AACATAAGGGCAATTTTCAAGGG + Intronic
990761646 5:59136855-59136877 AAGATCACTGCAATTTTCAAAGG + Intronic
993886053 5:93416720-93416742 CAGACAACTGCAACTTTGGAAGG - Intergenic
995150868 5:108843514-108843536 AAAAAAAATTCAACTTTCAATGG - Intronic
995354882 5:111225428-111225450 AAGAAAACTATAATTTTCAATGG - Intronic
995668683 5:114574887-114574909 AAGATAACTACAAATGTGAATGG + Intergenic
997046467 5:130325172-130325194 AAGACAAATGCAACTTTCTCAGG - Intergenic
999166416 5:149552876-149552898 ATTTTAACTGCAACTTTGAAAGG + Intronic
1001429894 5:171651003-171651025 AAAATAACAGCAACTTTACAAGG - Intergenic
1004532925 6:16470873-16470895 AGGATAATTGCATTTTTCAAAGG - Intronic
1004730300 6:18351337-18351359 GAGATAACTGCATATTTAAAGGG - Intergenic
1005719066 6:28583020-28583042 AAGATAACATCACCTTTCTAAGG - Intronic
1007501097 6:42297559-42297581 AAGAAAACTGGACCTTGCAAGGG + Intronic
1009028553 6:58029271-58029293 AAGAAAACTTCAACTTTTTAAGG + Intergenic
1010082775 6:71883839-71883861 AAAATAACTGAAACTTTTAGTGG + Intergenic
1010544413 6:77132556-77132578 AAAATAACTGCATCATTCTATGG + Intergenic
1012216541 6:96592414-96592436 AGGATAACAGCAATGTTCAAGGG - Intronic
1012593725 6:101015874-101015896 AGGATAACTACAACTTTATAGGG + Intergenic
1013758720 6:113491026-113491048 ATGATATTTGCAACTTACAATGG - Intergenic
1014523416 6:122472537-122472559 AAAATAACTGGAACTTTTATAGG - Intronic
1015642232 6:135347242-135347264 AATATAACTGTAACTTTCAATGG - Intronic
1017924499 6:158899101-158899123 AAAATAACTACAACTTTTCAAGG - Intronic
1018543046 6:164904288-164904310 AAGATAACTGCATCTTTCTGTGG + Intergenic
1019591213 7:1834640-1834662 AAGAAAACTTCAAGGTTCAATGG + Intronic
1020766945 7:12334431-12334453 AAGATAAATGCAACATTGACAGG + Intronic
1020973882 7:14981861-14981883 AAAATAAAAGTAACTTTCAAAGG - Intergenic
1021003247 7:15360240-15360262 AAAATAACTACAAGCTTCAAAGG + Intronic
1022229582 7:28401170-28401192 AAGATAAGAGCAACTTTTATAGG + Intronic
1022767997 7:33437219-33437241 AAGATAACTGAAACTTGCCTTGG + Intronic
1026270652 7:68833674-68833696 ATGAGAACTGCAACTTCCCAGGG + Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1027825224 7:83105574-83105596 AAGTTCACTGTAACTTTCCAGGG - Intronic
1028016478 7:85720063-85720085 AAGATAAGTGAAACTCTCACAGG - Intergenic
1030406164 7:109116557-109116579 AAGAAAACTGAAGCTTTGAAAGG + Intergenic
1032185604 7:129722688-129722710 AAGATAACTTCAAGTTTTTAGGG + Intronic
1032886391 7:136143901-136143923 AAGATGACTGCAACATTGACTGG - Intergenic
1035108304 7:156460068-156460090 AACACAACCGCAACTTGCAAAGG - Intergenic
1035259388 7:157652087-157652109 AAGAAAACTGGAATTTTTAAAGG + Intronic
1035791478 8:2309533-2309555 AAGAATAGTCCAACTTTCAAGGG + Intergenic
1035801327 8:2412172-2412194 AAGAATAGTCCAACTTTCAAGGG - Intergenic
1039777048 8:40747029-40747051 ATGAGAGCTGCCACTTTCAATGG + Intronic
1040646906 8:49408685-49408707 AAGATATCTGCAGTTTTCATGGG + Intergenic
1041490243 8:58425156-58425178 AAGAGAACTTAAACTTTCAAAGG - Intronic
1042137645 8:65647123-65647145 AAGATAGCTGGTACTGTCAAAGG + Intronic
1043243102 8:77961540-77961562 AAGTTAACTGCTACTTTCAGAGG - Intergenic
1043462841 8:80478185-80478207 AAAATAACTGAAACTTTGAAGGG + Intergenic
1044138599 8:88619248-88619270 AAAATATTTTCAACTTTCAATGG + Intergenic
1045078014 8:98591803-98591825 AAAATAACTGCAGCTTAGAAGGG + Intronic
1046938422 8:119907707-119907729 CAGTTCACTGCAACCTTCAAGGG - Intronic
1047697821 8:127420409-127420431 AAGGGAGCTGCAACTTTCAAAGG - Intergenic
1047706699 8:127506400-127506422 ACAATAACTGCCACATTCAATGG - Intergenic
1050306009 9:4306734-4306756 AGGATGACTGAAACTTTCCAAGG - Intronic
1050701944 9:8349758-8349780 AAGAGAACGGCAAGTTTAAATGG + Intronic
1052540243 9:29802331-29802353 GAGATAGCTGAAACTCTCAAAGG + Intergenic
1053404671 9:37862017-37862039 AACATAACAGTAACTTTAAAAGG - Exonic
1055746969 9:79458663-79458685 ATGATATCTCCAACTTACAATGG + Intergenic
1056307555 9:85305149-85305171 AAAGTGACTGCCACTTTCAAGGG + Intergenic
1056450438 9:86711578-86711600 AAGATGACTCCAAGTTTCATAGG + Intergenic
1059229386 9:112704713-112704735 AAGATTACTGTAACCTACAAAGG + Intronic
1203718945 Un_KI270742v1:185642-185664 AAGGTAACTGAGATTTTCAAAGG + Intergenic
1203653179 Un_KI270751v1:149317-149339 AAGGTAACTGAGATTTTCAAAGG + Intergenic
1186496888 X:10018109-10018131 AAGTTAATTACAACTTTAAAGGG - Intronic
1186548577 X:10477855-10477877 AAGATAACTGCACGTTTTCAAGG - Intronic
1186808586 X:13164493-13164515 AGGAGAACTGGAAATTTCAAGGG - Intergenic
1186972709 X:14865805-14865827 AAGATAACTGAATGTGTCAACGG + Intronic
1188081514 X:25847443-25847465 AAGATAAATCAAACTTTGAAAGG - Intergenic
1188492922 X:30755316-30755338 TAGAAAACTGGAACTTACAATGG - Intergenic
1188655433 X:32688625-32688647 AAGATACTTTCAACTTTCCATGG - Intronic
1190004050 X:46717718-46717740 TATCCAACTGCAACTTTCAAGGG + Intronic
1190123611 X:47684032-47684054 AAGAAAAGTGCAACTTGGAAAGG - Intergenic
1191161024 X:57330104-57330126 AAGATAACAGCAACTGTTCAGGG + Intronic
1192750318 X:73983747-73983769 AAGATAAATGCAACAATCCATGG - Intergenic
1193862062 X:86681154-86681176 AACAAAACTGCAACTTGAAAAGG + Intronic
1197812268 X:130455746-130455768 AAGATAAATGGAAGTTTAAAGGG - Intergenic
1201173099 Y:11290484-11290506 AAGGTAACTGAGATTTTCAAAGG + Intergenic