ID: 1083318761

View in Genome Browser
Species Human (GRCh38)
Location 11:61832495-61832517
Sequence ATGCCCAGGTTGCCTTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083318754_1083318761 27 Left 1083318754 11:61832445-61832467 CCCCAGGAAGCAGTTCTGAGATG 0: 1
1: 0
2: 2
3: 45
4: 251
Right 1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 118
1083318755_1083318761 26 Left 1083318755 11:61832446-61832468 CCCAGGAAGCAGTTCTGAGATGA 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 118
1083318756_1083318761 25 Left 1083318756 11:61832447-61832469 CCAGGAAGCAGTTCTGAGATGAA 0: 1
1: 1
2: 0
3: 42
4: 226
Right 1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083318761 Original CRISPR ATGCCCAGGTTGCCTTTGTA GGG Intronic
901396397 1:8985273-8985295 ATGGCCTGGTGGCCTTTGTGAGG - Intergenic
902767810 1:18628892-18628914 ACCTCCAGGTTGCCTTGGTATGG - Intergenic
904817910 1:33219618-33219640 ATGCCCAGGTTTCCTATCTGAGG + Intergenic
905375477 1:37517280-37517302 ATTCCCAGGCTACCTTTGTCGGG - Intergenic
907629803 1:56069173-56069195 GTGCCCAATTTGCCTTAGTATGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910479706 1:87645301-87645323 GTGCTGAGGTTGCCTTTGTTAGG + Intergenic
910606669 1:89092659-89092681 ATGCCCACCTTGCCTATTTAGGG + Intergenic
924726911 1:246679559-246679581 TTTCCCAGGTTGCCTGTGTAAGG - Intergenic
1065635373 10:27727976-27727998 ATTCCCAGATGGCCTTTGTTAGG + Intronic
1065756555 10:28936084-28936106 TTGCCCAGGCTTGCTTTGTATGG - Intergenic
1068799369 10:61122085-61122107 ATGCCCTGATTGCCTTTCTCAGG - Intergenic
1073836080 10:107444442-107444464 GTGCCCAGGTTGCTGTTGGAAGG - Intergenic
1075207285 10:120458007-120458029 ATGCCCAGGGTGGCTTTGAGCGG + Intronic
1075794746 10:125111860-125111882 ATGTCCAGGTGTCCTTTCTACGG + Intronic
1075812912 10:125239496-125239518 ATGCCCATTTTGCCTTCTTATGG - Intergenic
1076779368 10:132715680-132715702 ATGCCGAGTTTGCCTTTGCCTGG - Intronic
1078926261 11:15878266-15878288 ATGCCTATATTGCCTTTGAATGG + Intergenic
1081110239 11:39126653-39126675 ATGCCCACCTTGCCTTTGAAAGG - Intergenic
1083318761 11:61832495-61832517 ATGCCCAGGTTGCCTTTGTAGGG + Intronic
1086326577 11:85707487-85707509 TTGCCCATTTTGCCTTTGTCTGG + Exonic
1092758757 12:11790250-11790272 TTCCCCACGTTGCCTTTGTCTGG + Intronic
1093253769 12:16840572-16840594 AGGCCTTGGGTGCCTTTGTAAGG + Intergenic
1095243564 12:39890202-39890224 ATGGCCAGGTTTTCTCTGTAAGG - Intronic
1095883443 12:47164068-47164090 ATCCCCAGTTTGGCATTGTAGGG - Intronic
1097986955 12:65793856-65793878 TTGCCCTGGTTGCCACTGTATGG + Intergenic
1099913397 12:88861550-88861572 TTGCCCAGGTTGGCTTTGAGTGG - Intergenic
1104339454 12:127934280-127934302 ATTCTCAGGTAGCCTTTGTAGGG - Intergenic
1104860566 12:131921296-131921318 ATGCACAGCTTGCCTGTGGAGGG - Exonic
1108363540 13:49688869-49688891 ATGCCCATGTTGTCTTTGCTTGG - Intronic
1108772304 13:53718420-53718442 ATGCCAAGGGTGCTTTTCTAAGG + Intergenic
1111873477 13:93863989-93864011 TTTCCCATCTTGCCTTTGTAGGG + Intronic
1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG + Intergenic
1115699142 14:35932334-35932356 AAGCCCAGTCTGCCTTTGAAGGG - Intergenic
1117355793 14:54922681-54922703 GTGCCAAGCTTGCCTTTGTCAGG + Intergenic
1119081990 14:71703566-71703588 ATGCTCAGGTTTTCTGTGTAGGG - Intronic
1119164169 14:72478668-72478690 ATGCCCAGATTCACTTTATAGGG + Intronic
1121091577 14:91186666-91186688 ATGCCCATGATGACTTTGTTAGG + Intronic
1122389107 14:101368205-101368227 ATGCCCCGGTTGCCATTGGGTGG + Intergenic
1123762891 15:23446582-23446604 ATGCCCAAGTTGCCTCTTTGAGG + Intronic
1123986274 15:25649147-25649169 CTGCCAAGGCTGCCTGTGTAGGG + Intergenic
1125170849 15:36764896-36764918 ATGCCTAGGTTGCCATTCCAGGG + Intronic
1127821839 15:62665218-62665240 ATGCCCAGCTAACTTTTGTATGG + Intronic
1128105414 15:65040899-65040921 AAAGTCAGGTTGCCTTTGTAAGG + Intergenic
1128689215 15:69710504-69710526 AGGGGCAGGCTGCCTTTGTACGG + Intergenic
1129054571 15:72809828-72809850 ATGCCCAGGTGGCTTCTGGAAGG + Intergenic
1139890402 16:70250005-70250027 ATTCCTAGGCTGCCTTTGTCGGG - Exonic
1143006779 17:3841673-3841695 ATGCCCAGCTAACCTTTTTATGG - Intronic
1144829463 17:18123237-18123259 CTGCCCCGGTTGCCATTGTTGGG - Intronic
1146948887 17:36892235-36892257 CTGGTCAGGTTGCCTTTGCATGG - Intergenic
1147720053 17:42534263-42534285 AAGCCCAGTTAACCTTTGTAGGG - Intergenic
1152518122 17:80838004-80838026 ATGCACAGGGTGCCCTTGGAGGG - Intronic
1160977346 19:1799791-1799813 ATGGCCTGGTTTCCTTTGGAGGG - Intronic
1165210655 19:34233071-34233093 ATGCCCATGTTGTGGTTGTAAGG + Intergenic
1167876351 19:52416662-52416684 CTGCACAGGGTGCATTTGTAAGG - Exonic
1168178826 19:54645484-54645506 ATGCCCAGGTGTTTTTTGTACGG - Intronic
924980313 2:213958-213980 ATGTCCAGGTTACCTTTTCATGG + Intergenic
929126335 2:38525480-38525502 ATGCACAGGTTGACTCTGGATGG - Intergenic
934551939 2:95268048-95268070 ATGCCCAGGATGCTTTTGTAAGG - Intergenic
938702388 2:133891194-133891216 ATGCCCAGGTTGCCTATCCATGG + Intergenic
940215970 2:151303917-151303939 ATGGCCAGGTGGCCTTTGGGTGG - Intergenic
948582315 2:238996675-238996697 TTGCCCAGGGTGCCTGTGGAGGG + Intergenic
1169100622 20:2945257-2945279 ATTCTCATGTTGCCTTTTTATGG + Intronic
1170417248 20:16157695-16157717 ATGCCCATATTGCTTGTGTAGGG + Intergenic
1175768514 20:61607766-61607788 ATGCAAAGGTTGCCTTGGGAAGG + Intronic
1181819434 22:25463938-25463960 ATGCCCATGTTGAATATGTAAGG - Intergenic
1184520484 22:44991099-44991121 AAGCCCAGGTTGCATTTCTCTGG - Intronic
950204597 3:11069121-11069143 ATGCCTAGGCTGCCTTTGTTGGG + Intergenic
951034986 3:17922955-17922977 CTGTCCAGGTTGCCTTTGCTTGG + Intronic
956613398 3:71146970-71146992 CTGTCCAGCTTGCCTTTGAATGG + Intronic
959562695 3:107800668-107800690 ATGTCCAAGTTGCCATAGTAGGG + Intronic
961509134 3:127390564-127390586 CTGCCCAGGTCACCTGTGTAAGG - Intergenic
962924360 3:139977730-139977752 ATGCCCAGGCTGCCTGTTCAGGG - Intronic
963292193 3:143503449-143503471 ATGCCCAGGATGCCCTTGAGGGG + Intronic
964434295 3:156635780-156635802 ATGCCCAGGAGGCATTTGGAAGG - Intergenic
965894930 3:173563992-173564014 AGGCCTTGTTTGCCTTTGTAGGG - Intronic
967057518 3:185842671-185842693 ATTCCCAGGTTGCTTTATTAAGG + Intergenic
968771381 4:2509715-2509737 ATACCCAGCTTGCCTGTGGATGG - Intronic
972771731 4:42203614-42203636 TGGCCCAGGTAGCCTTAGTAGGG - Intergenic
977121722 4:93110117-93110139 ATACCAAGTTTGCCTTAGTAAGG - Intronic
979312288 4:119217418-119217440 GTGCCTAGGTTGTCTTTGTTAGG + Intronic
984751610 4:183282640-183282662 ATGCCCAGGTTGCGTGTTCATGG + Intronic
985021964 4:185701323-185701345 AGGCCCAGGTTGGATCTGTAAGG - Intronic
989774870 5:45193087-45193109 ATGCCAAGATTGACTTTGAAGGG - Intergenic
990313931 5:54566712-54566734 ATGCCTAGGTTGCCAATGGAAGG - Intergenic
990735215 5:58853108-58853130 ATGCTAAGGTTTGCTTTGTAGGG - Exonic
991039972 5:62165081-62165103 CTGCTCAAGTAGCCTTTGTAGGG + Intergenic
992690665 5:79237171-79237193 AGGCCCAGGTGTCCTCTGTACGG + Exonic
992760671 5:79948582-79948604 ATGCCCAGCTAGTTTTTGTATGG - Intergenic
993014858 5:82523866-82523888 ATGCAAAGGTTGCCTTTGGCAGG - Intergenic
993033352 5:82729740-82729762 ATGACCATTTTGCCTTTATAAGG + Intergenic
994025334 5:95074946-95074968 ATGCCCAGCTTGGCTCTGTCGGG + Intronic
995399720 5:111727226-111727248 ATCACCAGGTTGCCTTTGGGAGG - Intronic
995424090 5:112000338-112000360 ATGCCCAGTTTGCCCTTGGCAGG - Intergenic
996306395 5:122053039-122053061 ATGCCCATGTTTCTTTTGTTGGG + Intronic
997779000 5:136638386-136638408 AAGCCCAGGTTACCTTCCTAGGG + Intergenic
1002457253 5:179352397-179352419 ATGCCAGGGTTGACTTTGGACGG + Intergenic
1003470130 6:6421845-6421867 ATGCCCACCTTGCCTTTGGCAGG + Intergenic
1003531159 6:6938723-6938745 ATCACCAGGTTGCCTAAGTAGGG - Intergenic
1007238961 6:40411506-40411528 AGGGCCATGTGGCCTTTGTAAGG - Intronic
1009809109 6:68638058-68638080 ATGCCCCACTTGCCTTTGCAGGG - Intronic
1012018870 6:93890340-93890362 ATGCTCATGTTGCCTTTTTTTGG + Intergenic
1015084959 6:129279446-129279468 ATGGCAAGGTTGCTTTTGTTTGG + Intronic
1017048619 6:150370134-150370156 ATGTCCAGGTGGCCTCTGTTTGG - Intronic
1018613491 6:165663723-165663745 AAGCCCAGTTTGCCTTGGTTGGG + Intronic
1022227133 7:28374833-28374855 ATGCCCAGGTAGCCCTTGATAGG + Intronic
1022623239 7:32006688-32006710 ATACCCAGCTTGCCTGTTTATGG - Intronic
1024683573 7:51719662-51719684 ATGCCCAGGAGTCCTTTGTGTGG - Intergenic
1029807372 7:103010885-103010907 ATGCCCATGTTTCTTTTGTTGGG - Intronic
1030815882 7:114036969-114036991 ATGTCCAGATTGTCTTTGTGTGG + Intronic
1032805508 7:135350171-135350193 ATGCCCAGGTTCCCGTGGTGGGG + Intergenic
1035555210 8:562658-562680 AGGGCCAGGTTTCCTTTGAATGG - Intergenic
1036820489 8:11935798-11935820 ATGTCCAGGCTTCCTTCGTATGG + Intergenic
1040682649 8:49832074-49832096 ATTCCTAGGTTGCCTTTGGTGGG + Intergenic
1046373760 8:113348382-113348404 ATCACCAGGTTGTCTTTGTTTGG - Intronic
1052250664 9:26393892-26393914 ATGCCCACATTTCCTTTGTTCGG + Intergenic
1054820895 9:69519462-69519484 ATACCCAAGTTGCCTTCATAAGG + Intronic
1057850250 9:98561120-98561142 AGGCCTAGGTTGGCTTTATATGG + Intronic
1059761512 9:117342166-117342188 AGACCCAGGATGCCTTTGTTCGG - Intronic
1060375663 9:123113649-123113671 ATGCTCAGGAAGCCTTTGTGGGG + Intronic
1062617281 9:137403537-137403559 AGGCCCAGGTTTCCTGGGTACGG - Intronic
1192046978 X:67686260-67686282 ATGGCCACGTTGCCTATGAAAGG - Intronic
1192849657 X:74941930-74941952 ATGCCCATGTTTCTTTTGTTGGG + Intergenic
1192925786 X:75753718-75753740 ATGCCCATATTTCCATTGTAAGG - Intergenic
1193951527 X:87806601-87806623 GTGCCCAGGCTGACTTTGAAGGG - Intergenic
1199362087 X:146933006-146933028 AGGACGAGGTTGCCTTTGTAGGG + Intergenic
1201145905 Y:11065551-11065573 ATGCCCAGGTGGCCTATTTTGGG - Intergenic